Motif J6_67899.1 Version J6_67899.1 of this group appears in releases 3.91 to 3.94

Download

Csv

Json

Pairwise interactions
Sequence variants
History

#S	Loop id	PDB	Disc	#Non-core	Chain(s)	Standardized name for chain		1		2		3		4		5		6	break		7		8		9		10		11		12		13		14		15		16	break		17		18		19		20		21	break		22		23		24		25		26	break		27		28		29		30		31		32		33		34		35		36	break		37		38		39	1-39	5-8	5-34	6-7	6-33	7-9	9-32	12-20	13-19	14-28	15-18	16-17	19-30	20-23	20-31	21-22	23-30	25-28	26-27	35-38	36-37
1	J6_8P9A_003	8P9A	0.0000	3	AR+AT	LSU rRNA + 5.8S rRNA	G	22	A	23	G	24	U	25	A	26	C	27	*	G	58	G	59	A	60	A	61	A	62	A	63	G	64	A	65	A	66	C	68	*	G	75	G	76	A	77	U	78	U	79	*	A	106	A	107	A	108	A	109	G	110	*	C	321	U	322	A	323	A	324	A	325	U	326	A	327	U	328	G	330	G	331	*	C	32	A	33	C	35	cWW	cWW	csS	cWW	cSs	ncsS	tHW	csS	cSs	tHW	tHS	cWW	tWW	ntHS	tWW	cWW	ncSs	tSs	cWW	cWW	cWW

3D structures

Complete motif including flanking bases

Sequence	Counts
GAGUACGGAAAAGAAACGGAUUAAAAGCUAAAUAUUGGCAUC	1

Non-Watson-Crick part of the motif

Sequence	Counts
AGUAGAAAAGAAAGAUAAAUAAAUAUUGAU	1

Release history

Release	3.91	3.92	3.93	3.94
Date	2024-12-04	2025-01-01	2025-01-29	2025-02-26
Status	New id, no parents	Exact match	Exact match	Exact match

Parent motifs

This motif has no parent motifs.

Children motifs

This motif has no children motifs.

Annotations: (1)
Basepair signature: cWW-F-cWW-F-cWW-F-cWW-cSS-cWW-cSS-tHW-tWW-F-tWW-F-F-cSS-tSS-tHW-cSS-cWW-tHS-cWW-F-F-cWW
Heat map statistics: Min 0.00 | Avg 0.00 | Max 0.00

Help

Coloring options: Nucleotide numbers

Copyright 2026 BGSU RNA group. Page generated in 0.2695 s