Equivalence class DNA_2.5_39407.1 Current
| # | IFE | Standardized name | Molecule | Organism | Source | Rfam | Title | Method | Res. Å | #NTs | Date |
|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 1S32|1|I+ 1S32|1|J (rep) | palindromic alpha-satellite 146 bp DNA fragment | Homo sapiens | Molecular Recognition of the Nucleosomal 'Supergroove' | X-ray diffraction | 2.05 | 292 | 2004-05-11 | |||
| 2 | 2NQB|1|I+ 2NQB|1|J | alpha-satellite DNA | Homo sapiens | Drosophila Nucleosome Structure | X-ray diffraction | 2.3 | 292 | 2007-09-11 | |||
| 3 | 3C1B|1|I+ 3C1B|1|J | Palindromic 146bp Human Alpha satellite DNA | The effect of H3 K79 dimethylation and H4 K20 trimethylation on nucleosome and chromatin structure | X-ray diffraction | 2.2 | 292 | 2008-10-07 | ||||
| 4 | 3AFA|1|I+ 3AFA|1|J | 146-MER DNA | The human nucleosome structure | X-ray diffraction | 2.5 | 292 | 2010-05-26 | ||||
| 5 | 2CV5|1|I+ 2CV5|1|J | DNA (146-MER) | Crystal structure of human nucleosome core particle | X-ray diffraction | 2.5 | 292 | 2005-06-28 | ||||
| 6 | 1KX3|1|I+ 1KX3|1|J | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3') | Homo sapiens | X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | X-ray diffraction | 2 | 292 | 2002-12-25 | |||
| 7 | 1P3I|1|I+ 1P3I|1|J | Palindromic 146bp Human Alpha-Satellite DNA fragment | Homo sapiens | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | X-ray diffraction | 2.3 | 292 | 2004-02-24 | |||
| 8 | 1P3L|1|I+ 1P3L|1|J | Palindromic 146bp Human Alpha-Satellite DNA fragment | Homo sapiens | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | X-ray diffraction | 2.4 | 292 | 2004-02-24 | |||
| 9 | 1M18|1|I+ 1M18|1|J | Palindromic 146 Base Pair DNA Fragment | LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA | X-ray diffraction | 2.45 | 292 | 2003-02-18 | ||||
| 10 | 1EQZ|1|I+ 1EQZ|1|J | 146 NUCLEOTIDES LONG DNA | X-RAY STRUCTURE OF THE NUCLEOSOME CORE PARTICLE AT 2.5 A RESOLUTION | X-ray diffraction | 2.5 | 292 | 2000-04-17 |
Release history
Parents
| This class | Parent classes | Release id | Intersection | Added to this class | Only in parent |
|---|
Children
| This class | Descendant classes | Release id | Intersection | Only in this class | Added to child |
|---|
Instances are ordered to put similar structures near each other. Select one instance to see its 3D structure. Selecting two or more instances will show their superposition, but only chains with identical numbers of observed nucleotides will superpose well. Large structures are slow to display; this tool is not designed for that.
| #S | View | PDB | Title | Method | Resolution | #NTs | NAKB NA annotation | NAKB protein annotation |
|---|---|---|---|---|---|---|---|---|
| 1 | 1S32|1|I+ 1S32|1|J | Molecular Recognition of the Nucleosomal 'Supergroove' | X-RAY DIFFRACTION | 2.05 | 292 | B-form double helix,double helix,structure | chromatin,nucleosome,structural | |
| 2 | 1EQZ|1|I+ 1EQZ|1|J | X-RAY STRUCTURE OF THE NUCLEOSOME CORE PARTICLE AT 2.5 A RESOLUTION | X-RAY DIFFRACTION | 2.5 | 292 | B-form double helix,double helix,structure | chromatin,nucleosome,structural | |
| 3 | 1KX3|1|I+ 1KX3|1|J | X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | X-RAY DIFFRACTION | 2 | 292 | B-form double helix,double helix,structure | chromatin,nucleosome,structural | |
| 4 | 1P3I|1|I+ 1P3I|1|J | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | X-RAY DIFFRACTION | 2.3 | 292 | B-form double helix,double helix,structure | chromatin,nucleosome,structural | |
| 5 | 1P3L|1|I+ 1P3L|1|J | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | X-RAY DIFFRACTION | 2.4 | 292 | B-form double helix,double helix,structure | chromatin,nucleosome,structural | |
| 6 | 3C1B|1|I+ 3C1B|1|J | The effect of H3 K79 dimethylation and H4 K20 trimethylation on nucleosome and chromatin structure | X-RAY DIFFRACTION | 2.2 | 292 | B-form double helix,double helix,structure | chromatin,nucleosome,structural | |
| 7 | 2NQB|1|I+ 2NQB|1|J | Drosophila Nucleosome Structure | X-RAY DIFFRACTION | 2.3 | 292 | B-form double helix,double helix,structure | chromatin,nucleosome,structural | |
| 8 | 1M18|1|I+ 1M18|1|J | LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA | X-RAY DIFFRACTION | 2.45 | 292 | B-form double helix,double helix,structure | chromatin,nucleosome,structural | |
| 9 | 3AFA|1|I+ 3AFA|1|J | The human nucleosome structure | X-RAY DIFFRACTION | 2.5 | 292 | B-form double helix,double helix,structure | chromatin,nucleosome,structural | |
| 10 | 2CV5|1|I+ 2CV5|1|J | Crystal structure of human nucleosome core particle | X-RAY DIFFRACTION | 2.5 | 292 | B-form double helix,double helix,structure | chromatin,nucleosome,structural |
Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. The ordering in the heat map is the same as in the table. The colorbar ranges from 0 to the maximum observed discrepancy. Click above the diagonal to select a range of structures, below the diagonal to select two structures.
Coloring options: