Equivalence class DNA_4.0_08888.1 Current
| # | IFE | Standardized name | Molecule | Organism | Source | Rfam | Title | Method | Res. Å | Date |
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 2PYO|1|I+ 2PYO|1|J (rep) | DNA (147-MER) | Homo sapiens | Drosophila nucleosome core | X-ray diffraction | 2.43 | 2007-11-06 | |||
| 2 | 3MVD|1|I+ 3MVD|1|J | DNA (146-MER) | Crystal structure of the chromatin factor RCC1 in complex with the nucleosome core particle | X-ray diffraction | 2.9 | 2010-08-25 | ||||
| 3 | 3MGR|1|I+ 3MGR|1|J | DNA (147-MER) | Binding of Rubidium ions to the Nucleosome Core Particle | X-ray diffraction | 2.3 | 2010-06-16 | ||||
| 4 | 3LJA|1|I+ 3LJA|1|J | 147mer DNA | Using Soft X-Rays for a Detailed Picture of Divalent Metal Binding in the Nucleosome | X-ray diffraction | 2.75 | 2010-04-14 | ||||
| 5 | 3MGP|1|I+ 3MGP|1|J | DNA (147-MER) | Binding of Cobalt ions to the Nucleosome Core Particle | X-ray diffraction | 2.44 | 2010-06-16 | ||||
| 6 | 3MGQ|1|I+ 3MGQ|1|J | DNA (147-MER) | Binding of Nickel ions to the Nucleosome Core Particle | X-ray diffraction | 2.65 | 2010-06-16 | ||||
| 7 | 3MGS|1|I+ 3MGS|1|J | DNA (147-MER) | Binding of Cesium ions to the Nucleosome Core particle | X-ray diffraction | 3.15 | 2010-06-16 | ||||
| 8 | 3LEL|1|I+ 3LEL|1|J | 147-MER DNA | Structural Insight into the Sequence-Dependence of Nucleosome Positioning | X-ray diffraction | 2.95 | 2010-05-19 | ||||
| 9 | 3LEL|1|S+ 3LEL|1|T | 147-MER DNA | Structural Insight into the Sequence-Dependence of Nucleosome Positioning | X-ray diffraction | 2.95 | 2010-05-19 | ||||
| 10 | 2FJ7|1|I+ 2FJ7|1|J | 147 bp DNA containing 16 bp poly dA element, 147 bp DNA containing 16 bp poly dT element | Crystal structure of Nucleosome Core Particle Containing a Poly (dA.dT) Sequence Element | X-ray diffraction | 3.2 | 2006-09-26 | ||||
| 11 | 3B6F|1|I+ 3B6F|1|J | 147-MER DNA | Homo sapiens | Nucleosome core particle treated with cisplatin | X-ray diffraction | 3.45 | 2007-12-25 | |||
| 12 | 3B6G|1|I+ 3B6G|1|J | 147-MER DNA | Homo sapiens | Nucleosome core particle treated with oxaliplatin | X-ray diffraction | 3.45 | 2007-12-25 | |||
| 13 | 1KX5|1|I+ 1KX5|1|J | DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') | Homo sapiens | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | X-ray diffraction | 1.94 | 2002-12-25 |
Parents
| This class | Parent classes | Release id | Intersection | Added to this class | Only in parent |
|---|
Children
| This class | Descendant classes | Release id | Intersection | Only in this class | Added to child |
|---|
Instances are ordered to put similar structures near each other. Select one instance to see its 3D structure. Selecting two or more instances will show their superposition, but only chains with identical numbers of observed nucleotides will superpose well. Large structures are slow to display; this tool is not designed for that.
| #S | View | PDB | Title | Method | Resolution | Length | NAKB NA annotation | NAKB protein annotation |
|---|---|---|---|---|---|---|---|---|
| 1 | 3MGQ|1|I+ 3MGQ|1|J | Binding of Nickel ions to the Nucleosome Core Particle | X-RAY DIFFRACTION | 2.65 | 147 | B-form double helix,double helix,structure | chromatin,nucleosome,structural | |
| 2 | 3MGP|1|I+ 3MGP|1|J | Binding of Cobalt ions to the Nucleosome Core Particle | X-RAY DIFFRACTION | 2.44 | 147 | B-form double helix,double helix,structure | chromatin,nucleosome,structural | |
| 3 | 3LEL|1|I+ 3LEL|1|J | Structural Insight into the Sequence-Dependence of Nucleosome Positioning | X-RAY DIFFRACTION | 2.95 | 147 | B-form double helix,double helix,structure | chromatin,nucleosome,structural | |
| 4 | 3LEL|1|S+ 3LEL|1|T | Structural Insight into the Sequence-Dependence of Nucleosome Positioning | X-RAY DIFFRACTION | 2.95 | 147 | B-form double helix,double helix,structure | chromatin,nucleosome,structural | |
| 5 | 1KX5|1|I+ 1KX5|1|J | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | X-RAY DIFFRACTION | 1.94 | 147 | B-form double helix,double helix,structure | chromatin,nucleosome,structural | |
| 6 | 2PYO|1|I+ 2PYO|1|J | Drosophila nucleosome core | X-RAY DIFFRACTION | 2.43 | 147 | B-form double helix,double helix,structure | chromatin,nucleosome,structural | |
| 7 | 3MGR|1|I+ 3MGR|1|J | Binding of Rubidium ions to the Nucleosome Core Particle | X-RAY DIFFRACTION | 2.3 | 147 | B-form double helix,double helix,structure | chromatin,nucleosome,structural | |
| 8 | 3MGS|1|I+ 3MGS|1|J | Binding of Cesium ions to the Nucleosome Core particle | X-RAY DIFFRACTION | 3.15 | 147 | B-form double helix,double helix,structure | chromatin,nucleosome,structural | |
| 9 | 3LJA|1|I+ 3LJA|1|J | Using Soft X-Rays for a Detailed Picture of Divalent Metal Binding in the Nucleosome | X-RAY DIFFRACTION | 2.75 | 147 | B-form double helix,double helix,structure | chromatin,nucleosome,structural | |
| 10 | 3B6G|1|I+ 3B6G|1|J | Nucleosome core particle treated with oxaliplatin | X-RAY DIFFRACTION | 3.45 | 147 | B-form double helix,double helix,structure | chromatin,nucleosome,structural | |
| 11 | 3B6F|1|I+ 3B6F|1|J | Nucleosome core particle treated with cisplatin | X-RAY DIFFRACTION | 3.45 | 147 | B-form double helix,double helix,structure | chromatin,nucleosome,structural | |
| 12 | 2FJ7|1|I+ 2FJ7|1|J | Crystal structure of Nucleosome Core Particle Containing a Poly (dA.dT) Sequence Element | X-RAY DIFFRACTION | 3.2 | 147 | double helix,structure | chromatin,nucleosome,structural | |
| 13 | 3MVD|1|I+ 3MVD|1|J | Crystal structure of the chromatin factor RCC1 in complex with the nucleosome core particle | X-RAY DIFFRACTION | 2.9 | 147 | B-form double helix,double helix,structure | cell cycle,chromatin,nucleosome,regulatory,structural |
Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. The ordering in the heat map is the same as in the table. The colorbar ranges from 0 to the maximum observed discrepancy. Click above the diagonal to select a range of structures, below the diagonal to select two structures.
Coloring options: