#IFEStandardized nameMoleculeOrganismSourceRfamTitleMethodRes. Å#NTsDate
12PYO|1|I+ 2PYO|1|J (rep)DNA (147-MER)Homo sapiensDrosophila nucleosome coreX-ray diffraction2.432942007-11-06
23MVD|1|I+ 3MVD|1|JDNA (146-MER)Crystal structure of the chromatin factor RCC1 in complex with the nucleosome core particleX-ray diffraction2.92922010-08-25
33MGR|1|I+ 3MGR|1|JDNA (147-MER)Binding of Rubidium ions to the Nucleosome Core ParticleX-ray diffraction2.32942010-06-16
43LJA|1|I+ 3LJA|1|J147mer DNAUsing Soft X-Rays for a Detailed Picture of Divalent Metal Binding in the NucleosomeX-ray diffraction2.752942010-04-14
53MGP|1|I+ 3MGP|1|JDNA (147-MER)Binding of Cobalt ions to the Nucleosome Core ParticleX-ray diffraction2.442942010-06-16
63MGQ|1|I+ 3MGQ|1|JDNA (147-MER)Binding of Nickel ions to the Nucleosome Core ParticleX-ray diffraction2.652942010-06-16
73MGS|1|I+ 3MGS|1|JDNA (147-MER)Binding of Cesium ions to the Nucleosome Core particleX-ray diffraction3.152942010-06-16
83LEL|1|I+ 3LEL|1|J147-MER DNAStructural Insight into the Sequence-Dependence of Nucleosome PositioningX-ray diffraction2.952942010-05-19
93LEL|1|S+ 3LEL|1|T147-MER DNAStructural Insight into the Sequence-Dependence of Nucleosome PositioningX-ray diffraction2.952942010-05-19
102FJ7|1|I+ 2FJ7|1|J147 bp DNA containing 16 bp poly dA element, 147 bp DNA containing 16 bp poly dT elementCrystal structure of Nucleosome Core Particle Containing a Poly (dA.dT) Sequence ElementX-ray diffraction3.22942006-09-26
113B6F|1|I+ 3B6F|1|J147-MER DNAHomo sapiensNucleosome core particle treated with cisplatinX-ray diffraction3.452942007-12-25
123B6G|1|I+ 3B6G|1|J147-MER DNAHomo sapiensNucleosome core particle treated with oxaliplatinX-ray diffraction3.452942007-12-25
131KX5|1|I+ 1KX5|1|JDNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3')Homo sapiensX-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A ResolutionX-ray diffraction1.942942002-12-25

Release history

Release0.10.20.30.40.50.6
Date2011-02-052011-02-122011-02-162011-02-192011-02-262011-03-05

Parents

This classParent classesRelease idIntersectionAdded to this classOnly in parent

Children

This class Descendant classesRelease idIntersectionOnly in this classAdded to child

Instances are ordered to put similar structures near each other. Select one instance to see its 3D structure. Selecting two or more instances will show their superposition, but only chains with identical numbers of observed nucleotides will superpose well. Large structures are slow to display; this tool is not designed for that.

#SViewPDBTitleMethodResolution#NTsNAKB NA annotationNAKB protein annotation
13MGQ|1|I+ 3MGQ|1|JBinding of Nickel ions to the Nucleosome Core ParticleX-RAY DIFFRACTION2.65294B-form double helix,double helix,structurechromatin,nucleosome,structural
23MGP|1|I+ 3MGP|1|JBinding of Cobalt ions to the Nucleosome Core ParticleX-RAY DIFFRACTION2.44294B-form double helix,double helix,structurechromatin,nucleosome,structural
33LEL|1|I+ 3LEL|1|JStructural Insight into the Sequence-Dependence of Nucleosome PositioningX-RAY DIFFRACTION2.95294B-form double helix,double helix,structurechromatin,nucleosome,structural
43LEL|1|S+ 3LEL|1|TStructural Insight into the Sequence-Dependence of Nucleosome PositioningX-RAY DIFFRACTION2.95294B-form double helix,double helix,structurechromatin,nucleosome,structural
51KX5|1|I+ 1KX5|1|JX-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A ResolutionX-RAY DIFFRACTION1.94294B-form double helix,double helix,structurechromatin,nucleosome,structural
62PYO|1|I+ 2PYO|1|JDrosophila nucleosome coreX-RAY DIFFRACTION2.43294B-form double helix,double helix,structurechromatin,nucleosome,structural
73MGR|1|I+ 3MGR|1|JBinding of Rubidium ions to the Nucleosome Core ParticleX-RAY DIFFRACTION2.3294B-form double helix,double helix,structurechromatin,nucleosome,structural
83MGS|1|I+ 3MGS|1|JBinding of Cesium ions to the Nucleosome Core particleX-RAY DIFFRACTION3.15294B-form double helix,double helix,structurechromatin,nucleosome,structural
93LJA|1|I+ 3LJA|1|JUsing Soft X-Rays for a Detailed Picture of Divalent Metal Binding in the NucleosomeX-RAY DIFFRACTION2.75294B-form double helix,double helix,structurechromatin,nucleosome,structural
103B6G|1|I+ 3B6G|1|JNucleosome core particle treated with oxaliplatinX-RAY DIFFRACTION3.45294B-form double helix,double helix,structurechromatin,nucleosome,structural
113B6F|1|I+ 3B6F|1|JNucleosome core particle treated with cisplatinX-RAY DIFFRACTION3.45294B-form double helix,double helix,structurechromatin,nucleosome,structural
122FJ7|1|I+ 2FJ7|1|JCrystal structure of Nucleosome Core Particle Containing a Poly (dA.dT) Sequence ElementX-RAY DIFFRACTION3.2294double helix,structurechromatin,nucleosome,structural
133MVD|1|I+ 3MVD|1|JCrystal structure of the chromatin factor RCC1 in complex with the nucleosome core particleX-RAY DIFFRACTION2.9292B-form double helix,double helix,structurecell cycle,chromatin,nucleosome,regulatory,structural

Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. The ordering in the heat map is the same as in the table. The colorbar ranges from 0 to the maximum observed discrepancy. Click above the diagonal to select a range of structures, below the diagonal to select two structures.


Coloring options:

Copyright 2025 BGSU RNA group. Page generated in 0.0349 s