Equivalence class DNA_4.0_98263.1 Current
| # | IFE | Standardized name | Molecule | Organism | Source | Rfam | Title | Method | Res. Å | Date |
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 1SL1|1|T+ 1SL1|1|P (rep) | 5'-D(*CP*CP*C*(TTD)P*AP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP*TP*CP*G)-3', 5'-D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*CP*GP*GP*CP*CP*AP*GP*TP*GP*CP*CP*TP*(2DA))-3' | Binary 5' complex of T7 DNA polymerase with a DNA primer/template containing a cis-syn thymine dimer on the template | X-ray diffraction | 2.2 | 2004-07-06 | ||||
| 2 | 1SKS|1|T+ 1SKS|1|P | 5'-D(*CP*CP*CP*(TTD)P*AP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP*TP*CP*G)-3', 5'-D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*C*GP*GP*CP*CP*AP*GP*TP*GP*CP*CP*(2DT))-3' | Binary 3' complex of T7 DNA polymerase with a DNA primer/template containing a cis-syn thymine dimer on the template | X-ray diffraction | 2.3 | 2004-07-06 | ||||
| 3 | 1R7M|1|C+ 1R7M|1|D | 5'-D(*CP*AP*CP*GP*CP*TP*AP*GP*GP*GP*AP*TP*AP*AP*CP*AP*GP*GP*GP*TP*AP*AP*TP*AP*C)-3', 5'-D(*GP*GP*TP*AP*TP*TP*AP*CP*CP*CP*TP*GP*TP*TP*AP*TP*CP*CP*CP*TP*AP*GP*CP*GP*T)-3' | The homing endonuclease I-SceI bound to its DNA recognition region | X-ray diffraction | 2.25 | 2004-10-26 | ||||
| 4 | 1R7M|1|E+ 1R7M|1|F | 5'-D(*CP*AP*CP*GP*CP*TP*AP*GP*GP*GP*AP*TP*AP*AP*CP*AP*GP*GP*GP*TP*AP*AP*TP*AP*C)-3', 5'-D(*GP*GP*TP*AP*TP*TP*AP*CP*CP*CP*TP*GP*TP*TP*AP*TP*CP*CP*CP*TP*AP*GP*CP*GP*T)-3' | The homing endonuclease I-SceI bound to its DNA recognition region | X-ray diffraction | 2.25 | 2004-10-26 | ||||
| 5 | 1SKW|1|T+ 1SKW|1|P | 5'-D(*CP*CP*CP*(TTD)P*AP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP*TP*CP*G)-3', 5'-D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*C*GP*GP*CP*CP*AP*GP*TP*GP*CP*CP*(2DT))-3' | Binary 3' complex of T7 DNA polymerase with a DNA primer/template containing a disordered cis-syn thymine dimer on the template | X-ray diffraction | 2.3 | 2004-07-06 | ||||
| 6 | 1SL2|1|T+ 1SL2|1|P | 5'-D(*CP*CP*CP*(TTD)P*AP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP*TP*CP*G)-3', 5'-D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*CP*GP*GP*CP*CP*AP*GP*TP*GP*CP*CP*TP*(2DA))-3' | Ternary 5' complex of T7 DNA polymerase with a DNA primer/template containing a cis-syn thymine dimer on the template and an incoming nucleotide | X-ray diffraction | 2.3 | 2004-07-06 | ||||
| 7 | 3OOR|1|C+ 3OOR|1|D | 5'-D(*CP*AP*CP*GP*CP*TP*AP*GP*GP*GP*AP*TP*AP*AP*CP*CP*GP*GP*GP*TP*AP*AP*TP*AP*C)-3', 5'-D(*GP*GP*TP*AP*TP*TP*AP*CP*CP*CP*GP*GP*TP*TP*AP*TP*CP*CP*CP*TP*AP*GP*CP*GP*T)-3' | I-SceI mutant (K86R/G100T)complexed with C/G+4 DNA substrate | X-ray diffraction | 2.5 | 2010-11-17 | ||||
| 8 | 3OOL|1|C+ 3OOL|1|D | 5'-D(*CP*AP*CP*GP*CP*TP*AP*GP*GP*GP*AP*TP*AP*AP*CP*CP*GP*GP*GP*TP*AP*AP*TP*AP*C)-3', 5'-D(*GP*GP*TP*AP*TP*TP*AP*CP*CP*CP*GP*GP*TP*TP*AP*TP*CP*CP*CP*TP*AP*GP*CP*GP*T)-3' | I-SceI complexed with C/G+4 DNA substrate | X-ray diffraction | 2.3 | 2010-11-17 | ||||
| 9 | 2O93|1|A+ 2O93|1|B | kappaB enhancer element, DNA 25-mer | Crystal structure of NFAT bound to the HIV-1 LTR tandem kappaB enhancer element | X-ray diffraction | 3.05 | 2007-06-19 | ||||
| 10 | 2V6E|1|C+ 2V6E|1|E+ 2V6E|1|D+ 2V6E|1|F | TELRL | Ravinvirus N15 | protelomerase TelK complexed with substrate DNA | X-ray diffraction | 3.2 | 2007-10-02 | |||
| 11 | 1SL0|1|T+ 1SL0|1|P | 5'-D(*CP*CP*CP*(TTD)P*AP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP*TP*CP*G)-3', 5'-D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*CP*GP*GP*CP*CP*AP*GP*TP*GP*CP*CP*(2DT))-3' | Ternary 3' complex of T7 DNA polymerase with a DNA primer/template containing a disordered cis-syn thymine dimer on the template and an incoming nucleotide | X-ray diffraction | 3.2 | 2004-07-06 | ||||
| 12 | 1SL0|1|U+ 1SL0|1|Q | 5'-D(*CP*CP*CP*(TTD)P*AP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP*TP*CP*G)-3', 5'-D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*CP*GP*GP*CP*CP*AP*GP*TP*GP*CP*CP*(2DT))-3' | Ternary 3' complex of T7 DNA polymerase with a DNA primer/template containing a disordered cis-syn thymine dimer on the template and an incoming nucleotide | X-ray diffraction | 3.2 | 2004-07-06 | ||||
| 13 | 1SAX|1|C+ 1SAX|1|D | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3' | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | X-ray diffraction | 2.8 | 2004-04-27 | ||||
| 14 | 1Z63|1|C+ 1Z63|1|D | 5'-D(*AP*AP*AP*AP*AP*A*AP*TP*TP*GP*CP*CP*GP*AP*AP*GP*AP*CP*GP*AP*AP*AP*AP*AP*A)-3', 5'-D(*TP*TP*TP*TP*TP*TP*TP*CP*GP*TP*CP*TP*TP*CP*GP*GP*CP*AP*AP*TP*TP*TP*TP*TP*T)-3' | Sulfolobus solfataricus SWI2/SNF2 ATPase core in complex with dsDNA | X-ray diffraction | 3 | 2005-05-17 | ||||
| 15 | 1Z63|1|E+ 1Z63|1|F | 5'-D(*AP*AP*AP*AP*AP*A*AP*TP*TP*GP*CP*CP*GP*AP*AP*GP*AP*CP*GP*AP*AP*AP*AP*AP*A)-3', 5'-D(*TP*TP*TP*TP*TP*TP*TP*CP*GP*TP*CP*TP*TP*CP*GP*GP*CP*AP*AP*TP*TP*TP*TP*TP*T)-3' | Sulfolobus solfataricus SWI2/SNF2 ATPase core in complex with dsDNA | X-ray diffraction | 3 | 2005-05-17 |
Parents
| This class | Parent classes | Release id | Intersection | Added to this class | Only in parent |
|---|
Children
| This class | Descendant classes | Release id | Intersection | Only in this class | Added to child |
|---|
Instances are ordered to put similar structures near each other. Select one instance to see its 3D structure. Selecting two or more instances will show their superposition, but only chains with identical numbers of observed nucleotides will superpose well. Large structures are slow to display; this tool is not designed for that.
| #S | View | PDB | Title | Method | Resolution | Length | NAKB NA annotation | NAKB protein annotation |
|---|---|---|---|---|---|---|---|---|
| 1 | 1R7M|1|C+ 1R7M|1|D | The homing endonuclease I-SceI bound to its DNA recognition region | X-RAY DIFFRACTION | 2.25 | 25 | B-form double helix,double helix,structure | enzyme,hydrolase,nuclease | |
| 2 | 3OOL|1|C+ 3OOL|1|D | I-SceI complexed with C/G+4 DNA substrate | X-RAY DIFFRACTION | 2.3 | 25 | B-form double helix,double helix,structure | enzyme,hydrolase,nuclease | |
| 3 | 3OOR|1|C+ 3OOR|1|D | I-SceI mutant (K86R/G100T)complexed with C/G+4 DNA substrate | X-RAY DIFFRACTION | 2.5 | 25 | B-form double helix,double helix,structure | enzyme,hydrolase,nuclease | |
| 4 | 1R7M|1|E+ 1R7M|1|F | The homing endonuclease I-SceI bound to its DNA recognition region | X-RAY DIFFRACTION | 2.25 | 25 | B-form double helix,double helix,structure | enzyme,hydrolase,nuclease | |
| 5 | 1SL0|1|U+ 1SL0|1|Q | Ternary 3' complex of T7 DNA polymerase with a DNA primer/template containing a disordered cis-syn thymine dimer on the template and an incoming nucleotide | X-RAY DIFFRACTION | 3.2 | 25 | double helix,structure | enzyme,oxidoreductase,polymerase,transferase | |
| 6 | 1SL0|1|T+ 1SL0|1|P | Ternary 3' complex of T7 DNA polymerase with a DNA primer/template containing a disordered cis-syn thymine dimer on the template and an incoming nucleotide | X-RAY DIFFRACTION | 3.2 | 25 | double helix,structure | enzyme,oxidoreductase,polymerase,transferase | |
| 7 | 1SKS|1|T+ 1SKS|1|P | Binary 3' complex of T7 DNA polymerase with a DNA primer/template containing a cis-syn thymine dimer on the template | X-RAY DIFFRACTION | 2.3 | 25 | double helix,structure | enzyme,oxidoreductase,polymerase,transferase | |
| 8 | 1SKW|1|T+ 1SKW|1|P | Binary 3' complex of T7 DNA polymerase with a DNA primer/template containing a disordered cis-syn thymine dimer on the template | X-RAY DIFFRACTION | 2.3 | 25 | double helix,structure | enzyme,oxidoreductase,polymerase,transferase | |
| 9 | 1SL1|1|T+ 1SL1|1|P | Binary 5' complex of T7 DNA polymerase with a DNA primer/template containing a cis-syn thymine dimer on the template | X-RAY DIFFRACTION | 2.2 | 25 | double helix,structure | enzyme,oxidoreductase,polymerase,transferase | |
| 10 | 1Z63|1|C+ 1Z63|1|D | Sulfolobus solfataricus SWI2/SNF2 ATPase core in complex with dsDNA | X-RAY DIFFRACTION | 3 | 25 | B-form double helix,double helix,structure | enzyme,helicase,hydrolase | |
| 11 | 1SL2|1|T+ 1SL2|1|P | Ternary 5' complex of T7 DNA polymerase with a DNA primer/template containing a cis-syn thymine dimer on the template and an incoming nucleotide | X-RAY DIFFRACTION | 2.3 | 25 | B-form double helix,double helix,structure | enzyme,oxidoreductase,polymerase,transferase | |
| 12 | 1Z63|1|E+ 1Z63|1|F | Sulfolobus solfataricus SWI2/SNF2 ATPase core in complex with dsDNA | X-RAY DIFFRACTION | 3 | 25 | B-form double helix,double helix,structure | enzyme,helicase,hydrolase | |
| 13 | 1SAX|1|C+ 1SAX|1|D | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | X-RAY DIFFRACTION | 2.8 | 25 | B-form double helix,double helix,structure | DNA-binding transcription factor (TF),helix-turn-helix (HTH),regulatory,transcription,winged helix/forkhead | |
| 14 | 2V6E|1|C+ 2V6E|1|E+ 2V6E|1|D+ 2V6E|1|F | protelomerase TelK complexed with substrate DNA | X-RAY DIFFRACTION | 3.2 | 25 | B-form double helix,double helix,structure | enzyme,hydrolase | |
| 15 | 2O93|1|A+ 2O93|1|B | Crystal structure of NFAT bound to the HIV-1 LTR tandem kappaB enhancer element | X-RAY DIFFRACTION | 3.05 | 25 | B-form double helix,double helix,structure | DNA-binding transcription factor (TF),immunoglobulin (Ig) fold,regulatory,rel homology,transcription |
Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. The ordering in the heat map is the same as in the table. The colorbar ranges from 0 to the maximum observed discrepancy. Click above the diagonal to select a range of structures, below the diagonal to select two structures.
Coloring options: