Equivalence class NR_20.0_26150.2 Obsolete
| # | IFE | Standardized name | Molecule | Organism | Source | Rfam | Title | Method | Res. Å | #NTs | Date |
|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 4V9F|1|0 (rep) | Large subunit ribosomal RNA | 23S Ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | The re-refined crystal structure of the Haloarcula marismortui large ribosomal subunit at 2.4 Angstrom resolution: more complete structure of the L7/L12 and L1 stalk, L5 and LX proteins | X-ray diffraction | 2.4 | 2808 | 2014-07-09 |
| 2 | 1S72|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARGE RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTION | X-ray diffraction | 2.4 | 2754 | 2004-06-15 |
| 3 | 1JJ2|1|0 | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Fully Refined Crystal Structure of the Haloarcula marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution | X-ray diffraction | 2.4 | 2754 | 2001-08-01 |
| 4 | 1YI2|1|0 | Large subunit ribosomal RNA | 23S Ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure Of Erythromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | X-ray diffraction | 2.65 | 2754 | 2005-04-26 |
| 5 | 3CCU|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482C | X-ray diffraction | 2.8 | 2754 | 2008-05-20 |
| 6 | 3CCL|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535C. Density for Anisomycin is visible but not included in model. | X-ray diffraction | 2.9 | 2754 | 2008-05-20 |
| 7 | 1YHQ|1|0 | Large subunit ribosomal RNA | 23S Ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure Of Azithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | X-ray diffraction | 2.4 | 2754 | 2005-04-26 |
| 8 | 1YIJ|1|0 | Large subunit ribosomal RNA | 23S Ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure Of Telithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | X-ray diffraction | 2.6 | 2754 | 2005-04-26 |
| 9 | 3CMA|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA, RNA (5'-R(*CP*CP*(8AN))-3') | Haloarcula marismortui | Archaea | RF02540 | The structure of CCA and CCA-Phe-Cap-Bio bound to the large ribosomal subunit of Haloarcula marismortui | X-ray diffraction | 2.8 | 2754 | 2008-09-23 |
| 10 | 3CCV|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2616A | X-ray diffraction | 2.9 | 2754 | 2008-05-20 |
| 11 | 3G6E|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of Homoharringtonine bound to the large ribosomal subunit | X-ray diffraction | 2.7 | 2754 | 2009-04-28 |
| 12 | 3G71|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of Bruceantin bound to the large ribosomal subunit | X-ray diffraction | 2.85 | 2754 | 2009-04-28 |
| 13 | 3CD6|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Co-cystal of large Ribosomal Subunit mutant G2616A with CC-Puromycin | X-ray diffraction | 2.75 | 2754 | 2008-05-20 |
| 14 | 2QEX|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Negamycin Binds to the Wall of the Nascent Chain Exit Tunnel of the 50S Ribosomal Subunit | X-ray diffraction | 2.9 | 2754 | 2008-09-30 |
| 15 | 3CCM|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2611U | X-ray diffraction | 2.55 | 2754 | 2008-05-20 |
| 16 | 3I56|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of Triacetyloleandomcyin Bound to the Large Ribosomal Subunit | X-ray diffraction | 2.9 | 2754 | 2010-03-09 |
| 17 | 2OTL|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Girodazole bound to the large subunit of Haloarcula marismortui | X-ray diffraction | 2.7 | 2754 | 2007-04-03 |
| 18 | 3CCS|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482A | X-ray diffraction | 2.95 | 2754 | 2008-05-20 |
| 19 | 1YJN|1|0 | Large subunit ribosomal RNA | 23S Ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure Of Clindamycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | X-ray diffraction | 3 | 2754 | 2005-04-26 |
| 20 | 1YJ9|1|0 | Large subunit ribosomal RNA | 23S Ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure Of The Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui Containing a three residue deletion in L22 | X-ray diffraction | 2.8 | 2754 | 2005-04-26 |
| 21 | 3CC4|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal Subunit | X-ray diffraction | 2.7 | 2754 | 2008-05-20 |
| 22 | 3CCQ|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488U | X-ray diffraction | 2.9 | 2754 | 2008-05-20 |
| 23 | 1YIT|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure Of Virginiamycin M and S Bound To The 50S Ribosomal Subunit Of Haloarcula Marismortui | X-ray diffraction | 2.8 | 2754 | 2005-04-26 |
| 24 | 3CC2|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | The Refined Crystal Structure of the Haloarcula Marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution with rrnA Sequence for the 23S rRNA and Genome-derived Sequences for r-Proteins | X-ray diffraction | 2.4 | 2754 | 2008-05-20 |
| 25 | 1KQS|1|0 | Large subunit ribosomal RNA | 23S RRNA, CC-Pmn-pcb, CCA | Haloarcula marismortui | Archaea | RF02540 | The Haloarcula marismortui 50S Complexed with a Pretranslocational Intermediate in Protein Synthesis | X-ray diffraction | 3.1 | 2754 | 2002-02-22 |
| 26 | 2OTJ|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | 13-deoxytedanolide bound to the large subunit of Haloarcula marismortui | X-ray diffraction | 2.9 | 2754 | 2007-04-03 |
| 27 | 3CCR|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488C. Density for anisomycin is visible but not included in the model. | X-ray diffraction | 3 | 2754 | 2008-05-20 |
| 28 | 3CC7|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2487U | X-ray diffraction | 2.7 | 2754 | 2008-05-20 |
| 29 | 3G4S|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of Tiamulin bound to the large ribosomal subunit | X-ray diffraction | 3.2 | 2754 | 2009-04-28 |
| 30 | 3I55|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of Mycalamide A Bound to the Large Ribosomal Subunit | X-ray diffraction | 3.11 | 2754 | 2010-03-09 |
| 31 | 2QA4|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | A more complete structure of the the L7/L12 stalk of the Haloarcula marismortui 50S large ribosomal subunit | X-ray diffraction | 3 | 2753 | 2008-04-01 |
| 32 | 3CCJ|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2534U | X-ray diffraction | 3.3 | 2754 | 2008-05-20 |
| 33 | 3CCE|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535A | X-ray diffraction | 2.75 | 2754 | 2008-05-20 |
| 34 | 3OW2|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure of Enhanced Macrolide Bound to 50S Ribosomal Subunit | X-ray diffraction | 2.7 | 2754 | 2012-06-20 |
| 35 | 1VQO|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna | Haloarcula marismortui | Archaea | RF02540 | The structure of CCPMN bound to the large ribosomal subunit haloarcula marismortui | X-ray diffraction | 2.2 | 2754 | 2005-11-29 |
| 36 | 1VQ8|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-R(*CP*CP*(DA)*(PHE)*(ACA))-3' | Haloarcula marismortui | Archaea | RF02540 | The structure of CCDA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortui | X-ray diffraction | 2.2 | 2754 | 2005-11-29 |
| 37 | 1VQP|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-R(*(DC)P*(DC)P*(PPU)*(LOF)P*(PO2)P*AP*C*C)-3' | Haloarcula marismortui | Archaea | RF02540 | The structure of the transition state analogue 'RAP' bound to the large ribosomal subunit of haloarcula marismortui | X-ray diffraction | 2.25 | 2754 | 2005-11-29 |
| 38 | 1VQK|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna | Haloarcula marismortui | Archaea | RF02540 | The structure of CCDA-PHE-CAP-BIO bound to the a site of the ribosomal subunit of haloarcula marismortui | X-ray diffraction | 2.3 | 2754 | 2005-11-29 |
| 39 | 1VQN|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-R(*CP*CP*AP*(PHE)*(ACA)*(BTN))-3' | Haloarcula marismortui | Archaea | RF02540 | The structure of CC-HPMN AND CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortui | X-ray diffraction | 2.4 | 2754 | 2005-11-29 |
| 40 | 1VQ9|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-R(*CP*CP*AP*(PHE)*(ACA))-3' | Haloarcula marismortui | Archaea | RF02540 | The structure of CCA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortui | X-ray diffraction | 2.4 | 2754 | 2005-11-29 |
| 41 | 1VQ7|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-R(*CP*CP*(5AA)P*(2OP)P*(PAE)P*AP*C*C)-3') | Haloarcula marismortui | Archaea | RF02540 | The structure of the transition state analogue 'DCA' bound to the large ribosomal subunit of haloarcula marismortui | X-ray diffraction | 2.5 | 2754 | 2005-11-29 |
| 42 | 1VQ4|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-R(*CP*CP*(5AA)P*(2OP)P*(PO2)P*(DA)P*C*C)-3') | Haloarcula marismortui | Archaea | RF02540 | The structure of the transition state analogue 'DAA' bound to the large ribosomal subunit of Haloarcula marismortui | X-ray diffraction | 2.7 | 2754 | 2005-11-29 |
| 43 | 1VQ6|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-R(*CP*CP*AP*(PHE)*(ACA)*(BTN))-3' | Haloarcula marismortui | Archaea | RF02540 | The structure of c-hpmn and CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortui | X-ray diffraction | 2.7 | 2754 | 2005-11-29 |
| 44 | 3CPW|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA, 5'-R(*CP*CP*AP*(PHE)*(ACA))-3' | Haloarcula marismortui | Archaea | RF02540 | The structure of the antibiotic LINEZOLID bound to the large ribosomal subunit of HALOARCULA MARISMORTUI | X-ray diffraction | 2.7 | 2754 | 2008-07-22 |
| 45 | 3CME|1|0 | Large subunit ribosomal RNA | 50S RIBOSOMAL RNA, RNA (5'-R(*CP*CP*(8AN))-3') | Haloarcula marismortui | Archaea | RF02540 | The Structure of CA and CCA-PHE-CAP-BIO Bound to the Large Ribosomal Subunit of Haloarcula Marismortui | X-ray diffraction | 2.95 | 2754 | 2008-09-23 |
| 46 | 1M90|1|A | Large subunit ribosomal RNA | 23S RRNA, CCA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of CCA-Phe-caproic acid-biotin and sparsomycin bound to the 50S ribosomal subunit | X-ray diffraction | 2.8 | 2754 | 2002-09-06 |
| 47 | 3CXC|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA, 5'-R(*CP*CP*A)-3' | Haloarcula marismortui | Archaea | RF02540 | The structure of an enhanced oxazolidinone inhibitor bound to the 50S ribosomal subunit of H. marismortui | X-ray diffraction | 3 | 2754 | 2009-04-28 |
| 48 | 1QVG|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, Oligonucleotide CCA | Haloarcula marismortui | Archaea | RF02540 | Structure of CCA oligonucleotide bound to the tRNA binding sites of the large ribosomal subunit of Haloarcula marismortui | X-ray diffraction | 2.9 | 2754 | 2003-11-11 |
| 49 | 1NJI|1|A | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of chloramphenicol bound to the 50S ribosomal subunit | X-ray diffraction | 3 | 2754 | 2003-07-22 |
| 50 | 1VQ5|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-D(*(DC)P*(DC)P*(5AA)P*(2OP)P*(PO2)P*AP*C*C)-3') | Haloarcula marismortui | Archaea | RF02540 | The structure of the transition state analogue 'RAA' bound to the large ribosomal subunit of haloarcula marismortui | X-ray diffraction | 2.6 | 2754 | 2005-11-29 |
| 51 | 1KC8|1|A | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal Structure of Blasticidin S Bound to the 50S Ribosomal Subunit | X-ray diffraction | 3.01 | 2754 | 2003-07-22 |
| 52 | 1K73|1|A | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal Subunit | X-ray diffraction | 3.01 | 2754 | 2003-07-22 |
| 53 | 1Q81|1|A | Large subunit ribosomal RNA | 23S ribosomal rna, minihelix-puromycin | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure of minihelix with 3' puromycin bound to A-site of the 50S ribosomal subunit. | X-ray diffraction | 2.95 | 2754 | 2003-10-07 |
| 54 | 1Q82|1|A | Large subunit ribosomal RNA | 23S ribosomal rna, CC-puromycin | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure of CC-Puromycin bound to the A-site of the 50S ribosomal subunit | X-ray diffraction | 2.98 | 2754 | 2003-10-07 |
| 55 | 1QVF|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna | Haloarcula marismortui | Archaea | RF02540 | Structure of a deacylated tRNA minihelix bound to the E site of the large ribosomal subunit of Haloarcula marismortui | X-ray diffraction | 3.1 | 2754 | 2003-11-11 |
| 56 | 1K9M|1|A | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of tylosin bound to the 50S ribosomal subunit of Haloarcula marismortui | X-ray diffraction | 3 | 2754 | 2002-07-19 |
| 57 | 1KD1|1|A | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal Structure of Spiramycin bound to the 50S Ribosomal Subunit of Haloarcula marismortui | X-ray diffraction | 3 | 2754 | 2002-07-19 |
| 58 | 1K8A|1|A | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortui | X-ray diffraction | 3 | 2754 | 2002-07-19 |
| 59 | 1M1K|1|A | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of azithromycin bound to the 50S ribosomal subunit of Haloarcula marismortui | X-ray diffraction | 3.2 | 2754 | 2002-07-19 |
| 60 | 1Q86|1|A | Large subunit ribosomal RNA | 23S ribosomal rna, CCA-phenylalanine-cariotic-acid-biotin | Haloarcula marismortui | Archaea | RF02540 | Crystal structure of CCA-Phe-cap-biotin bound simultaneously at half occupancy to both the A-site and P-site of the the 50S ribosomal Subunit. | X-ray diffraction | 3 | 2754 | 2003-10-07 |
| 61 | 1Q7Y|1|A | Large subunit ribosomal RNA | 23S ribosomal rna | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure of CCdAP-Puromycin bound at the Peptidyl transferase center of the 50S ribosomal subunit | X-ray diffraction | 3.2 | 2754 | 2003-10-07 |
| 62 | 1FFK|1|0 | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | X-ray diffraction | 2.4 | 2706 | 2000-08-14 |
| 63 | 1FG0|1|A | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | Haloarcula marismortui | Archaea | RF02540 | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | X-ray diffraction | 3 | 496 | 2000-08-28 |
| 64 | 1FFZ|1|A | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | X-ray diffraction | 3.2 | 496 | 2000-08-28 |
| 65 | 1N8R|1|A | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of large ribosomal subunit in complex with virginiamycin M | X-ray diffraction | 3 | 2754 | 2003-07-22 |
| 66 | 1W2B|1|0 | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Trigger Factor ribosome binding domain in complex with 50S | X-ray diffraction | 3.5 | 2754 | 2004-09-02 |
Release history
| Release | 3.0 | 3.1 | 3.2 | 3.3 | 3.4 | 3.5 | 3.6 | 3.7 | 3.8 | 3.9 | 3.10 | 3.11 | 3.12 | 3.13 | 3.14 | 3.15 | 3.16 | 3.17 | 3.18 | 3.19 | 3.20 | 3.21 | 3.22 | 3.23 | 3.24 | 3.25 | 3.26 | 3.27 | 3.28 | 3.29 | 3.30 | 3.31 | 3.32 | 3.33 | 3.34 | 3.35 | 3.36 | 3.37 | 3.38 | 3.39 | 3.40 | 3.41 | 3.42 | 3.43 | 3.44 | 3.45 | 3.46 | 3.47 | 3.48 | 3.49 | 3.50 | 3.51 | 3.52 | 3.53 | 3.54 | 3.55 | 3.56 | 3.57 | 3.58 | 3.59 | 3.60 | 3.61 | 3.62 | 3.63 | 3.64 | 3.65 | 3.66 | 3.67 | 3.68 | 3.69 | 3.70 | 3.71 | 3.72 | 3.73 | 3.74 | 3.75 | 3.76 | 3.77 | 3.78 | 3.79 | 3.80 | 3.81 | 3.82 | 3.83 | 3.84 | 3.85 | 3.86 | 3.87 | 3.88 | 3.89 | 3.90 | 3.91 | 3.92 | 3.93 | 3.94 | 3.95 | 3.96 | 3.97 | 3.98 | 3.99 | 3.100 | 3.101 | 3.102 | 3.103 | 3.104 | 3.105 | 3.106 | 3.107 | 3.108 | 3.109 | 3.110 | 3.111 | 3.112 | 3.113 | 3.114 | 3.115 | 3.116 | 3.117 | 3.118 | 3.119 | 3.120 | 3.121 | 3.122 | 3.123 | 3.124 | 3.125 | 3.126 | 3.127 | 3.128 | 3.129 | 3.130 | 3.131 | 3.132 | 3.133 | 3.134 | 3.135 | 3.136 | 3.137 | 3.138 | 3.139 | 3.140 | 3.141 | 3.142 | 3.143 | 3.144 | 3.145 | 3.146 | 3.147 | 3.148 | 3.149 | 3.150 | 3.151 | 3.152 | 3.153 | 3.154 | 3.155 | 3.156 | 3.157 | 3.158 | 3.159 | 3.160 | 3.161 | 3.162 | 3.163 | 3.164 | 3.165 | 3.166 | 3.167 | 3.168 | 3.169 | 3.170 | 3.171 | 3.172 | 3.173 | 3.174 | 3.175 | 3.176 | 3.177 | 3.178 | 3.179 | 3.180 | 3.181 | 3.182 | 3.183 | 3.184 | 3.185 | 3.186 | 3.187 | 3.188 | 3.189 | 3.190 | 3.191 | 3.192 | 3.193 | 3.194 | 3.195 | 3.196 | 3.197 | 3.198 | 3.199 | 3.200 | 3.201 | 3.202 | 3.203 | 3.204 | 3.205 | 3.206 | 3.207 | 3.208 | 3.209 | 3.210 | 3.211 | 3.212 | 3.213 | 3.214 | 3.215 | 3.216 | 3.217 | 3.218 | 3.219 | 3.220 | 3.221 | 3.222 | 3.223 | 3.224 | 3.225 | 3.226 | 3.227 | 3.228 | 3.229 | 3.230 | 3.231 | 3.232 | 3.233 | 3.234 | 3.235 | 3.236 | 3.237 | 3.238 | 3.239 | 3.240 | 3.241 | 3.242 | 3.243 | 3.244 | 3.245 | 3.246 | 3.247 | 3.248 | 3.249 | 3.250 | 3.251 | 3.252 | 3.253 | 3.254 | 3.255 | 3.256 | 3.257 | 3.258 | 3.259 | 3.260 | 3.261 | 3.262 | 3.263 | 3.264 | 3.265 | 3.266 | 3.267 | 3.268 | 3.269 | 3.270 | 3.271 | 3.272 | 3.273 | 3.274 | 3.275 | 3.276 | 3.277 | 3.278 | 3.279 | 3.280 | 3.281 | 3.282 | 3.283 | 3.284 | 3.285 | 3.286 | 3.287 | 3.288 | 3.289 | 3.290 | 3.291 | 3.292 | 3.293 | 3.294 | 3.295 | 3.296 | 3.297 | 3.298 | 3.299 | 3.300 | 3.301 | 3.302 | 3.303 | 3.304 | 3.305 | 3.306 | 3.307 | 3.308 | 3.309 | 3.310 | 3.311 | 3.312 | 3.313 | 3.314 | 3.315 | 3.316 | 3.317 | 3.318 | 3.319 | 3.320 | 3.321 | 3.322 | 3.323 | 3.324 | 3.325 | 3.326 | 3.327 | 3.328 | 3.329 | 3.330 | 3.331 | 3.332 | 3.333 | 3.334 | 3.335 | 3.336 | 3.337 | 3.338 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Date | 2017-12-15 | 2017-12-22 | 2017-12-29 | 2018-01-05 | 2018-01-12 | 2018-01-19 | 2018-01-26 | 2018-02-02 | 2018-02-09 | 2018-02-16 | 2018-02-23 | 2018-03-01 | 2018-03-08 | 2018-03-15 | 2018-03-22 | 2018-03-29 | 2018-04-06 | 2018-04-13 | 2018-04-20 | 2018-04-27 | 2018-05-04 | 2018-05-11 | 2018-05-18 | 2018-05-25 | 2018-06-01 | 2018-06-08 | 2018-06-15 | 2018-06-22 | 2018-06-29 | 2018-07-06 | 2018-07-13 | 2018-07-20 | 2018-07-27 | 2018-08-03 | 2018-08-10 | 2018-08-17 | 2018-08-24 | 2018-08-31 | 2018-09-07 | 2018-09-14 | 2018-09-21 | 2018-09-28 | 2018-10-05 | 2018-10-12 | 2018-10-19 | 2018-10-26 | 2018-11-02 | 2018-11-09 | 2018-11-16 | 2018-11-23 | 2018-11-30 | 2018-12-07 | 2018-12-14 | 2018-12-21 | 2018-12-28 | 2019-01-04 | 2019-01-11 | 2019-01-18 | 2019-01-25 | 2019-02-01 | 2019-02-08 | 2019-02-15 | 2019-02-22 | 2019-03-01 | 2019-03-08 | 2019-03-15 | 2019-03-22 | 2019-03-29 | 2019-04-05 | 2019-04-12 | 2019-04-19 | 2019-04-26 | 2019-05-03 | 2019-05-10 | 2019-05-17 | 2019-05-24 | 2019-05-31 | 2019-06-07 | 2019-06-14 | 2019-06-21 | 2019-06-28 | 2019-07-05 | 2019-07-12 | 2019-07-19 | 2019-07-26 | 2019-08-02 | 2019-08-09 | 2019-08-16 | 2019-08-23 | 2019-08-28 | 2019-09-04 | 2019-09-11 | 2019-09-19 | 2019-09-25 | 2019-10-03 | 2019-10-09 | 2019-10-16 | 2019-10-23 | 2019-10-30 | 2019-11-06 | 2019-11-13 | 2019-11-20 | 2019-11-27 | 2019-12-04 | 2019-12-11 | 2019-12-18 | 2019-12-25 | 2020-01-01 | 2020-01-08 | 2020-01-15 | 2020-01-22 | 2020-01-29 | 2020-02-05 | 2020-02-12 | 2020-02-19 | 2020-02-26 | 2020-03-04 | 2020-03-11 | 2020-03-18 | 2020-03-25 | 2020-04-01 | 2020-04-08 | 2020-04-15 | 2020-04-22 | 2020-04-29 | 2020-05-06 | 2020-05-13 | 2020-05-20 | 2020-05-27 | 2020-06-03 | 2020-06-10 | 2020-06-17 | 2020-06-24 | 2020-07-01 | 2020-07-08 | 2020-07-15 | 2020-07-22 | 2020-07-29 | 2020-08-05 | 2020-08-12 | 2020-08-19 | 2020-08-26 | 2020-09-02 | 2020-09-09 | 2020-09-16 | 2020-09-23 | 2020-09-30 | 2020-10-07 | 2020-10-14 | 2020-10-21 | 2020-10-28 | 2020-11-04 | 2020-11-11 | 2020-11-18 | 2020-11-25 | 2020-12-02 | 2020-12-09 | 2020-12-16 | 2020-12-23 | 2020-12-30 | 2021-01-06 | 2021-01-13 | 2021-01-20 | 2021-01-27 | 2021-02-03 | 2021-02-10 | 2021-02-17 | 2021-02-24 | 2021-03-03 | 2021-03-10 | 2021-03-17 | 2021-03-24 | 2021-03-31 | 2021-04-07 | 2021-04-14 | 2021-04-21 | 2021-04-28 | 2021-05-05 | 2021-05-12 | 2021-05-19 | 2021-05-26 | 2021-06-02 | 2021-06-09 | 2021-06-16 | 2021-06-23 | 2021-06-30 | 2021-07-07 | 2021-07-14 | 2021-07-21 | 2021-07-28 | 2021-08-04 | 2021-08-11 | 2021-08-18 | 2021-08-25 | 2021-09-01 | 2021-09-08 | 2021-09-15 | 2021-09-22 | 2021-09-29 | 2021-10-06 | 2021-10-13 | 2021-10-20 | 2021-10-27 | 2021-11-03 | 2021-11-10 | 2021-11-17 | 2021-11-24 | 2021-12-01 | 2021-12-08 | 2021-12-15 | 2021-12-22 | 2021-12-29 | 2022-01-05 | 2022-01-12 | 2022-01-19 | 2022-01-26 | 2022-02-02 | 2022-02-09 | 2022-02-16 | 2022-02-23 | 2022-03-02 | 2022-03-09 | 2022-03-16 | 2022-03-23 | 2022-03-30 | 2022-04-06 | 2022-04-13 | 2022-04-20 | 2022-04-27 | 2022-05-04 | 2022-05-11 | 2022-05-18 | 2022-05-25 | 2022-06-01 | 2022-06-08 | 2022-06-15 | 2022-06-22 | 2022-06-29 | 2022-07-06 | 2022-07-13 | 2022-07-20 | 2022-07-27 | 2022-08-03 | 2022-08-10 | 2022-08-17 | 2022-08-24 | 2022-08-31 | 2022-09-07 | 2022-09-14 | 2022-09-21 | 2022-09-28 | 2022-10-05 | 2022-10-12 | 2022-10-19 | 2022-10-26 | 2022-11-02 | 2022-11-09 | 2022-11-16 | 2022-11-23 | 2022-11-30 | 2022-12-07 | 2022-12-14 | 2022-12-21 | 2022-12-28 | 2023-01-04 | 2023-01-11 | 2023-01-18 | 2023-01-25 | 2023-02-01 | 2023-02-08 | 2023-02-15 | 2023-02-22 | 2023-03-01 | 2023-03-08 | 2023-03-15 | 2023-03-22 | 2023-03-29 | 2023-04-05 | 2023-04-12 | 2023-04-19 | 2023-04-26 | 2023-05-03 | 2023-05-10 | 2023-05-17 | 2023-05-24 | 2023-05-31 | 2023-06-07 | 2023-06-14 | 2023-06-21 | 2023-06-28 | 2023-07-05 | 2023-07-12 | 2023-07-19 | 2023-07-26 | 2023-08-02 | 2023-08-09 | 2023-08-16 | 2023-08-23 | 2023-08-30 | 2023-09-06 | 2023-09-13 | 2023-09-20 | 2023-09-27 | 2023-10-04 | 2023-10-11 | 2023-10-18 | 2023-10-25 | 2023-11-01 | 2023-11-08 | 2023-11-15 | 2023-11-24 | 2023-11-29 | 2023-12-06 | 2023-12-13 | 2023-12-20 | 2023-12-27 | 2024-01-03 | 2024-01-10 | 2024-01-17 | 2024-01-24 | 2024-01-31 | 2024-02-07 | 2024-02-14 | 2024-02-21 | 2024-02-28 | 2024-03-06 | 2024-03-13 | 2024-03-20 | 2024-03-27 | 2024-04-03 | 2024-04-10 | 2024-04-17 | 2024-04-24 | 2024-05-01 | 2024-05-08 | 2024-05-15 | 2024-05-22 | 2024-05-29 | 2024-06-05 |
Parents
| This class | Parent classes | Release id | Intersection | Added to this class | Only in parent |
|---|---|---|---|---|---|
| NR_20.0_26150.2 | NR_20.0_26150.1 | 3.0 | (66) 1FFK|1|0, 1FFZ|1|A, 1FG0|1|A, 1JJ2|1|0, 1K73|1|A, 1K8A|1|A, 1K9M|1|A, 1KC8|1|A, 1KD1|1|A, 1KQS|1|0, 1M1K|1|A, 1M90|1|A, 1N8R|1|A, 1NJI|1|A, 1Q7Y|1|A, 1Q81|1|A, 1Q82|1|A, 1Q86|1|A, 1QVF|1|0, 1QVG|1|0, 1S72|1|0, 1VQ4|1|0, 1VQ5|1|0, 1VQ6|1|0, 1VQ7|1|0, 1VQ8|1|0, 1VQ9|1|0, 1VQK|1|0, 1VQN|1|0, 1VQO|1|0, 1VQP|1|0, 1W2B|1|0, 1YHQ|1|0, 1YI2|1|0, 1YIJ|1|0, 1YIT|1|0, 1YJ9|1|0, 1YJN|1|0, 2OTJ|1|0, 2OTL|1|0, 2QA4|1|0, 2QEX|1|0, 3CC2|1|0, 3CC4|1|0, 3CC7|1|0, 3CCE|1|0, 3CCJ|1|0, 3CCL|1|0, 3CCM|1|0, 3CCQ|1|0, 3CCR|1|0, 3CCS|1|0, 3CCU|1|0, 3CCV|1|0, 3CD6|1|0, 3CMA|1|0, 3CME|1|0, 3CPW|1|0, 3CXC|1|0, 3G4S|1|0, 3G6E|1|0, 3G71|1|0, 3I55|1|0, 3I56|1|0, 3OW2|1|0, 4V9F|1|0 | (0) | (3) 1VQL|1|0, 1VQM|1|0, 1YJW|1|0 |
Children
| This class | Descendant classes | Release id | Intersection | Only in this class | Added to child |
|---|
Instances are ordered to put similar structures near each other. Select one instance to see its 3D structure. Selecting two or more instances will show their superposition, but only chains with identical numbers of observed nucleotides will superpose well. Large structures are slow to display; this tool is not designed for that.
| #S | View | PDB | Title | Method | Resolution | #NTs |
|---|---|---|---|---|---|---|
| 1 | 3OW2|1|0 | Crystal Structure of Enhanced Macrolide Bound to 50S Ribosomal Subunit | X-RAY DIFFRACTION | 2.7 | 2754 | |
| 2 | 3CME|1|0 | The Structure of CA and CCA-PHE-CAP-BIO Bound to the Large Ribosomal Subunit of Haloarcula Marismortui | X-RAY DIFFRACTION | 2.95 | 2754 | |
| 3 | 3CCM|1|0 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2611U | X-RAY DIFFRACTION | 2.55 | 2754 | |
| 4 | 3CMA|1|0 | The structure of CCA and CCA-Phe-Cap-Bio bound to the large ribosomal subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 2.8 | 2754 | |
| 5 | 1VQ9|1|0 | The structure of CCA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.4 | 2754 | |
| 6 | 1VQ8|1|0 | The structure of CCDA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.2 | 2754 | |
| 7 | 1VQP|1|0 | The structure of the transition state analogue 'RAP' bound to the large ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.25 | 2754 | |
| 8 | 1VQN|1|0 | The structure of CC-HPMN AND CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.4 | 2754 | |
| 9 | 1VQK|1|0 | The structure of CCDA-PHE-CAP-BIO bound to the a site of the ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.3 | 2754 | |
| 10 | 1VQO|1|0 | The structure of CCPMN bound to the large ribosomal subunit haloarcula marismortui | X-RAY DIFFRACTION | 2.2 | 2754 | |
| 11 | 3CPW|1|0 | The structure of the antibiotic LINEZOLID bound to the large ribosomal subunit of HALOARCULA MARISMORTUI | X-RAY DIFFRACTION | 2.7 | 2754 | |
| 12 | 3CCL|1|0 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535C. Density for Anisomycin is visible but not included in model. | X-RAY DIFFRACTION | 2.9 | 2754 | |
| 13 | 3CCQ|1|0 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488U | X-RAY DIFFRACTION | 2.9 | 2754 | |
| 14 | 3CC7|1|0 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2487U | X-RAY DIFFRACTION | 2.7 | 2754 | |
| 15 | 3CCE|1|0 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535A | X-RAY DIFFRACTION | 2.75 | 2754 | |
| 16 | 3CCU|1|0 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482C | X-RAY DIFFRACTION | 2.8 | 2754 | |
| 17 | 3CCV|1|0 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2616A | X-RAY DIFFRACTION | 2.9 | 2754 | |
| 18 | 3CC4|1|0 | Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal Subunit | X-RAY DIFFRACTION | 2.7 | 2754 | |
| 19 | 2OTJ|1|0 | 13-deoxytedanolide bound to the large subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 2.9 | 2754 | |
| 20 | 3G71|1|0 | Co-crystal structure of Bruceantin bound to the large ribosomal subunit | X-RAY DIFFRACTION | 2.85 | 2754 | |
| 21 | 3G6E|1|0 | Co-crystal structure of Homoharringtonine bound to the large ribosomal subunit | X-RAY DIFFRACTION | 2.7 | 2754 | |
| 22 | 1YHQ|1|0 | Crystal Structure Of Azithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | X-RAY DIFFRACTION | 2.4 | 2754 | |
| 23 | 3CC2|1|0 | The Refined Crystal Structure of the Haloarcula Marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution with rrnA Sequence for the 23S rRNA and Genome-derived Sequences for r-Proteins | X-RAY DIFFRACTION | 2.4 | 2754 | |
| 24 | 3I56|1|0 | Co-crystal structure of Triacetyloleandomcyin Bound to the Large Ribosomal Subunit | X-RAY DIFFRACTION | 2.9 | 2754 | |
| 25 | 1YJ9|1|0 | Crystal Structure Of The Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui Containing a three residue deletion in L22 | X-RAY DIFFRACTION | 2.8 | 2754 | |
| 26 | 2OTL|1|0 | Girodazole bound to the large subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 2.7 | 2754 | |
| 27 | 1YJN|1|0 | Crystal Structure Of Clindamycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | X-RAY DIFFRACTION | 3 | 2754 | |
| 28 | 1YIT|1|0 | Crystal Structure Of Virginiamycin M and S Bound To The 50S Ribosomal Subunit Of Haloarcula Marismortui | X-RAY DIFFRACTION | 2.8 | 2754 | |
| 29 | 1YIJ|1|0 | Crystal Structure Of Telithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | X-RAY DIFFRACTION | 2.6 | 2754 | |
| 30 | 1YI2|1|0 | Crystal Structure Of Erythromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | X-RAY DIFFRACTION | 2.65 | 2754 | |
| 31 | 1M90|1|A | Co-crystal structure of CCA-Phe-caproic acid-biotin and sparsomycin bound to the 50S ribosomal subunit | X-RAY DIFFRACTION | 2.8 | 2754 | |
| 32 | 1M1K|1|A | Co-crystal structure of azithromycin bound to the 50S ribosomal subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 3.2 | 2754 | |
| 33 | 1QVF|1|0 | Structure of a deacylated tRNA minihelix bound to the E site of the large ribosomal subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 3.1 | 2754 | |
| 34 | 1K73|1|A | Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal Subunit | X-RAY DIFFRACTION | 3.01 | 2754 | |
| 35 | 1JJ2|1|0 | Fully Refined Crystal Structure of the Haloarcula marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution | X-RAY DIFFRACTION | 2.4 | 2754 | |
| 36 | 1S72|1|0 | REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARGE RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTION | X-RAY DIFFRACTION | 2.4 | 2754 | |
| 37 | 1NJI|1|A | Structure of chloramphenicol bound to the 50S ribosomal subunit | X-RAY DIFFRACTION | 3 | 2754 | |
| 38 | 1KC8|1|A | Co-crystal Structure of Blasticidin S Bound to the 50S Ribosomal Subunit | X-RAY DIFFRACTION | 3.01 | 2754 | |
| 39 | 1Q82|1|A | Crystal Structure of CC-Puromycin bound to the A-site of the 50S ribosomal subunit | X-RAY DIFFRACTION | 2.98 | 2754 | |
| 40 | 1N8R|1|A | Structure of large ribosomal subunit in complex with virginiamycin M | X-RAY DIFFRACTION | 3 | 2754 | |
| 41 | 1K8A|1|A | Co-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 3 | 2754 | |
| 42 | 1K9M|1|A | Co-crystal structure of tylosin bound to the 50S ribosomal subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 3 | 2754 | |
| 43 | 1KD1|1|A | Co-crystal Structure of Spiramycin bound to the 50S Ribosomal Subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 3 | 2754 | |
| 44 | 1KQS|1|0 | The Haloarcula marismortui 50S Complexed with a Pretranslocational Intermediate in Protein Synthesis | X-RAY DIFFRACTION | 3.1 | 2754 | |
| 45 | 1W2B|1|0 | Trigger Factor ribosome binding domain in complex with 50S | X-RAY DIFFRACTION | 3.5 | 2754 | |
| 46 | 3I55|1|0 | Co-crystal structure of Mycalamide A Bound to the Large Ribosomal Subunit | X-RAY DIFFRACTION | 3.11 | 2754 | |
| 47 | 3CD6|1|0 | Co-cystal of large Ribosomal Subunit mutant G2616A with CC-Puromycin | X-RAY DIFFRACTION | 2.75 | 2754 | |
| 48 | 3CCS|1|0 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482A | X-RAY DIFFRACTION | 2.95 | 2754 | |
| 49 | 3CCR|1|0 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488C. Density for anisomycin is visible but not included in the model. | X-RAY DIFFRACTION | 3 | 2754 | |
| 50 | 3CCJ|1|0 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2534U | X-RAY DIFFRACTION | 3.3 | 2754 | |
| 51 | 3G4S|1|0 | Co-crystal structure of Tiamulin bound to the large ribosomal subunit | X-RAY DIFFRACTION | 3.2 | 2754 | |
| 52 | 1FFK|1|0 | CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | X-RAY DIFFRACTION | 2.4 | 2706 | |
| 53 | 4V9F|1|0 | The re-refined crystal structure of the Haloarcula marismortui large ribosomal subunit at 2.4 Angstrom resolution: more complete structure of the L7/L12 and L1 stalk, L5 and LX proteins | X-RAY DIFFRACTION | 2.4 | 2808 | |
| 54 | 1QVG|1|0 | Structure of CCA oligonucleotide bound to the tRNA binding sites of the large ribosomal subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 2.9 | 2754 | |
| 55 | 1VQ7|1|0 | The structure of the transition state analogue 'DCA' bound to the large ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.5 | 2754 | |
| 56 | 1VQ5|1|0 | The structure of the transition state analogue 'RAA' bound to the large ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.6 | 2754 | |
| 57 | 1VQ4|1|0 | The structure of the transition state analogue 'DAA' bound to the large ribosomal subunit of Haloarcula marismortui | X-RAY DIFFRACTION | 2.7 | 2754 | |
| 58 | 1VQ6|1|0 | The structure of c-hpmn and CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortui | X-RAY DIFFRACTION | 2.7 | 2754 | |
| 59 | 1Q86|1|A | Crystal structure of CCA-Phe-cap-biotin bound simultaneously at half occupancy to both the A-site and P-site of the the 50S ribosomal Subunit. | X-RAY DIFFRACTION | 3 | 2754 | |
| 60 | 3CXC|1|0 | The structure of an enhanced oxazolidinone inhibitor bound to the 50S ribosomal subunit of H. marismortui | X-RAY DIFFRACTION | 3 | 2754 | |
| 61 | 1Q7Y|1|A | Crystal Structure of CCdAP-Puromycin bound at the Peptidyl transferase center of the 50S ribosomal subunit | X-RAY DIFFRACTION | 3.2 | 2754 | |
| 62 | 1Q81|1|A | Crystal Structure of minihelix with 3' puromycin bound to A-site of the 50S ribosomal subunit. | X-RAY DIFFRACTION | 2.95 | 2754 | |
| 63 | 2QA4|1|0 | A more complete structure of the the L7/L12 stalk of the Haloarcula marismortui 50S large ribosomal subunit | X-RAY DIFFRACTION | 3 | 2753 | |
| 64 | 2QEX|1|0 | Negamycin Binds to the Wall of the Nascent Chain Exit Tunnel of the 50S Ribosomal Subunit | X-RAY DIFFRACTION | 2.9 | 2754 | |
| 65 | 1FG0|1|A | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | X-RAY DIFFRACTION | 3 | 496 | |
| 66 | 1FFZ|1|A | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | X-RAY DIFFRACTION | 3.2 | 496 |
Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. The ordering in the heat map is the same as in the table. The colorbar ranges from 0 to the maximum observed discrepancy. Click above the diagonal to select a range of structures, below the diagonal to select two structures.
Coloring options: