#IFEStandardized nameMoleculeOrganismSourceRfamTitleMethodRes. Å#NTsDate
14V9F|1|0 (rep)Large subunit ribosomal RNA23S Ribosomal RNAHaloarcula marismortuiArchaeaRF02540The re-refined crystal structure of the Haloarcula marismortui large ribosomal subunit at 2.4 Angstrom resolution: more complete structure of the L7/L12 and L1 stalk, L5 and LX proteinsX-ray diffraction2.428082014-07-09
21S72|1|0Large subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF02540REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARGE RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTIONX-ray diffraction2.427542004-06-15
31JJ2|1|0Large subunit ribosomal RNA23S RRNAHaloarcula marismortuiArchaeaRF02540Fully Refined Crystal Structure of the Haloarcula marismortui Large Ribosomal Subunit at 2.4 Angstrom ResolutionX-ray diffraction2.427542001-08-01
41YI2|1|0Large subunit ribosomal RNA23S Ribosomal RNAHaloarcula marismortuiArchaeaRF02540Crystal Structure Of Erythromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-ray diffraction2.6527542005-04-26
53CCU|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482CX-ray diffraction2.827542008-05-20
63CCL|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535C. Density for Anisomycin is visible but not included in model.X-ray diffraction2.927542008-05-20
71YHQ|1|0Large subunit ribosomal RNA23S Ribosomal RNAHaloarcula marismortuiArchaeaRF02540Crystal Structure Of Azithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-ray diffraction2.427542005-04-26
81YIJ|1|0Large subunit ribosomal RNA23S Ribosomal RNAHaloarcula marismortuiArchaeaRF02540Crystal Structure Of Telithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-ray diffraction2.627542005-04-26
93CMA|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNA, RNA (5'-R(*CP*CP*(8AN))-3')Haloarcula marismortuiArchaeaRF02540The structure of CCA and CCA-Phe-Cap-Bio bound to the large ribosomal subunit of Haloarcula marismortuiX-ray diffraction2.827542008-09-23
103CCV|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2616AX-ray diffraction2.927542008-05-20
113G6E|1|0Large subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF02540Co-crystal structure of Homoharringtonine bound to the large ribosomal subunitX-ray diffraction2.727542009-04-28
123G71|1|0Large subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF02540Co-crystal structure of Bruceantin bound to the large ribosomal subunitX-ray diffraction2.8527542009-04-28
133CD6|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Co-cystal of large Ribosomal Subunit mutant G2616A with CC-PuromycinX-ray diffraction2.7527542008-05-20
141YJW|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Crystal Structure Of Quinupristin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-ray diffraction2.927542005-04-26
152QEX|1|0Large subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF02540Negamycin Binds to the Wall of the Nascent Chain Exit Tunnel of the 50S Ribosomal SubunitX-ray diffraction2.927542008-09-30
163CCM|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2611UX-ray diffraction2.5527542008-05-20
173I56|1|0Large subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF02540Co-crystal structure of Triacetyloleandomcyin Bound to the Large Ribosomal SubunitX-ray diffraction2.927542010-03-09
182OTL|1|0Large subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF02540Girodazole bound to the large subunit of Haloarcula marismortuiX-ray diffraction2.727542007-04-03
193CCS|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482AX-ray diffraction2.9527542008-05-20
201YJN|1|0Large subunit ribosomal RNA23S Ribosomal RNAHaloarcula marismortuiArchaeaRF02540Crystal Structure Of Clindamycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-ray diffraction327542005-04-26
211YJ9|1|0Large subunit ribosomal RNA23S Ribosomal RNAHaloarcula marismortuiArchaeaRF02540Crystal Structure Of The Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui Containing a three residue deletion in L22X-ray diffraction2.827542005-04-26
223CC4|1|0Large subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF02540Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal SubunitX-ray diffraction2.727542008-05-20
233CCQ|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488UX-ray diffraction2.927542008-05-20
241YIT|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Crystal Structure Of Virginiamycin M and S Bound To The 50S Ribosomal Subunit Of Haloarcula MarismortuiX-ray diffraction2.827542005-04-26
253CC2|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540The Refined Crystal Structure of the Haloarcula Marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution with rrnA Sequence for the 23S rRNA and Genome-derived Sequences for r-ProteinsX-ray diffraction2.427542008-05-20
262OTJ|1|0Large subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF0254013-deoxytedanolide bound to the large subunit of Haloarcula marismortuiX-ray diffraction2.927542007-04-03
273CCR|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488C. Density for anisomycin is visible but not included in the model.X-ray diffraction327542008-05-20
283CC7|1|0Large subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF02540Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2487UX-ray diffraction2.727542008-05-20
292QA4|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540A more complete structure of the the L7/L12 stalk of the Haloarcula marismortui 50S large ribosomal subunitX-ray diffraction327532008-04-01
303CCE|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535AX-ray diffraction2.7527542008-05-20
313OW2|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Crystal Structure of Enhanced Macrolide Bound to 50S Ribosomal SubunitX-ray diffraction2.727542012-06-20
321VQO|1|0Large subunit ribosomal RNA23S ribosomal rnaHaloarcula marismortuiArchaeaRF02540The structure of CCPMN bound to the large ribosomal subunit haloarcula marismortuiX-ray diffraction2.227542005-11-29
331VQ8|1|0Large subunit ribosomal RNA23S ribosomal rna, 5'-R(*CP*CP*(DA)*(PHE)*(ACA))-3'Haloarcula marismortuiArchaeaRF02540The structure of CCDA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortuiX-ray diffraction2.227542005-11-29
341VQM|1|0Large subunit ribosomal RNA23S ribosomal rnaHaloarcula marismortuiArchaeaRF02540The structure of the transition state analogue 'DAN' bound to the large ribosomal subunit of haloarcula marismortuiX-ray diffraction2.327542005-11-29
351VQP|1|0Large subunit ribosomal RNA23S ribosomal rna, 5'-R(*(DC)P*(DC)P*(PPU)*(LOF)P*(PO2)P*AP*C*C)-3'Haloarcula marismortuiArchaeaRF02540The structure of the transition state analogue 'RAP' bound to the large ribosomal subunit of haloarcula marismortuiX-ray diffraction2.2527542005-11-29
361VQK|1|0Large subunit ribosomal RNA23S ribosomal rnaHaloarcula marismortuiArchaeaRF02540The structure of CCDA-PHE-CAP-BIO bound to the a site of the ribosomal subunit of haloarcula marismortuiX-ray diffraction2.327542005-11-29
371VQL|1|0Large subunit ribosomal RNA23S ribosomal rnaHaloarcula marismortuiArchaeaRF02540The structure of the transition state analogue 'DCSN' bound to the large ribosomal subunit of haloarcula marismortuiX-ray diffraction2.327542005-11-29
381VQN|1|0Large subunit ribosomal RNA23S ribosomal rna, 5'-R(*CP*CP*AP*(PHE)*(ACA)*(BTN))-3'Haloarcula marismortuiArchaeaRF02540The structure of CC-HPMN AND CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortuiX-ray diffraction2.427542005-11-29
391VQ9|1|0Large subunit ribosomal RNA23S ribosomal rna, 5'-R(*CP*CP*AP*(PHE)*(ACA))-3'Haloarcula marismortuiArchaeaRF02540The structure of CCA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortuiX-ray diffraction2.427542005-11-29
401VQ7|1|0Large subunit ribosomal RNA23S ribosomal rna, 5'-R(*CP*CP*(5AA)P*(2OP)P*(PAE)P*AP*C*C)-3')Haloarcula marismortuiArchaeaRF02540The structure of the transition state analogue 'DCA' bound to the large ribosomal subunit of haloarcula marismortuiX-ray diffraction2.527542005-11-29
411VQ4|1|0Large subunit ribosomal RNA23S ribosomal rna, 5'-R(*CP*CP*(5AA)P*(2OP)P*(PO2)P*(DA)P*C*C)-3')Haloarcula marismortuiArchaeaRF02540The structure of the transition state analogue 'DAA' bound to the large ribosomal subunit of Haloarcula marismortuiX-ray diffraction2.727542005-11-29
421VQ6|1|0Large subunit ribosomal RNA23S ribosomal rna, 5'-R(*CP*CP*AP*(PHE)*(ACA)*(BTN))-3'Haloarcula marismortuiArchaeaRF02540The structure of c-hpmn and CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortuiX-ray diffraction2.727542005-11-29
433CPW|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNA, 5'-R(*CP*CP*AP*(PHE)*(ACA))-3'Haloarcula marismortuiArchaeaRF02540The structure of the antibiotic LINEZOLID bound to the large ribosomal subunit of HALOARCULA MARISMORTUIX-ray diffraction2.727542008-07-22
443CME|1|0Large subunit ribosomal RNA50S RIBOSOMAL RNA, RNA (5'-R(*CP*CP*(8AN))-3')Haloarcula marismortuiArchaeaRF02540The Structure of CA and CCA-PHE-CAP-BIO Bound to the Large Ribosomal Subunit of Haloarcula MarismortuiX-ray diffraction2.9527542008-09-23
451M90|1|ALarge subunit ribosomal RNA23S RRNA, CCAHaloarcula marismortuiArchaeaRF02540Co-crystal structure of CCA-Phe-caproic acid-biotin and sparsomycin bound to the 50S ribosomal subunitX-ray diffraction2.827542002-09-06
463CXC|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNA, 5'-R(*CP*CP*A)-3'Haloarcula marismortuiArchaeaRF02540The structure of an enhanced oxazolidinone inhibitor bound to the 50S ribosomal subunit of H. marismortuiX-ray diffraction327542009-04-28
471QVG|1|0Large subunit ribosomal RNA23S ribosomal rna, Oligonucleotide CCAHaloarcula marismortuiArchaeaRF02540Structure of CCA oligonucleotide bound to the tRNA binding sites of the large ribosomal subunit of Haloarcula marismortuiX-ray diffraction2.927542003-11-11
481NJI|1|ALarge subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF02540Structure of chloramphenicol bound to the 50S ribosomal subunitX-ray diffraction327542003-07-22
491VQ5|1|0Large subunit ribosomal RNA23S ribosomal rna, 5'-D(*(DC)P*(DC)P*(5AA)P*(2OP)P*(PO2)P*AP*C*C)-3')Haloarcula marismortuiArchaeaRF02540The structure of the transition state analogue 'RAA' bound to the large ribosomal subunit of haloarcula marismortuiX-ray diffraction2.627542005-11-29
501Q81|1|ALarge subunit ribosomal RNA23S ribosomal rna, minihelix-puromycinHaloarcula marismortuiArchaeaRF02540Crystal Structure of minihelix with 3' puromycin bound to A-site of the 50S ribosomal subunit.X-ray diffraction2.9527542003-10-07
511Q82|1|ALarge subunit ribosomal RNA23S ribosomal rna, CC-puromycinHaloarcula marismortuiArchaeaRF02540Crystal Structure of CC-Puromycin bound to the A-site of the 50S ribosomal subunitX-ray diffraction2.9827542003-10-07
521K9M|1|ALarge subunit ribosomal RNA23S RRNAHaloarcula marismortuiArchaeaRF02540Co-crystal structure of tylosin bound to the 50S ribosomal subunit of Haloarcula marismortuiX-ray diffraction327542002-07-19
531KD1|1|ALarge subunit ribosomal RNA23S RRNAHaloarcula marismortuiArchaeaRF02540Co-crystal Structure of Spiramycin bound to the 50S Ribosomal Subunit of Haloarcula marismortuiX-ray diffraction327542002-07-19
541K8A|1|ALarge subunit ribosomal RNA23S RRNAHaloarcula marismortuiArchaeaRF02540Co-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortuiX-ray diffraction327542002-07-19
551Q86|1|ALarge subunit ribosomal RNA23S ribosomal rna, CCA-phenylalanine-cariotic-acid-biotinHaloarcula marismortuiArchaeaRF02540Crystal structure of CCA-Phe-cap-biotin bound simultaneously at half occupancy to both the A-site and P-site of the the 50S ribosomal Subunit.X-ray diffraction327542003-10-07
561FFK|1|0Large subunit ribosomal RNA23S RRNAHaloarcula marismortuiArchaeaRF02540CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTIONX-ray diffraction2.427062000-08-14
571FG0|1|ALarge subunit ribosomal RNA23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3'Haloarcula marismortuiArchaeaRF02540LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUNDX-ray diffraction34962000-08-28
581N8R|1|ALarge subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF02540Structure of large ribosomal subunit in complex with virginiamycin MX-ray diffraction327542003-07-22

Release history

Release3.3393.3403.3413.3423.3433.3443.3453.3463.3473.3483.3493.3503.3513.3523.3533.3543.3553.3563.3573.3583.3593.3603.3613.3623.3633.3643.3653.3663.3673.3683.3693.3703.3713.3723.3733.3743.3753.3763.377
Date2024-06-122024-06-192024-06-262024-07-032024-07-102024-07-172024-07-252024-07-312024-08-072024-08-142024-08-212024-08-282024-09-042024-09-112024-09-182024-09-252024-10-022024-10-092024-10-162024-10-232024-10-302024-11-062024-11-132024-11-202024-11-272024-12-042024-12-112024-12-182024-12-252025-01-012025-01-082025-01-152025-01-222025-01-292025-02-052025-02-122025-02-192025-02-262025-03-05

Parents

This classParent classesRelease idIntersectionAdded to this classOnly in parent

Children

This class Descendant classesRelease idIntersectionOnly in this classAdded to child

Instances are ordered to put similar structures near each other. Select one instance to see its 3D structure. Selecting two or more instances will show their superposition, but only chains with identical numbers of observed nucleotides will superpose well. Large structures are slow to display; this tool is not designed for that.

#SViewPDBTitleMethodResolution#NTs
13CME|1|0The Structure of CA and CCA-PHE-CAP-BIO Bound to the Large Ribosomal Subunit of Haloarcula MarismortuiX-RAY DIFFRACTION2.952754
21VQP|1|0The structure of the transition state analogue 'RAP' bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.252754
31VQL|1|0The structure of the transition state analogue 'DCSN' bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.32754
41VQM|1|0The structure of the transition state analogue 'DAN' bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.32754
51VQN|1|0The structure of CC-HPMN AND CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.42754
61VQ8|1|0The structure of CCDA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.22754
71VQ9|1|0The structure of CCA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.42754
83CMA|1|0The structure of CCA and CCA-Phe-Cap-Bio bound to the large ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.82754
91VQK|1|0The structure of CCDA-PHE-CAP-BIO bound to the a site of the ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.32754
101VQO|1|0The structure of CCPMN bound to the large ribosomal subunit haloarcula marismortuiX-RAY DIFFRACTION2.22754
113CCM|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2611UX-RAY DIFFRACTION2.552754
123OW2|1|0Crystal Structure of Enhanced Macrolide Bound to 50S Ribosomal SubunitX-RAY DIFFRACTION2.72754
133CPW|1|0The structure of the antibiotic LINEZOLID bound to the large ribosomal subunit of HALOARCULA MARISMORTUIX-RAY DIFFRACTION2.72754
144V9F|1|0The re-refined crystal structure of the Haloarcula marismortui large ribosomal subunit at 2.4 Angstrom resolution: more complete structure of the L7/L12 and L1 stalk, L5 and LX proteinsX-RAY DIFFRACTION2.42808
151FFK|1|0CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTIONX-RAY DIFFRACTION2.42706
163CCR|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488C. Density for anisomycin is visible but not included in the model.X-RAY DIFFRACTION32754
173CCS|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482AX-RAY DIFFRACTION2.952754
183CD6|1|0Co-cystal of large Ribosomal Subunit mutant G2616A with CC-PuromycinX-RAY DIFFRACTION2.752754
193CCL|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535C. Density for Anisomycin is visible but not included in model.X-RAY DIFFRACTION2.92754
203CCQ|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488UX-RAY DIFFRACTION2.92754
213CC7|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2487UX-RAY DIFFRACTION2.72754
223CCE|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535AX-RAY DIFFRACTION2.752754
233CCU|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482CX-RAY DIFFRACTION2.82754
243CCV|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2616AX-RAY DIFFRACTION2.92754
253G71|1|0Co-crystal structure of Bruceantin bound to the large ribosomal subunitX-RAY DIFFRACTION2.852754
262OTJ|1|013-deoxytedanolide bound to the large subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.92754
273CC4|1|0Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal SubunitX-RAY DIFFRACTION2.72754
283G6E|1|0Co-crystal structure of Homoharringtonine bound to the large ribosomal subunitX-RAY DIFFRACTION2.72754
291YHQ|1|0Crystal Structure Of Azithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.42754
303CC2|1|0The Refined Crystal Structure of the Haloarcula Marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution with rrnA Sequence for the 23S rRNA and Genome-derived Sequences for r-ProteinsX-RAY DIFFRACTION2.42754
313I56|1|0Co-crystal structure of Triacetyloleandomcyin Bound to the Large Ribosomal SubunitX-RAY DIFFRACTION2.92754
321YJ9|1|0Crystal Structure Of The Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui Containing a three residue deletion in L22X-RAY DIFFRACTION2.82754
332OTL|1|0Girodazole bound to the large subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.72754
341YJN|1|0Crystal Structure Of Clindamycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION32754
351YIT|1|0Crystal Structure Of Virginiamycin M and S Bound To The 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.82754
361YJW|1|0Crystal Structure Of Quinupristin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.92754
371YIJ|1|0Crystal Structure Of Telithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.62754
381YI2|1|0Crystal Structure Of Erythromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.652754
391M90|1|ACo-crystal structure of CCA-Phe-caproic acid-biotin and sparsomycin bound to the 50S ribosomal subunitX-RAY DIFFRACTION2.82754
401S72|1|0REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARGE RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTIONX-RAY DIFFRACTION2.42754
411JJ2|1|0Fully Refined Crystal Structure of the Haloarcula marismortui Large Ribosomal Subunit at 2.4 Angstrom ResolutionX-RAY DIFFRACTION2.42754
421NJI|1|AStructure of chloramphenicol bound to the 50S ribosomal subunitX-RAY DIFFRACTION32754
431Q82|1|ACrystal Structure of CC-Puromycin bound to the A-site of the 50S ribosomal subunitX-RAY DIFFRACTION2.982754
441N8R|1|AStructure of large ribosomal subunit in complex with virginiamycin MX-RAY DIFFRACTION32754
451K8A|1|ACo-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION32754
461KD1|1|ACo-crystal Structure of Spiramycin bound to the 50S Ribosomal Subunit of Haloarcula marismortuiX-RAY DIFFRACTION32754
471K9M|1|ACo-crystal structure of tylosin bound to the 50S ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION32754
481Q86|1|ACrystal structure of CCA-Phe-cap-biotin bound simultaneously at half occupancy to both the A-site and P-site of the the 50S ribosomal Subunit.X-RAY DIFFRACTION32754
491VQ6|1|0The structure of c-hpmn and CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.72754
501VQ7|1|0The structure of the transition state analogue 'DCA' bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.52754
511VQ5|1|0The structure of the transition state analogue 'RAA' bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.62754
521VQ4|1|0The structure of the transition state analogue 'DAA' bound to the large ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.72754
531QVG|1|0Structure of CCA oligonucleotide bound to the tRNA binding sites of the large ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.92754
543CXC|1|0The structure of an enhanced oxazolidinone inhibitor bound to the 50S ribosomal subunit of H. marismortuiX-RAY DIFFRACTION32754
551Q81|1|ACrystal Structure of minihelix with 3' puromycin bound to A-site of the 50S ribosomal subunit.X-RAY DIFFRACTION2.952754
562QA4|1|0A more complete structure of the the L7/L12 stalk of the Haloarcula marismortui 50S large ribosomal subunitX-RAY DIFFRACTION32753
572QEX|1|0Negamycin Binds to the Wall of the Nascent Chain Exit Tunnel of the 50S Ribosomal SubunitX-RAY DIFFRACTION2.92754
581FG0|1|ALARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUNDX-RAY DIFFRACTION3496

Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. The ordering in the heat map is the same as in the table. The colorbar ranges from 0 to the maximum observed discrepancy. Click above the diagonal to select a range of structures, below the diagonal to select two structures.


Coloring options:

Copyright 2026 BGSU RNA group. Page generated in 6.5427 s