#IFEStandardized nameMoleculeOrganismSourceRfamTitleMethodRes. Å#NTsDate
14V9F|1|0 (rep)Large subunit ribosomal RNA23S Ribosomal RNAHaloarcula marismortuiArchaeaRF02540The re-refined crystal structure of the Haloarcula marismortui large ribosomal subunit at 2.4 Angstrom resolution: more complete structure of the L7/L12 and L1 stalk, L5 and LX proteinsX-ray diffraction2.428082014-07-09
21S72|1|0Large subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF02540REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARGE RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTIONX-ray diffraction2.427542004-06-15
31JJ2|1|0Large subunit ribosomal RNA23S RRNAHaloarcula marismortuiArchaeaRF02540Fully Refined Crystal Structure of the Haloarcula marismortui Large Ribosomal Subunit at 2.4 Angstrom ResolutionX-ray diffraction2.427542001-08-01
41YI2|1|0Large subunit ribosomal RNA23S Ribosomal RNAHaloarcula marismortuiArchaeaRF02540Crystal Structure Of Erythromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-ray diffraction2.6527542005-04-26
53CCU|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482CX-ray diffraction2.827542008-05-20
63CCL|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535C. Density for Anisomycin is visible but not included in model.X-ray diffraction2.927542008-05-20
71YHQ|1|0Large subunit ribosomal RNA23S Ribosomal RNAHaloarcula marismortuiArchaeaRF02540Crystal Structure Of Azithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-ray diffraction2.427542005-04-26
81YIJ|1|0Large subunit ribosomal RNA23S Ribosomal RNAHaloarcula marismortuiArchaeaRF02540Crystal Structure Of Telithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-ray diffraction2.627542005-04-26
93CMA|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNA, RNA (5'-R(*CP*CP*(8AN))-3')Haloarcula marismortuiArchaeaRF02540The structure of CCA and CCA-Phe-Cap-Bio bound to the large ribosomal subunit of Haloarcula marismortuiX-ray diffraction2.827542008-09-23
103CCV|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2616AX-ray diffraction2.927542008-05-20
113G6E|1|0Large subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF02540Co-crystal structure of Homoharringtonine bound to the large ribosomal subunitX-ray diffraction2.727542009-04-28
123G71|1|0Large subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF02540Co-crystal structure of Bruceantin bound to the large ribosomal subunitX-ray diffraction2.8527542009-04-28
133CD6|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Co-cystal of large Ribosomal Subunit mutant G2616A with CC-PuromycinX-ray diffraction2.7527542008-05-20
142QEX|1|0Large subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF02540Negamycin Binds to the Wall of the Nascent Chain Exit Tunnel of the 50S Ribosomal SubunitX-ray diffraction2.927542008-09-30
153CCM|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2611UX-ray diffraction2.5527542008-05-20
163I56|1|0Large subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF02540Co-crystal structure of Triacetyloleandomcyin Bound to the Large Ribosomal SubunitX-ray diffraction2.927542010-03-09
172OTL|1|0Large subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF02540Girodazole bound to the large subunit of Haloarcula marismortuiX-ray diffraction2.727542007-04-03
183CCS|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482AX-ray diffraction2.9527542008-05-20
191YJN|1|0Large subunit ribosomal RNA23S Ribosomal RNAHaloarcula marismortuiArchaeaRF02540Crystal Structure Of Clindamycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-ray diffraction327542005-04-26
201YJ9|1|0Large subunit ribosomal RNA23S Ribosomal RNAHaloarcula marismortuiArchaeaRF02540Crystal Structure Of The Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui Containing a three residue deletion in L22X-ray diffraction2.827542005-04-26
213CC4|1|0Large subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF02540Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal SubunitX-ray diffraction2.727542008-05-20
223CCQ|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488UX-ray diffraction2.927542008-05-20
231YIT|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Crystal Structure Of Virginiamycin M and S Bound To The 50S Ribosomal Subunit Of Haloarcula MarismortuiX-ray diffraction2.827542005-04-26
243CC2|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540The Refined Crystal Structure of the Haloarcula Marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution with rrnA Sequence for the 23S rRNA and Genome-derived Sequences for r-ProteinsX-ray diffraction2.427542008-05-20
251KQS|1|0Large subunit ribosomal RNA23S RRNA, CC-Pmn-pcb, CCAHaloarcula marismortuiArchaeaRF02540The Haloarcula marismortui 50S Complexed with a Pretranslocational Intermediate in Protein SynthesisX-ray diffraction3.127542002-02-22
262OTJ|1|0Large subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF0254013-deoxytedanolide bound to the large subunit of Haloarcula marismortuiX-ray diffraction2.927542007-04-03
273CCR|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488C. Density for anisomycin is visible but not included in the model.X-ray diffraction327542008-05-20
283CC7|1|0Large subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF02540Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2487UX-ray diffraction2.727542008-05-20
293G4S|1|0Large subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF02540Co-crystal structure of Tiamulin bound to the large ribosomal subunitX-ray diffraction3.227542009-04-28
303I55|1|0Large subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF02540Co-crystal structure of Mycalamide A Bound to the Large Ribosomal SubunitX-ray diffraction3.1127542010-03-09
312QA4|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540A more complete structure of the the L7/L12 stalk of the Haloarcula marismortui 50S large ribosomal subunitX-ray diffraction327532008-04-01
323CCJ|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2534UX-ray diffraction3.327542008-05-20
333CCE|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535AX-ray diffraction2.7527542008-05-20
343OW2|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540Crystal Structure of Enhanced Macrolide Bound to 50S Ribosomal SubunitX-ray diffraction2.727542012-06-20
351VQO|1|0Large subunit ribosomal RNA23S ribosomal rnaHaloarcula marismortuiArchaeaRF02540The structure of CCPMN bound to the large ribosomal subunit haloarcula marismortuiX-ray diffraction2.227542005-11-29
361VQ8|1|0Large subunit ribosomal RNA23S ribosomal rna, 5'-R(*CP*CP*(DA)*(PHE)*(ACA))-3'Haloarcula marismortuiArchaeaRF02540The structure of CCDA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortuiX-ray diffraction2.227542005-11-29
371VQP|1|0Large subunit ribosomal RNA23S ribosomal rna, 5'-R(*(DC)P*(DC)P*(PPU)*(LOF)P*(PO2)P*AP*C*C)-3'Haloarcula marismortuiArchaeaRF02540The structure of the transition state analogue 'RAP' bound to the large ribosomal subunit of haloarcula marismortuiX-ray diffraction2.2527542005-11-29
381VQK|1|0Large subunit ribosomal RNA23S ribosomal rnaHaloarcula marismortuiArchaeaRF02540The structure of CCDA-PHE-CAP-BIO bound to the a site of the ribosomal subunit of haloarcula marismortuiX-ray diffraction2.327542005-11-29
391VQN|1|0Large subunit ribosomal RNA23S ribosomal rna, 5'-R(*CP*CP*AP*(PHE)*(ACA)*(BTN))-3'Haloarcula marismortuiArchaeaRF02540The structure of CC-HPMN AND CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortuiX-ray diffraction2.427542005-11-29
401VQ9|1|0Large subunit ribosomal RNA23S ribosomal rna, 5'-R(*CP*CP*AP*(PHE)*(ACA))-3'Haloarcula marismortuiArchaeaRF02540The structure of CCA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortuiX-ray diffraction2.427542005-11-29
411VQ7|1|0Large subunit ribosomal RNA23S ribosomal rna, 5'-R(*CP*CP*(5AA)P*(2OP)P*(PAE)P*AP*C*C)-3')Haloarcula marismortuiArchaeaRF02540The structure of the transition state analogue 'DCA' bound to the large ribosomal subunit of haloarcula marismortuiX-ray diffraction2.527542005-11-29
421VQ4|1|0Large subunit ribosomal RNA23S ribosomal rna, 5'-R(*CP*CP*(5AA)P*(2OP)P*(PO2)P*(DA)P*C*C)-3')Haloarcula marismortuiArchaeaRF02540The structure of the transition state analogue 'DAA' bound to the large ribosomal subunit of Haloarcula marismortuiX-ray diffraction2.727542005-11-29
431VQ6|1|0Large subunit ribosomal RNA23S ribosomal rna, 5'-R(*CP*CP*AP*(PHE)*(ACA)*(BTN))-3'Haloarcula marismortuiArchaeaRF02540The structure of c-hpmn and CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortuiX-ray diffraction2.727542005-11-29
443CPW|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNA, 5'-R(*CP*CP*AP*(PHE)*(ACA))-3'Haloarcula marismortuiArchaeaRF02540The structure of the antibiotic LINEZOLID bound to the large ribosomal subunit of HALOARCULA MARISMORTUIX-ray diffraction2.727542008-07-22
453CME|1|0Large subunit ribosomal RNA50S RIBOSOMAL RNA, RNA (5'-R(*CP*CP*(8AN))-3')Haloarcula marismortuiArchaeaRF02540The Structure of CA and CCA-PHE-CAP-BIO Bound to the Large Ribosomal Subunit of Haloarcula MarismortuiX-ray diffraction2.9527542008-09-23
461M90|1|ALarge subunit ribosomal RNA23S RRNA, CCAHaloarcula marismortuiArchaeaRF02540Co-crystal structure of CCA-Phe-caproic acid-biotin and sparsomycin bound to the 50S ribosomal subunitX-ray diffraction2.827542002-09-06
473CXC|1|0Large subunit ribosomal RNA23S RIBOSOMAL RNA, 5'-R(*CP*CP*A)-3'Haloarcula marismortuiArchaeaRF02540The structure of an enhanced oxazolidinone inhibitor bound to the 50S ribosomal subunit of H. marismortuiX-ray diffraction327542009-04-28
481QVG|1|0Large subunit ribosomal RNA23S ribosomal rna, Oligonucleotide CCAHaloarcula marismortuiArchaeaRF02540Structure of CCA oligonucleotide bound to the tRNA binding sites of the large ribosomal subunit of Haloarcula marismortuiX-ray diffraction2.927542003-11-11
491NJI|1|ALarge subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF02540Structure of chloramphenicol bound to the 50S ribosomal subunitX-ray diffraction327542003-07-22
501VQ5|1|0Large subunit ribosomal RNA23S ribosomal rna, 5'-D(*(DC)P*(DC)P*(5AA)P*(2OP)P*(PO2)P*AP*C*C)-3')Haloarcula marismortuiArchaeaRF02540The structure of the transition state analogue 'RAA' bound to the large ribosomal subunit of haloarcula marismortuiX-ray diffraction2.627542005-11-29
511KC8|1|ALarge subunit ribosomal RNA23S RRNAHaloarcula marismortuiArchaeaRF02540Co-crystal Structure of Blasticidin S Bound to the 50S Ribosomal SubunitX-ray diffraction3.0127542003-07-22
521K73|1|ALarge subunit ribosomal RNA23S RRNAHaloarcula marismortuiArchaeaRF02540Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal SubunitX-ray diffraction3.0127542003-07-22
531Q81|1|ALarge subunit ribosomal RNA23S ribosomal rna, minihelix-puromycinHaloarcula marismortuiArchaeaRF02540Crystal Structure of minihelix with 3' puromycin bound to A-site of the 50S ribosomal subunit.X-ray diffraction2.9527542003-10-07
541Q82|1|ALarge subunit ribosomal RNA23S ribosomal rna, CC-puromycinHaloarcula marismortuiArchaeaRF02540Crystal Structure of CC-Puromycin bound to the A-site of the 50S ribosomal subunitX-ray diffraction2.9827542003-10-07
551QVF|1|0Large subunit ribosomal RNA23S ribosomal rnaHaloarcula marismortuiArchaeaRF02540Structure of a deacylated tRNA minihelix bound to the E site of the large ribosomal subunit of Haloarcula marismortuiX-ray diffraction3.127542003-11-11
561K9M|1|ALarge subunit ribosomal RNA23S RRNAHaloarcula marismortuiArchaeaRF02540Co-crystal structure of tylosin bound to the 50S ribosomal subunit of Haloarcula marismortuiX-ray diffraction327542002-07-19
571KD1|1|ALarge subunit ribosomal RNA23S RRNAHaloarcula marismortuiArchaeaRF02540Co-crystal Structure of Spiramycin bound to the 50S Ribosomal Subunit of Haloarcula marismortuiX-ray diffraction327542002-07-19
581K8A|1|ALarge subunit ribosomal RNA23S RRNAHaloarcula marismortuiArchaeaRF02540Co-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortuiX-ray diffraction327542002-07-19
591M1K|1|ALarge subunit ribosomal RNA23S RRNAHaloarcula marismortuiArchaeaRF02540Co-crystal structure of azithromycin bound to the 50S ribosomal subunit of Haloarcula marismortuiX-ray diffraction3.227542002-07-19
601Q86|1|ALarge subunit ribosomal RNA23S ribosomal rna, CCA-phenylalanine-cariotic-acid-biotinHaloarcula marismortuiArchaeaRF02540Crystal structure of CCA-Phe-cap-biotin bound simultaneously at half occupancy to both the A-site and P-site of the the 50S ribosomal Subunit.X-ray diffraction327542003-10-07
611Q7Y|1|ALarge subunit ribosomal RNA23S ribosomal rnaHaloarcula marismortuiArchaeaRF02540Crystal Structure of CCdAP-Puromycin bound at the Peptidyl transferase center of the 50S ribosomal subunitX-ray diffraction3.227542003-10-07
621FFK|1|0Large subunit ribosomal RNA23S RRNAHaloarcula marismortuiArchaeaRF02540CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTIONX-ray diffraction2.427062000-08-14
631FG0|1|ALarge subunit ribosomal RNA23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3'Haloarcula marismortuiArchaeaRF02540LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUNDX-ray diffraction34962000-08-28
641FFZ|1|ALarge subunit ribosomal RNA23S RIBOSOMAL RNAHaloarcula marismortuiArchaeaRF02540LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCINX-ray diffraction3.24962000-08-28
651N8R|1|ALarge subunit ribosomal RNA23S ribosomal RNAHaloarcula marismortuiArchaeaRF02540Structure of large ribosomal subunit in complex with virginiamycin MX-ray diffraction327542003-07-22
661W2B|1|0Large subunit ribosomal RNA23S RRNAHaloarcula marismortuiArchaeaRF02540Trigger Factor ribosome binding domain in complex with 50SX-ray diffraction3.527542004-09-02

Release history

Release3.03.13.23.33.43.53.63.73.83.93.103.113.123.133.143.153.163.173.183.193.203.213.223.233.243.253.263.273.283.293.303.313.323.333.343.353.363.373.383.393.403.413.423.433.443.453.463.473.483.493.503.513.523.533.543.553.563.573.583.593.603.613.623.633.643.653.663.673.683.693.703.713.723.733.743.753.763.773.783.793.803.813.823.833.843.853.863.873.883.893.903.913.923.933.943.953.963.973.983.993.1003.1013.1023.1033.1043.1053.1063.1073.1083.1093.1103.1113.1123.1133.1143.1153.1163.1173.1183.1193.1203.1213.1223.1233.1243.1253.1263.1273.1283.1293.1303.1313.1323.1333.1343.1353.1363.1373.1383.1393.1403.1413.1423.1433.1443.1453.1463.1473.1483.1493.1503.1513.1523.1533.1543.1553.1563.1573.1583.1593.1603.1613.1623.1633.1643.1653.1663.1673.1683.1693.1703.1713.1723.1733.1743.1753.1763.1773.1783.1793.1803.1813.1823.1833.1843.1853.1863.1873.1883.1893.1903.1913.1923.1933.1943.1953.1963.1973.1983.1993.2003.2013.2023.2033.2043.2053.2063.2073.2083.2093.2103.2113.2123.2133.2143.2153.2163.2173.2183.2193.2203.2213.2223.2233.2243.2253.2263.2273.2283.2293.2303.2313.2323.2333.2343.2353.2363.2373.2383.2393.2403.2413.2423.2433.2443.2453.2463.2473.2483.2493.2503.2513.2523.2533.2543.2553.2563.2573.2583.2593.2603.2613.2623.2633.2643.2653.2663.2673.2683.2693.2703.2713.2723.2733.2743.2753.2763.2773.2783.2793.2803.2813.2823.2833.2843.2853.2863.2873.2883.2893.2903.2913.2923.2933.2943.2953.2963.2973.2983.2993.3003.3013.3023.3033.3043.3053.3063.3073.3083.3093.3103.3113.3123.3133.3143.3153.3163.3173.3183.3193.3203.3213.3223.3233.3243.3253.3263.3273.3283.3293.3303.3313.3323.3333.3343.3353.3363.3373.338
Date2017-12-152017-12-222017-12-292018-01-052018-01-122018-01-192018-01-262018-02-022018-02-092018-02-162018-02-232018-03-012018-03-082018-03-152018-03-222018-03-292018-04-062018-04-132018-04-202018-04-272018-05-042018-05-112018-05-182018-05-252018-06-012018-06-082018-06-152018-06-222018-06-292018-07-062018-07-132018-07-202018-07-272018-08-032018-08-102018-08-172018-08-242018-08-312018-09-072018-09-142018-09-212018-09-282018-10-052018-10-122018-10-192018-10-262018-11-022018-11-092018-11-162018-11-232018-11-302018-12-072018-12-142018-12-212018-12-282019-01-042019-01-112019-01-182019-01-252019-02-012019-02-082019-02-152019-02-222019-03-012019-03-082019-03-152019-03-222019-03-292019-04-052019-04-122019-04-192019-04-262019-05-032019-05-102019-05-172019-05-242019-05-312019-06-072019-06-142019-06-212019-06-282019-07-052019-07-122019-07-192019-07-262019-08-022019-08-092019-08-162019-08-232019-08-282019-09-042019-09-112019-09-192019-09-252019-10-032019-10-092019-10-162019-10-232019-10-302019-11-062019-11-132019-11-202019-11-272019-12-042019-12-112019-12-182019-12-252020-01-012020-01-082020-01-152020-01-222020-01-292020-02-052020-02-122020-02-192020-02-262020-03-042020-03-112020-03-182020-03-252020-04-012020-04-082020-04-152020-04-222020-04-292020-05-062020-05-132020-05-202020-05-272020-06-032020-06-102020-06-172020-06-242020-07-012020-07-082020-07-152020-07-222020-07-292020-08-052020-08-122020-08-192020-08-262020-09-022020-09-092020-09-162020-09-232020-09-302020-10-072020-10-142020-10-212020-10-282020-11-042020-11-112020-11-182020-11-252020-12-022020-12-092020-12-162020-12-232020-12-302021-01-062021-01-132021-01-202021-01-272021-02-032021-02-102021-02-172021-02-242021-03-032021-03-102021-03-172021-03-242021-03-312021-04-072021-04-142021-04-212021-04-282021-05-052021-05-122021-05-192021-05-262021-06-022021-06-092021-06-162021-06-232021-06-302021-07-072021-07-142021-07-212021-07-282021-08-042021-08-112021-08-182021-08-252021-09-012021-09-082021-09-152021-09-222021-09-292021-10-062021-10-132021-10-202021-10-272021-11-032021-11-102021-11-172021-11-242021-12-012021-12-082021-12-152021-12-222021-12-292022-01-052022-01-122022-01-192022-01-262022-02-022022-02-092022-02-162022-02-232022-03-022022-03-092022-03-162022-03-232022-03-302022-04-062022-04-132022-04-202022-04-272022-05-042022-05-112022-05-182022-05-252022-06-012022-06-082022-06-152022-06-222022-06-292022-07-062022-07-132022-07-202022-07-272022-08-032022-08-102022-08-172022-08-242022-08-312022-09-072022-09-142022-09-212022-09-282022-10-052022-10-122022-10-192022-10-262022-11-022022-11-092022-11-162022-11-232022-11-302022-12-072022-12-142022-12-212022-12-282023-01-042023-01-112023-01-182023-01-252023-02-012023-02-082023-02-152023-02-222023-03-012023-03-082023-03-152023-03-222023-03-292023-04-052023-04-122023-04-192023-04-262023-05-032023-05-102023-05-172023-05-242023-05-312023-06-072023-06-142023-06-212023-06-282023-07-052023-07-122023-07-192023-07-262023-08-022023-08-092023-08-162023-08-232023-08-302023-09-062023-09-132023-09-202023-09-272023-10-042023-10-112023-10-182023-10-252023-11-012023-11-082023-11-152023-11-242023-11-292023-12-062023-12-132023-12-202023-12-272024-01-032024-01-102024-01-172024-01-242024-01-312024-02-072024-02-142024-02-212024-02-282024-03-062024-03-132024-03-202024-03-272024-04-032024-04-102024-04-172024-04-242024-05-012024-05-082024-05-152024-05-222024-05-292024-06-05

Children

This class Descendant classesRelease idIntersectionOnly in this classAdded to child

Instances are ordered to put similar structures near each other. Select one instance to see its 3D structure. Selecting two or more instances will show their superposition, but only chains with identical numbers of observed nucleotides will superpose well. Large structures are slow to display; this tool is not designed for that.

#SViewPDBTitleMethodResolution#NTs
14V9F|1|0The re-refined crystal structure of the Haloarcula marismortui large ribosomal subunit at 2.4 Angstrom resolution: more complete structure of the L7/L12 and L1 stalk, L5 and LX proteinsX-RAY DIFFRACTION2.42808
21FFK|1|0CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTIONX-RAY DIFFRACTION2.42706
31W2B|1|0Trigger Factor ribosome binding domain in complex with 50SX-RAY DIFFRACTION3.52754
41Q7Y|1|ACrystal Structure of CCdAP-Puromycin bound at the Peptidyl transferase center of the 50S ribosomal subunitX-RAY DIFFRACTION3.22754
51Q81|1|ACrystal Structure of minihelix with 3' puromycin bound to A-site of the 50S ribosomal subunit.X-RAY DIFFRACTION2.952754
61N8R|1|AStructure of large ribosomal subunit in complex with virginiamycin MX-RAY DIFFRACTION32754
71Q82|1|ACrystal Structure of CC-Puromycin bound to the A-site of the 50S ribosomal subunitX-RAY DIFFRACTION2.982754
81KC8|1|ACo-crystal Structure of Blasticidin S Bound to the 50S Ribosomal SubunitX-RAY DIFFRACTION3.012754
91NJI|1|AStructure of chloramphenicol bound to the 50S ribosomal subunitX-RAY DIFFRACTION32754
101S72|1|0REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARGE RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTIONX-RAY DIFFRACTION2.42754
111JJ2|1|0Fully Refined Crystal Structure of the Haloarcula marismortui Large Ribosomal Subunit at 2.4 Angstrom ResolutionX-RAY DIFFRACTION2.42754
121K73|1|ACo-crystal Structure of Anisomycin Bound to the 50S Ribosomal SubunitX-RAY DIFFRACTION3.012754
131QVF|1|0Structure of a deacylated tRNA minihelix bound to the E site of the large ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION3.12754
141M1K|1|ACo-crystal structure of azithromycin bound to the 50S ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION3.22754
151K9M|1|ACo-crystal structure of tylosin bound to the 50S ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION32754
161KD1|1|ACo-crystal Structure of Spiramycin bound to the 50S Ribosomal Subunit of Haloarcula marismortuiX-RAY DIFFRACTION32754
171K8A|1|ACo-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION32754
181M90|1|ACo-crystal structure of CCA-Phe-caproic acid-biotin and sparsomycin bound to the 50S ribosomal subunitX-RAY DIFFRACTION2.82754
191YI2|1|0Crystal Structure Of Erythromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.652754
201YIJ|1|0Crystal Structure Of Telithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.62754
211YIT|1|0Crystal Structure Of Virginiamycin M and S Bound To The 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.82754
221YJN|1|0Crystal Structure Of Clindamycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION32754
233I56|1|0Co-crystal structure of Triacetyloleandomcyin Bound to the Large Ribosomal SubunitX-RAY DIFFRACTION2.92754
241YJ9|1|0Crystal Structure Of The Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui Containing a three residue deletion in L22X-RAY DIFFRACTION2.82754
252OTL|1|0Girodazole bound to the large subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.72754
261VQ4|1|0The structure of the transition state analogue 'DAA' bound to the large ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.72754
271VQ5|1|0The structure of the transition state analogue 'RAA' bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.62754
281VQ7|1|0The structure of the transition state analogue 'DCA' bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.52754
291QVG|1|0Structure of CCA oligonucleotide bound to the tRNA binding sites of the large ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.92754
302OTJ|1|013-deoxytedanolide bound to the large subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.92754
313CCE|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535AX-RAY DIFFRACTION2.752754
323CCV|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2616AX-RAY DIFFRACTION2.92754
333CCU|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482CX-RAY DIFFRACTION2.82754
343CC4|1|0Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal SubunitX-RAY DIFFRACTION2.72754
353G71|1|0Co-crystal structure of Bruceantin bound to the large ribosomal subunitX-RAY DIFFRACTION2.852754
363G6E|1|0Co-crystal structure of Homoharringtonine bound to the large ribosomal subunitX-RAY DIFFRACTION2.72754
373CC2|1|0The Refined Crystal Structure of the Haloarcula Marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution with rrnA Sequence for the 23S rRNA and Genome-derived Sequences for r-ProteinsX-RAY DIFFRACTION2.42754
381YHQ|1|0Crystal Structure Of Azithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula MarismortuiX-RAY DIFFRACTION2.42754
393CC7|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2487UX-RAY DIFFRACTION2.72754
403CCQ|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488UX-RAY DIFFRACTION2.92754
413CCL|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535C. Density for Anisomycin is visible but not included in model.X-RAY DIFFRACTION2.92754
423CD6|1|0Co-cystal of large Ribosomal Subunit mutant G2616A with CC-PuromycinX-RAY DIFFRACTION2.752754
433CCS|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482AX-RAY DIFFRACTION2.952754
443CCR|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488C. Density for anisomycin is visible but not included in the model.X-RAY DIFFRACTION32754
453I55|1|0Co-crystal structure of Mycalamide A Bound to the Large Ribosomal SubunitX-RAY DIFFRACTION3.112754
463G4S|1|0Co-crystal structure of Tiamulin bound to the large ribosomal subunitX-RAY DIFFRACTION3.22754
473CCJ|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2534UX-RAY DIFFRACTION3.32754
483CME|1|0The Structure of CA and CCA-PHE-CAP-BIO Bound to the Large Ribosomal Subunit of Haloarcula MarismortuiX-RAY DIFFRACTION2.952754
493CMA|1|0The structure of CCA and CCA-Phe-Cap-Bio bound to the large ribosomal subunit of Haloarcula marismortuiX-RAY DIFFRACTION2.82754
501VQ9|1|0The structure of CCA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.42754
511VQ8|1|0The structure of CCDA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.22754
521VQP|1|0The structure of the transition state analogue 'RAP' bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.252754
531VQN|1|0The structure of CC-HPMN AND CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.42754
541VQO|1|0The structure of CCPMN bound to the large ribosomal subunit haloarcula marismortuiX-RAY DIFFRACTION2.22754
551VQK|1|0The structure of CCDA-PHE-CAP-BIO bound to the a site of the ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.32754
563CCM|1|0Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2611UX-RAY DIFFRACTION2.552754
573OW2|1|0Crystal Structure of Enhanced Macrolide Bound to 50S Ribosomal SubunitX-RAY DIFFRACTION2.72754
583CPW|1|0The structure of the antibiotic LINEZOLID bound to the large ribosomal subunit of HALOARCULA MARISMORTUIX-RAY DIFFRACTION2.72754
591KQS|1|0The Haloarcula marismortui 50S Complexed with a Pretranslocational Intermediate in Protein SynthesisX-RAY DIFFRACTION3.12754
601Q86|1|ACrystal structure of CCA-Phe-cap-biotin bound simultaneously at half occupancy to both the A-site and P-site of the the 50S ribosomal Subunit.X-RAY DIFFRACTION32754
611VQ6|1|0The structure of c-hpmn and CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortuiX-RAY DIFFRACTION2.72754
623CXC|1|0The structure of an enhanced oxazolidinone inhibitor bound to the 50S ribosomal subunit of H. marismortuiX-RAY DIFFRACTION32754
632QA4|1|0A more complete structure of the the L7/L12 stalk of the Haloarcula marismortui 50S large ribosomal subunitX-RAY DIFFRACTION32753
642QEX|1|0Negamycin Binds to the Wall of the Nascent Chain Exit Tunnel of the 50S Ribosomal SubunitX-RAY DIFFRACTION2.92754
651FG0|1|ALARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUNDX-RAY DIFFRACTION3496
661FFZ|1|ALARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCINX-RAY DIFFRACTION3.2496

Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. The ordering in the heat map is the same as in the table. The colorbar ranges from 0 to the maximum observed discrepancy. Click above the diagonal to select a range of structures, below the diagonal to select two structures.


Coloring options:

Copyright 2025 BGSU RNA group. Page generated in 0.0738 s