#IFEStandardized nameMoleculeOrganismSourceRfamTitleMethodRes. ÅDate
11QWA|A (rep)NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.Solution NMR2003-11-25
22RPT|AStructure of the CC mismatch from the thymidylate synthase binding site 1 hairpin and analysis of its interaction with paromomycinSolution NMR2009-08-25
32XLI|BPseudomonas aeruginosaCrystal structure of the Csy4-crRNA complex, monoclinic formX-ray diffraction2.332010-09-22
42XLJ|BPseudomonas aeruginosaCrystal structure of the Csy4-crRNA complex, hexagonal formX-ray diffraction2.62010-09-22
52XLK|CPseudomonas aeruginosaCrystal structure of the Csy4-crRNA complex, orthorhombic formX-ray diffraction1.82010-09-22

Release history

Release0.160.170.18
Date2011-05-072011-05-142011-05-21

Parents

This classParent classesRelease idIntersectionAdded to this classOnly in parent

Children

This class Descendant classesRelease idIntersectionOnly in this classAdded to child

Instances are ordered to put similar structures near each other. Select one instance to see its 3D structure. Selecting two or more instances will show their superposition, but only chains with identical numbers of observed nucleotides will superpose well. Large structures are slow to display; this tool is not designed for that.

#SViewPDBTitleMethodResolutionLength

Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. The ordering in the heat map is the same as in the table. The colorbar ranges from 0 to the maximum observed discrepancy. Click above the diagonal to select a range of structures, below the diagonal to select two structures.


Coloring options:

Copyright 2024 BGSU RNA group. Page generated in 0.0153 s