1 | 4V9F|1|0 (rep) | Large subunit ribosomal RNA | 23S Ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | The re-refined crystal structure of the Haloarcula marismortui large ribosomal subunit at 2.4 Angstrom resolution: more complete structure of the L7/L12 and L1 stalk, L5 and LX proteins | X-ray diffraction | 2.4 | 2014-07-09 |
2 | 1S72|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARGE RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTION | X-ray diffraction | 2.4 | 2004-06-15 |
3 | 1VQO|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna | Haloarcula marismortui | Archaea | RF02540 | The structure of CCPMN bound to the large ribosomal subunit haloarcula marismortui | X-ray diffraction | 2.2 | 2005-11-29 |
4 | 3CC2|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | The Refined Crystal Structure of the Haloarcula Marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution with rrnA Sequence for the 23S rRNA and Genome-derived Sequences for r-Proteins | X-ray diffraction | 2.4 | 2008-05-20 |
5 | 1VQK|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna | Haloarcula marismortui | Archaea | RF02540 | The structure of CCDA-PHE-CAP-BIO bound to the a site of the ribosomal subunit of haloarcula marismortui | X-ray diffraction | 2.3 | 2005-11-29 |
6 | 1VQP|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-R(*(DC)P*(DC)P*(PPU)*(LOF)P*(PO2)P*AP*C*C)-3' | Haloarcula marismortui | Archaea | RF02540 | The structure of the transition state analogue 'RAP' bound to the large ribosomal subunit of haloarcula marismortui | X-ray diffraction | 2.25 | 2005-11-29 |
7 | 3CCU|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482C | X-ray diffraction | 2.8 | 2008-05-20 |
8 | 1JJ2|1|0 | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Fully Refined Crystal Structure of the Haloarcula marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution | X-ray diffraction | 2.4 | 2001-08-01 |
9 | 1K73|1|A | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal Subunit | X-ray diffraction | 3.01 | 2003-07-22 |
10 | 1VQ6|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-R(*CP*CP*AP*(PHE)*(ACA)*(BTN))-3' | Haloarcula marismortui | Archaea | RF02540 | The structure of c-hpmn and CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortui | X-ray diffraction | 2.7 | 2005-11-29 |
11 | 3CPW|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA, 5'-R(*CP*CP*AP*(PHE)*(ACA))-3' | Haloarcula marismortui | Archaea | RF02540 | The structure of the antibiotic LINEZOLID bound to the large ribosomal subunit of HALOARCULA MARISMORTUI | X-ray diffraction | 2.7 | 2008-07-22 |
12 | 1VQM|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna | Haloarcula marismortui | Archaea | RF02540 | The structure of the transition state analogue 'DAN' bound to the large ribosomal subunit of haloarcula marismortui | X-ray diffraction | 2.3 | 2005-11-29 |
13 | 3CC4|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal Subunit | X-ray diffraction | 2.7 | 2008-05-20 |
14 | 3G6E|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of Homoharringtonine bound to the large ribosomal subunit | X-ray diffraction | 2.7 | 2009-04-28 |
15 | 1VQ4|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-R(*CP*CP*(5AA)P*(2OP)P*(PO2)P*(DA)P*C*C)-3') | Haloarcula marismortui | Archaea | RF02540 | The structure of the transition state analogue 'DAA' bound to the large ribosomal subunit of Haloarcula marismortui | X-ray diffraction | 2.7 | 2005-11-29 |
16 | 1VQ8|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-R(*CP*CP*(DA)*(PHE)*(ACA))-3' | Haloarcula marismortui | Archaea | RF02540 | The structure of CCDA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortui | X-ray diffraction | 2.2 | 2005-11-29 |
17 | 1QVF|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna | Haloarcula marismortui | Archaea | RF02540 | Structure of a deacylated tRNA minihelix bound to the E site of the large ribosomal subunit of Haloarcula marismortui | X-ray diffraction | 3.1 | 2003-11-11 |
18 | 1VQL|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna | Haloarcula marismortui | Archaea | RF02540 | The structure of the transition state analogue 'DCSN' bound to the large ribosomal subunit of haloarcula marismortui | X-ray diffraction | 2.3 | 2005-11-29 |
19 | 1M90|1|A | Large subunit ribosomal RNA | 23S RRNA, CCA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of CCA-Phe-caproic acid-biotin and sparsomycin bound to the 50S ribosomal subunit | X-ray diffraction | 2.8 | 2002-09-06 |
20 | 3CCM|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2611U | X-ray diffraction | 2.55 | 2008-05-20 |
21 | 1VQ9|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-R(*CP*CP*AP*(PHE)*(ACA))-3' | Haloarcula marismortui | Archaea | RF02540 | The structure of CCA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortui | X-ray diffraction | 2.4 | 2005-11-29 |
22 | 1YHQ|1|0 | Large subunit ribosomal RNA | 23S Ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure Of Azithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | X-ray diffraction | 2.4 | 2005-04-26 |
23 | 1NJI|1|A | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of chloramphenicol bound to the 50S ribosomal subunit | X-ray diffraction | 3 | 2003-07-22 |
24 | 1VQ7|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-R(*CP*CP*(5AA)P*(2OP)P*(PAE)P*AP*C*C)-3') | Haloarcula marismortui | Archaea | RF02540 | The structure of the transition state analogue 'DCA' bound to the large ribosomal subunit of haloarcula marismortui | X-ray diffraction | 2.5 | 2005-11-29 |
25 | 1VQN|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-R(*CP*CP*AP*(PHE)*(ACA)*(BTN))-3' | Haloarcula marismortui | Archaea | RF02540 | The structure of CC-HPMN AND CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortui | X-ray diffraction | 2.4 | 2005-11-29 |
26 | 1YI2|1|0 | Large subunit ribosomal RNA | 23S Ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure Of Erythromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | X-ray diffraction | 2.65 | 2005-04-26 |
27 | 3CC7|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2487U | X-ray diffraction | 2.7 | 2008-05-20 |
28 | 1KQS|1|0 | Large subunit ribosomal RNA | 23S RRNA, CCA, CC-Pmn-pcb | Haloarcula marismortui | Archaea | RF02540 | The Haloarcula marismortui 50S Complexed with a Pretranslocational Intermediate in Protein Synthesis | X-ray diffraction | 3.1 | 2002-02-22 |
29 | 3CXC|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA, 5'-R(*CP*CP*A)-3' | Haloarcula marismortui | Archaea | RF02540 | The structure of an enhanced oxazolidinone inhibitor bound to the 50S ribosomal subunit of H. marismortui | X-ray diffraction | 3 | 2009-04-28 |
30 | 1KC8|1|A | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal Structure of Blasticidin S Bound to the 50S Ribosomal Subunit | X-ray diffraction | 3.01 | 2003-07-22 |
31 | 1K9M|1|A | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of tylosin bound to the 50S ribosomal subunit of Haloarcula marismortui | X-ray diffraction | 3 | 2002-07-19 |
32 | 1VQ5|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, 5'-D(*(DC)P*(DC)P*(5AA)P*(2OP)P*(PO2)P*AP*C*C)-3') | Haloarcula marismortui | Archaea | RF02540 | The structure of the transition state analogue 'RAA' bound to the large ribosomal subunit of haloarcula marismortui | X-ray diffraction | 2.6 | 2005-11-29 |
33 | 3OW2|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure of Enhanced Macrolide Bound to 50S Ribosomal Subunit | X-ray diffraction | 2.7 | 2012-06-20 |
34 | 3CCL|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535C. Density for Anisomycin is visible but not included in model. | X-ray diffraction | 2.9 | 2008-05-20 |
35 | 3CMA|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA, RNA (5'-R(*CP*CP*(8AN))-3') | Haloarcula marismortui | Archaea | RF02540 | The structure of CCA and CCA-Phe-Cap-Bio bound to the large ribosomal subunit of Haloarcula marismortui | X-ray diffraction | 2.8 | 2008-09-23 |
36 | 1YIT|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure Of Virginiamycin M and S Bound To The 50S Ribosomal Subunit Of Haloarcula Marismortui | X-ray diffraction | 2.8 | 2005-04-26 |
37 | 3CCV|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2616A | X-ray diffraction | 2.9 | 2008-05-20 |
38 | 3CCQ|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488U | X-ray diffraction | 2.9 | 2008-05-20 |
39 | 1YIJ|1|0 | Large subunit ribosomal RNA | 23S Ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure Of Telithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | X-ray diffraction | 2.6 | 2005-04-26 |
40 | 1YJW|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure Of Quinupristin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | X-ray diffraction | 2.9 | 2005-04-26 |
41 | 3G71|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of Bruceantin bound to the large ribosomal subunit | X-ray diffraction | 2.85 | 2009-04-28 |
42 | 1M1K|1|A | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of azithromycin bound to the 50S ribosomal subunit of Haloarcula marismortui | X-ray diffraction | 3.2 | 2002-07-19 |
43 | 1N8R|1|A | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of large ribosomal subunit in complex with virginiamycin M | X-ray diffraction | 3 | 2003-07-22 |
44 | 1Q86|1|A | Large subunit ribosomal RNA | 23S ribosomal rna, CCA-phenylalanine-cariotic-acid-biotin | Haloarcula marismortui | Archaea | RF02540 | Crystal structure of CCA-Phe-cap-biotin bound simultaneously at half occupancy to both the A-site and P-site of the the 50S ribosomal Subunit. | X-ray diffraction | 3 | 2003-10-07 |
45 | 1YJN|1|0 | Large subunit ribosomal RNA | 23S Ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure Of Clindamycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | X-ray diffraction | 3 | 2005-04-26 |
46 | 1Q82|1|A | Large subunit ribosomal RNA | 23S ribosomal rna, CC-puromycin | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure of CC-Puromycin bound to the A-site of the 50S ribosomal subunit | X-ray diffraction | 2.98 | 2003-10-07 |
47 | 1FFK|1|0 | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | X-ray diffraction | 2.4 | 2000-08-14 |
48 | 2OTL|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Girodazole bound to the large subunit of Haloarcula marismortui | X-ray diffraction | 2.7 | 2007-04-03 |
49 | 3CD6|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Co-cystal of large Ribosomal Subunit mutant G2616A with CC-Puromycin | X-ray diffraction | 2.75 | 2008-05-20 |
50 | 1Q81|1|A | Large subunit ribosomal RNA | 23S ribosomal rna, minihelix-puromycin | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure of minihelix with 3' puromycin bound to A-site of the 50S ribosomal subunit. | X-ray diffraction | 2.95 | 2003-10-07 |
51 | 1K8A|1|A | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortui | X-ray diffraction | 3 | 2002-07-19 |
52 | 1YJ9|1|0 | Large subunit ribosomal RNA | 23S Ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure Of The Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui Containing a three residue deletion in L22 | X-ray diffraction | 2.8 | 2005-04-26 |
53 | 3CCE|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535A | X-ray diffraction | 2.75 | 2008-05-20 |
54 | 1KD1|1|A | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal Structure of Spiramycin bound to the 50S Ribosomal Subunit of Haloarcula marismortui | X-ray diffraction | 3 | 2002-07-19 |
55 | 3I55|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of Mycalamide A Bound to the Large Ribosomal Subunit | X-ray diffraction | 3.11 | 2010-03-09 |
56 | 3I56|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of Triacetyloleandomcyin Bound to the Large Ribosomal Subunit | X-ray diffraction | 2.9 | 2010-03-09 |
57 | 1Q7Y|1|A | Large subunit ribosomal RNA | 23S ribosomal rna | Haloarcula marismortui | Archaea | RF02540 | Crystal Structure of CCdAP-Puromycin bound at the Peptidyl transferase center of the 50S ribosomal subunit | X-ray diffraction | 3.2 | 2003-10-07 |
58 | 1QVG|1|0 | Large subunit ribosomal RNA | 23S ribosomal rna, Oligonucleotide CCA | Haloarcula marismortui | Archaea | RF02540 | Structure of CCA oligonucleotide bound to the tRNA binding sites of the large ribosomal subunit of Haloarcula marismortui | X-ray diffraction | 2.9 | 2003-11-11 |
59 | 2OTJ|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | 13-deoxytedanolide bound to the large subunit of Haloarcula marismortui | X-ray diffraction | 2.9 | 2007-04-03 |
60 | 3CCS|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482A | X-ray diffraction | 2.95 | 2008-05-20 |
61 | 2QEX|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Negamycin Binds to the Wall of the Nascent Chain Exit Tunnel of the 50S Ribosomal Subunit | X-ray diffraction | 2.9 | 2008-09-30 |
62 | 3CME|1|0 | Large subunit ribosomal RNA | 50S RIBOSOMAL RNA, RNA (5'-R(*CP*CP*(8AN))-3') | Haloarcula marismortui | Archaea | RF02540 | The Structure of CA and CCA-PHE-CAP-BIO Bound to the Large Ribosomal Subunit of Haloarcula Marismortui | X-ray diffraction | 2.95 | 2008-09-23 |
63 | 3CCR|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488C. Density for anisomycin is visible but not included in the model. | X-ray diffraction | 3 | 2008-05-20 |
64 | 1W2B|1|0 | Large subunit ribosomal RNA | 23S RRNA | Haloarcula marismortui | Archaea | RF02540 | Trigger Factor ribosome binding domain in complex with 50S | X-ray diffraction | 3.5 | 2004-09-02 |
65 | 3CCJ|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2534U | X-ray diffraction | 3.3 | 2008-05-20 |
66 | 2QA4|1|0 | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | A more complete structure of the the L7/L12 stalk of the Haloarcula marismortui 50S large ribosomal subunit | X-ray diffraction | 3 | 2008-04-01 |
67 | 3G4S|1|0 | Large subunit ribosomal RNA | 23S ribosomal RNA | Haloarcula marismortui | Archaea | RF02540 | Co-crystal structure of Tiamulin bound to the large ribosomal subunit | X-ray diffraction | 3.2 | 2009-04-28 |
68 | 1FG0|1|A | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | Haloarcula marismortui | Archaea | RF02540 | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | X-ray diffraction | 3 | 2000-08-28 |
69 | 1FFZ|1|A | Large subunit ribosomal RNA | 23S RIBOSOMAL RNA | Haloarcula marismortui | Archaea | RF02540 | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | X-ray diffraction | 3.2 | 2000-08-28 |