3D structure

PDB id
3JBV (explore in PDB, NAKB, or RNA 3D Hub)
Description
Mechanisms of Ribosome Stalling by SecM at Multiple Elongation Steps
Experimental method
ELECTRON MICROSCOPY
Resolution
3.32 Å

Loop

Sequence
AGCGACGCUUAUGCGUUGUU
Length
20 nucleotides
Bulged bases
3JBV|1|b|G|1171, 3JBV|1|b|U|1174, 3JBV|1|b|A|1175
QA status
Valid loop

Sequence variability

If this chain is mapped to an Rfam alignment, the link below will give its sequence variability.
R3DSVS

Structural variability across Equivalence Class

The link below will give the loop's structural variability across the equivalence class for this chain.
R3DMCS EC

Structural variability across Rfam

If this chain is mapped to an Rfam alignment, the link below will give the loop's structural variability between chains mapped to the same Rfam family.
R3DMCS Rfam
Detailed Annotation
No text annotation
Broad Annotation
No text annotation
Motif group
Not in a motif group
Basepair signature
Not available
Number of instances in this motif group
0

Unit IDs

3JBV|1|b|A|1165
3JBV|1|b|G|1166
3JBV|1|b|C|1167
3JBV|1|b|G|1168
3JBV|1|b|A|1169
3JBV|1|b|C|1170
3JBV|1|b|G|1171
3JBV|1|b|C|1172
3JBV|1|b|U|1173
3JBV|1|b|U|1174
3JBV|1|b|A|1175
3JBV|1|b|U|1176
3JBV|1|b|G|1177
3JBV|1|b|C|1178
3JBV|1|b|G|1179
3JBV|1|b|U|1180
3JBV|1|b|U|1181
3JBV|1|b|G|1182
3JBV|1|b|U|1183
3JBV|1|b|U|1184

Current chains

Chain b
RNA (2903-MER)

Nearby chains

Chain 2
50S ribosomal protein L30

Coloring options:

Copyright 2025 BGSU RNA group. Page generated in 0.0918 s