3D structure

PDB id
4V5B (explore in PDB, NAKB, or RNA 3D Hub)
Description
Structure of PDF binding helix in complex with the ribosome
Experimental method
X-RAY DIFFRACTION
Resolution
3.74 Å

Loop

Sequence
CCAGUAGCGGCGAGCGAACG
Length
20 nucleotides
Bulged bases
None detected
QA status
Valid loop

Sequence variability

If this chain is mapped to an Rfam alignment, the link below will give its sequence variability.
R3DSVS

Structural variability across Equivalence Class

The link below will give the loop's structural variability across the equivalence class for this chain.
R3DMCS EC

Structural variability across Rfam

If this chain is mapped to an Rfam alignment, the link below will give the loop's structural variability between chains mapped to the same Rfam family.
R3DMCS Rfam
Detailed Annotation
No text annotation
Broad Annotation
No text annotation
Motif group
Not in a motif group
Basepair signature
Not available
Number of instances in this motif group
0

Unit IDs

4V5B|1|CB|C|239
4V5B|1|CB|C|240
4V5B|1|CB|A|241
4V5B|1|CB|G|242
4V5B|1|CB|U|243
4V5B|1|CB|A|244
4V5B|1|CB|G|245
4V5B|1|CB|C|246
4V5B|1|CB|G|247
4V5B|1|CB|G|248
4V5B|1|CB|C|249
4V5B|1|CB|G|250
4V5B|1|CB|A|251
4V5B|1|CB|G|252
4V5B|1|CB|C|253
4V5B|1|CB|G|254
4V5B|1|CB|A|255
4V5B|1|CB|A|256
4V5B|1|CB|C|257
4V5B|1|CB|G|258

Current chains

Chain CB
23S RIBOSOMAL RNA

Nearby chains

Chain C3
50S RIBOSOMAL PROTEIN L35
Chain CL
50S RIBOSOMAL PROTEIN L15

Coloring options:

Copyright 2025 BGSU RNA group. Page generated in 0.152 s