3D structure

PDB id
4V91 (explore in PDB, NAKB, or RNA 3D Hub)
Description
Kluyveromyces lactis 80S ribosome in complex with CrPV-IRES
Experimental method
ELECTRON MICROSCOPY
Resolution
3.7 Å

Loop

Sequence
UGAAUUGCAGAAUUCCGUGAA
Length
21 nucleotides
Bulged bases
4V91|1|4|C|84, 4V91|1|4|U|86
QA status
Unknown status

Sequence variability

If this chain is mapped to an Rfam alignment, the link below will give its sequence variability.
R3DSVS

Structural variability across Equivalence Class

The link below will give the loop's structural variability across the equivalence class for this chain.
R3DMCS EC

Structural variability across Rfam

If this chain is mapped to an Rfam alignment, the link below will give the loop's structural variability between chains mapped to the same Rfam family.
R3DMCS Rfam
Detailed Annotation
No text annotation
Broad Annotation
No text annotation
Motif group
HL_07149.1
Basepair signature
cWW-tSH-tHS-R-R-tSS-R-R-R-R-R-R-R-R-R-R
Number of instances in this motif group
2

Unit IDs

4V91|1|4|U|69
4V91|1|4|G|70
4V91|1|4|A|71
4V91|1|4|A|72
4V91|1|4|U|73
4V91|1|4|U|74
4V91|1|4|G|75
4V91|1|4|C|76
4V91|1|4|A|77
4V91|1|4|G|78
4V91|1|4|A|79
4V91|1|4|A|80
4V91|1|4|U|81
4V91|1|4|U|82
4V91|1|4|C|83
4V91|1|4|C|84
4V91|1|4|G|85
4V91|1|4|U|86
4V91|1|4|G|87
4V91|1|4|A|88
4V91|1|4|A|89

Current chains

Chain 4
5.8S RRNA

Nearby chains

Chain 1
Large subunit ribosomal RNA; LSU rRNA
Chain Y
UL24
Chain h
UL29
Chain j
EL37
Chain l
EL39

Coloring options:

Copyright 2025 BGSU RNA group. Page generated in 0.1135 s