HL_6OGI_050
3D structure
- PDB id
- 6OGI (explore in PDB, NAKB, or RNA 3D Hub)
- Description
- 70S termination complex with RF2 bound to the UAG codon. Rotated ribosome conformation (Structure V)
- Experimental method
- ELECTRON MICROSCOPY
- Resolution
- 3.4 Å
Loop
- Sequence
- GUGGGAGGCUUUGAAGUGUGGACGCCAGUCUGCAUGGAGCCGACCUUGAAAUACCAC
- Length
- 57 nucleotides
- Bulged bases
- 6OGI|1|1|U|2132, 6OGI|1|1|G|2133, 6OGI|1|1|A|2134, 6OGI|1|1|A|2135, 6OGI|1|1|C|2145, 6OGI|1|1|C|2146, 6OGI|1|1|U|2172
- QA status
- Unknown status
Sequence variability
-
If this chain is mapped to an Rfam alignment, the link below will give its sequence variability.
- R3DSVS
Structural variability across Equivalence Class
-
The link below will give the loop's structural variability across the equivalence class for this chain.
- R3DMCS EC
Structural variability across Rfam
-
If this chain is mapped to an Rfam alignment, the link below will give the loop's structural variability between chains mapped to the same Rfam family.
- R3DMCS Rfam
- Detailed Annotation
- No text annotation
- Broad Annotation
- No text annotation
- Motif group
- Not in a motif group
- Basepair signature
- Not available
- Number of instances in this motif group
- 0
Unit IDs
6OGI|1|1|G|2121
6OGI|1|1|U|2122
6OGI|1|1|G|2123
6OGI|1|1|G|2124
6OGI|1|1|G|2125
6OGI|1|1|A|2126
6OGI|1|1|G|2127
6OGI|1|1|G|2128
6OGI|1|1|C|2129
6OGI|1|1|U|2130
6OGI|1|1|U|2131
6OGI|1|1|U|2132
6OGI|1|1|G|2133
6OGI|1|1|A|2134
6OGI|1|1|A|2135
6OGI|1|1|G|2136
6OGI|1|1|U|2137
6OGI|1|1|G|2138
6OGI|1|1|U|2139
6OGI|1|1|G|2140
6OGI|1|1|G|2141
6OGI|1|1|A|2142
6OGI|1|1|C|2143
6OGI|1|1|G|2144
6OGI|1|1|C|2145
6OGI|1|1|C|2146
6OGI|1|1|A|2147
6OGI|1|1|G|2148
6OGI|1|1|U|2149
6OGI|1|1|C|2150
6OGI|1|1|U|2151
6OGI|1|1|G|2152
6OGI|1|1|C|2153
6OGI|1|1|A|2154
6OGI|1|1|U|2155
6OGI|1|1|G|2156
6OGI|1|1|G|2157
6OGI|1|1|A|2158
6OGI|1|1|G|2159
6OGI|1|1|C|2160
6OGI|1|1|C|2161
6OGI|1|1|G|2162
6OGI|1|1|A|2163
6OGI|1|1|C|2164
6OGI|1|1|C|2165
6OGI|1|1|U|2166
6OGI|1|1|U|2167
6OGI|1|1|G|2168
6OGI|1|1|A|2169
6OGI|1|1|A|2170
6OGI|1|1|A|2171
6OGI|1|1|U|2172
6OGI|1|1|A|2173
6OGI|1|1|C|2174
6OGI|1|1|C|2175
6OGI|1|1|A|2176
6OGI|1|1|C|2177
Current chains
- Chain 1
- 23S ribosomal RNA
Nearby chains
- Chain 5
- Transfer RNA; tRNA
- Chain P
- 30S ribosomal protein S11
- Chain a
- 50S ribosomal protein L1
Coloring options: