3D structure

PDB id
3JBV (explore in PDB, NAKB, or RNA 3D Hub)
Description
Mechanisms of Ribosome Stalling by SecM at Multiple Elongation Steps
Experimental method
ELECTRON MICROSCOPY
Resolution
3.32 Å

Loop

Sequence
AGCCUUGAUGUGUAGGAUAGGUGGGAG*CGACCUUGAAAUACCACCCUUUAAUGUU
Length
55 nucleotides
Bulged bases
3JBV|1|b|U|2111, 3JBV|1|b|G|2112, 3JBV|1|b|U|2113, 3JBV|1|b|A|2114, 3JBV|1|b|G|2115, 3JBV|1|b|G|2116, 3JBV|1|b|A|2117, 3JBV|1|b|U|2118, 3JBV|1|b|G|2123, 3JBV|1|b|G|2124, 3JBV|1|b|G|2162, 3JBV|1|b|A|2163, 3JBV|1|b|A|2169, 3JBV|1|b|A|2171, 3JBV|1|b|U|2172, 3JBV|1|b|A|2173
QA status
Valid loop

Sequence variability

If this chain is mapped to an Rfam alignment, the link below will give its sequence variability.
R3DSVS

Structural variability across Equivalence Class

The link below will give the loop's structural variability across the equivalence class for this chain.
R3DMCS EC

Structural variability across Rfam

If this chain is mapped to an Rfam alignment, the link below will give the loop's structural variability between chains mapped to the same Rfam family.
R3DMCS Rfam
Detailed Annotation
No text annotation
Broad Annotation
No text annotation
Motif group
Not in a motif group
Basepair signature
Not available
Number of instances in this motif group
0

Unit IDs

3JBV|1|b|A|2101
3JBV|1|b|G|2102
3JBV|1|b|C|2103
3JBV|1|b|C|2104
3JBV|1|b|U|2105
3JBV|1|b|U|2106
3JBV|1|b|G|2107
3JBV|1|b|A|2108
3JBV|1|b|U|2109
3JBV|1|b|G|2110
3JBV|1|b|U|2111
3JBV|1|b|G|2112
3JBV|1|b|U|2113
3JBV|1|b|A|2114
3JBV|1|b|G|2115
3JBV|1|b|G|2116
3JBV|1|b|A|2117
3JBV|1|b|U|2118
3JBV|1|b|A|2119
3JBV|1|b|G|2120
3JBV|1|b|G|2121
3JBV|1|b|U|2122
3JBV|1|b|G|2123
3JBV|1|b|G|2124
3JBV|1|b|G|2125
3JBV|1|b|A|2126
3JBV|1|b|G|2127
*
3JBV|1|b|C|2161
3JBV|1|b|G|2162
3JBV|1|b|A|2163
3JBV|1|b|C|2164
3JBV|1|b|C|2165
3JBV|1|b|U|2166
3JBV|1|b|U|2167
3JBV|1|b|G|2168
3JBV|1|b|A|2169
3JBV|1|b|A|2170
3JBV|1|b|A|2171
3JBV|1|b|U|2172
3JBV|1|b|A|2173
3JBV|1|b|C|2174
3JBV|1|b|C|2175
3JBV|1|b|A|2176
3JBV|1|b|C|2177
3JBV|1|b|C|2178
3JBV|1|b|C|2179
3JBV|1|b|U|2180
3JBV|1|b|U|2181
3JBV|1|b|U|2182
3JBV|1|b|A|2183
3JBV|1|b|A|2184
3JBV|1|b|U|2185
3JBV|1|b|G|2186
3JBV|1|b|U|2187
3JBV|1|b|U|2188

Current chains

Chain b
RNA (2903-MER)

Nearby chains

Chain W
Transfer RNA; tRNA

Coloring options:

Copyright 2025 BGSU RNA group. Page generated in 0.1337 s