IL_4W21_201
3D structure
- PDB id
- 4W21 (explore in PDB, NAKB, or RNA 3D Hub)
- Description
- Structure of the 80S mammalian ribosome bound to eEF2 (this entry contains the large ribosomal subunit RNA)
- Experimental method
- ELECTRON MICROSCOPY
- Resolution
- 3.5 Å
Loop
- Sequence
- GAGCUC*GAGCAGAAGGGCAAAAGCUC
- Length
- 26 nucleotides
- Bulged bases
- 4W21|1|5|A|4280
- QA status
- Valid loop
Sequence variability
-
If this chain is mapped to an Rfam alignment, the link below will give its sequence variability.
- R3DSVS
Structural variability across Equivalence Class
-
The link below will give the loop's structural variability across the equivalence class for this chain.
- R3DMCS EC
Structural variability across Rfam
-
If this chain is mapped to an Rfam alignment, the link below will give the loop's structural variability between chains mapped to the same Rfam family.
- R3DMCS Rfam
- Detailed Annotation
- No text annotation
- Broad Annotation
- No text annotation
- Motif group
- Not in a motif group
- Basepair signature
- Not available
- Number of instances in this motif group
- 0
Unit IDs
4W21|1|5|G|4238
4W21|1|5|A|4239
4W21|1|5|G|4240
4W21|1|5|C|4241
4W21|1|5|U|4242
4W21|1|5|C|4243
*
4W21|1|5|G|4267
4W21|1|5|A|4268
4W21|1|5|G|4269
4W21|1|5|C|4270
4W21|1|5|A|4271
4W21|1|5|G|4272
4W21|1|5|A|4273
4W21|1|5|A|4274
4W21|1|5|G|4275
4W21|1|5|G|4276
4W21|1|5|G|4277
4W21|1|5|C|4278
4W21|1|5|A|4279
4W21|1|5|A|4280
4W21|1|5|A|4281
4W21|1|5|A|4282
4W21|1|5|G|4283
4W21|1|5|C|4284
4W21|1|5|U|4285
4W21|1|5|C|4286
Current chains
- Chain 5
- 28S ribosomal RNA
Nearby chains
- Chain 7
- 5S ribosomal RNA; 5S rRNA
Coloring options: