3D structure

PDB id
7ASM (explore in PDB, NAKB, or RNA 3D Hub)
Description
Staphylococcus aureus 50S after 30 minutes incubation at 37C
Experimental method
ELECTRON MICROSCOPY
Resolution
2.48 Å

Loop

Sequence
ACGUUACUAACGACGAUAUGC*GAUUU
Length
26 nucleotides
Bulged bases
7ASM|1|A|U|72
QA status
Valid loop

Sequence variability

If this chain is mapped to an Rfam alignment, the link below will give its sequence variability.
R3DSVS

Structural variability across Equivalence Class

The link below will give the loop's structural variability across the equivalence class for this chain.
R3DMCS EC

Structural variability across Rfam

If this chain is mapped to an Rfam alignment, the link below will give the loop's structural variability between chains mapped to the same Rfam family.
R3DMCS Rfam
IL_7ASM_112 not in the Motif Atlas
Geometric match to IL_5TBW_144
Geometric discrepancy: 0.2378
The information below is about IL_5TBW_144
Detailed Annotation
No text annotation
Broad Annotation
No text annotation
Motif group
IL_44998.1
Basepair signature
cWW-cWW-R-cWW-tSS-R-cWW-cWW-L-cWW-L-L-L-cWW-L-cSS-L-R-L-R
Number of instances in this motif group
2

Unit IDs

7ASM|1|A|A|56
7ASM|1|A|C|57
7ASM|1|A|G|58
7ASM|1|A|U|59
7ASM|1|A|U|60
7ASM|1|A|A|61
7ASM|1|A|C|62
7ASM|1|A|U|63
7ASM|1|A|A|64
7ASM|1|A|A|65
7ASM|1|A|C|66
7ASM|1|A|G|67
7ASM|1|A|A|68
7ASM|1|A|C|69
7ASM|1|A|G|70
7ASM|1|A|A|71
7ASM|1|A|U|72
7ASM|1|A|A|73
7ASM|1|A|U|74
7ASM|1|A|G|75
7ASM|1|A|C|76
*
7ASM|1|A|G|109
7ASM|1|A|A|110
7ASM|1|A|U|111
7ASM|1|A|U|112
7ASM|1|A|U|113

Current chains

Chain A
23S rRNA

Nearby chains

Chain 2
50S ribosomal protein L34
Chain R
50S ribosomal protein L23
Chain W
50S ribosomal protein L29

Coloring options:


Copyright 2025 BGSU RNA group. Page generated in 0.1338 s