Motif HL_00849.1 Version HL_00849.1 of this group appears in releases 2.0 to 2.0
| #S | Loop id | PDB | Disc | #Non-core | Chain(s) | Standardized name for chain | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 1-20 | 4-17 | 5-17 | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | HL_5AJ0_030 | 5AJ0 | 0 | 1 | A2 | LSU rRNA | G | 1954 | U | 1955 | G | 1956 | G | 1957 | C | 1958 | C | 1959 | A | 1960 | G | 1962 | G | 1963 | A | 1964 | A | 1965 | G | 1966 | U | 1967 | C | 1968 | G | 1969 | G | 1970 | A | 1971 | A | 1972 | U | 1973 | C | 1974 | cWW | ncWW | ncWW |
3D structures
Complete motif including flanking bases
| Sequence | Counts |
|---|---|
| GUGGCCAUGGAAGUCGGAAUC | 1 |
Non-Watson-Crick part of the motif
| Sequence | Counts |
|---|---|
| UGGCCAUGGAAGUCGGAAU | 1 |
Release history
| Release | 2.0 |
|---|---|
| Date | 2017-04-24 |
| Status | New id, no parents |
Parent motifs
This motif has no parent motifs.
Children motifs
This motif has no children motifs.- Annotations
-
- (1)
- Basepair signature
- cWW-L-R-R-L-L-cWW-R-R-R-R-R-R-R-R-R-R
- Heat map statistics
- Min 0.00 | Avg 0.00 | Max 0.00
Coloring options: