#SLoop idPDBDisc#Non-coreChain(s)Standardized name for chain 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21break 22 23 24 25 261-262-153-143-184-1312-1914-1815-1620-2321-22
1 IL_5TBW_1445TBW0.000004 5.8S rRNAA44C45G46C47A48G49C50G51A52A53A54U55G56C57G58A59U60A61C62G63U64*A96A97U98C99U100cWWcWWcWWtsScWWcWWncsSncSscWWcWW

3D structures

Complete motif including flanking bases
SequenceCounts
ACGCAGCGAAAUGCGAUACGU*AAUCU1
Non-Watson-Crick part of the motif
SequenceCounts
CGCAGCGAAAUGCGAUACG*AUC1

Release history

Release3.33.43.53.63.73.83.93.103.113.123.133.143.153.163.173.183.193.203.213.223.233.243.253.263.273.283.293.303.313.323.333.343.353.363.373.383.393.403.413.423.433.443.453.463.473.483.493.503.513.523.533.543.553.563.573.583.593.603.613.623.633.643.653.663.673.683.693.703.713.723.733.743.753.763.773.783.79
Date2018-03-082018-04-062018-05-042018-06-012018-06-292018-07-272018-08-242018-09-212018-10-192018-11-162018-12-142019-01-112019-02-082019-03-082019-04-052019-05-032019-05-312019-06-282019-07-262019-08-232019-09-192019-10-162019-11-132019-12-112020-01-082020-02-052020-03-042020-04-012020-04-292020-05-272020-06-242020-07-222020-08-192020-09-162020-10-142020-11-112020-12-092021-01-062021-02-032021-03-032021-03-312021-04-282021-05-262021-06-232021-07-212021-08-182021-09-152021-10-132021-11-102021-12-082022-01-052022-02-022022-03-022022-03-302022-04-272022-05-252022-06-222022-07-202022-08-172022-10-122022-11-092022-12-072023-01-042023-02-012023-03-012023-03-292023-04-262023-05-242023-06-212023-07-192023-08-162023-09-132023-10-112023-11-082023-12-062024-01-032024-01-03
StatusNew id, no parentsExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact match

Parent motifs

This motif has no parent motifs.

Children motifs

This motif has no children motifs.
Annotations
  • (1)
  • Basepair signature
    cWW-R-R-cWW-tSS-cWW-cWW-L-L-L-L-L-L-L-cWW-cSS-cSS-L-cWW-cWW
    Heat map statistics
    Min 0.00 | Avg 0.00 | Max 0.00
    Help

    Coloring options:

    Copyright 2025 BGSU RNA group. Page generated in 0.2598 s