#SLoop idPDBDisc#Non-coreChain(s)Standardized name for chain 1 2break 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 241-242-313-17
1 IL_4P95_0014P9500ARNA (192-MER)U3C4*G263G264U265U266G267A268A269C270A271C272U273U274A275A276U277U278G279G280G281U282U283A284cWWcWWtWWa

3D structures

Complete motif including flanking bases
SequenceCounts
UC*GGUUGAACACUUAAUUGGGUUA1
Non-Watson-Crick part of the motif
SequenceCounts
*GUUGAACACUUAAUUGGGUU1

Release history

Release3.33.43.53.63.73.83.93.103.23.113.123.133.143.153.163.173.183.193.203.213.223.233.243.253.263.273.283.293.303.313.323.333.343.353.363.373.383.393.403.413.423.433.443.453.463.473.483.493.503.513.523.533.543.553.563.573.583.593.603.613.623.633.643.653.66
Date2018-03-082018-04-062018-05-042018-06-012018-06-292018-07-272018-08-242018-09-212018-09-262018-10-192018-11-162018-12-142019-01-112019-02-082019-03-082019-04-052019-05-032019-05-312019-06-282019-07-262019-08-232019-09-192019-10-162019-11-132019-12-112020-01-082020-02-052020-03-042020-04-012020-04-292020-05-272020-06-242020-07-222020-08-192020-09-162020-10-142020-11-112020-12-092021-01-062021-02-032021-03-032021-03-312021-04-282021-05-262021-06-232021-07-212021-08-182021-09-152021-10-132021-11-102021-12-082022-01-052022-02-022022-03-022022-03-302022-04-272022-05-252022-06-222022-07-202022-08-172022-10-122022-11-092022-12-072023-01-042023-02-01
StatusExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchNew id, no parentsExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact match

Parent motifs

This motif has no parent motifs.

Children motifs

This motif has no children motifs.
Annotations
  • (1)
  • Basepair signature
    cWW-R-R-R-R-R-R-tWW-R-R-R-R-R-R-R-R-R-R-R-R-cWW
    Heat map statistics
    Min 0.00 | Avg 0.00 | Max 0.00
    Help

    Coloring options:

    Copyright 2026 BGSU RNA group. Database contents are licensed under Creative Commons Attribution 4.0 International (CC BY 4.0). Page generated in 0.2036 s