Motif IL_80355.1 Version IL_80355.1 of this group appears in releases 3.6 to 3.76

Download

Csv

Json

Pairwise interactions
Sequence variants
History

#S	Loop id	PDB	Disc	#Non-core	Chain(s)	Standardized name		1		2		3		4		5		6		7		8		9		10		11		12		13		14		15		16		17		18	break		19		20		21		22		23	1-23	2-22	2-23	7-8	18-19
1	IL_6ASO_001	6ASO	0	3	I	U6 snRNA	G	39	A	40	A	41	A	42	C	43	A	44	A	45	U	46	A	47	C	48	G	50	A	51	G	52	A	53	A	56	U	57	C	58	A	59	*	U	88	U	89	U	90	A	91	C	92	cWW	tWW	ntWW	ncSH	cWW

3D structures

Complete motif including flanking bases

Sequence	Counts
GAAACAAUACAGAGAUGAUCA*UUUAC	1

Non-Watson-Crick part of the motif

Sequence	Counts
AAACAAUACAGAGAUGAUC*UUA	1

Release history

Release	3.6	3.7	3.8	3.9	3.10	3.11	3.12	3.13	3.14	3.15	3.16	3.17	3.18	3.19	3.20	3.21	3.22	3.23	3.24	3.25	3.26	3.27	3.28	3.29	3.30	3.31	3.32	3.33	3.34	3.35	3.36	3.37	3.38	3.39	3.40	3.41	3.42	3.43	3.44	3.45	3.46	3.47	3.48	3.49	3.50	3.51	3.52	3.53	3.54	3.55	3.56	3.57	3.58	3.59	3.60	3.61	3.62	3.63	3.64	3.65	3.66	3.67	3.68	3.69	3.70	3.71	3.72	3.73	3.74	3.75	3.76
Date	2018-06-01	2018-06-29	2018-07-27	2018-08-24	2018-09-21	2018-10-19	2018-11-16	2018-12-14	2019-01-11	2019-02-08	2019-03-08	2019-04-05	2019-05-03	2019-05-31	2019-06-28	2019-07-26	2019-08-23	2019-09-19	2019-10-16	2019-11-13	2019-12-11	2020-01-08	2020-02-05	2020-03-04	2020-04-01	2020-04-29	2020-05-27	2020-06-24	2020-07-22	2020-08-19	2020-09-16	2020-10-14	2020-11-11	2020-12-09	2021-01-06	2021-02-03	2021-03-03	2021-03-31	2021-04-28	2021-05-26	2021-06-23	2021-07-21	2021-08-18	2021-09-15	2021-10-13	2021-11-10	2021-12-08	2022-01-05	2022-02-02	2022-03-02	2022-03-30	2022-04-27	2022-05-25	2022-06-22	2022-07-20	2022-08-17	2022-10-12	2022-11-09	2022-12-07	2023-01-04	2023-02-01	2023-03-01	2023-03-29	2023-04-26	2023-05-24	2023-06-21	2023-07-19	2023-08-16	2023-09-13	2023-10-11	2023-11-08
Status	New id, no parents	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match

Parent motifs

This motif has no parent motifs.

Children motifs

This motif has no children motifs.

Annotations: (1)
Basepair signature: cWW-tWW-tWW-L-R-R-L-L-L-L-L-L-L-L-L-L-L-L-L-L-cWW
Heat map statistics: Min 0.00 | Avg 0.00 | Max 0.00

Help

Coloring options: Nucleotide numbers

Copyright 2025 BGSU RNA group. Page generated in 0.8258 s