Motif J3_01343.1 Version J3_01343.1 of this group appears in releases 4.0 to 4.13

Download

Csv

Json

Pairwise interactions
Sequence variants
History

#S	Loop id	PDB	Disc	#Non-core	Chain(s)	Standardized name for chain		1		2		3		4		5		6	break		7		8		9		10		11		12		13	break		14		15		16		17		18		19		20	1-20	2-17	4-18	6-7	13-14
1	J3_8B0X_010	8B0X	0.0000	0	A	SSU rRNA	C	1063	G	1064	U	1065	C	1066	A	1067	G	1068	*	C	1107	G	1108	C	1109	A	1110	A	1111	C	1112	C	1113	*	G	1187	A	1188	U	1189	G	1190	A	1191	C	1192	G	1193	cWW	tSS	tWH	cWW	cWW
2	J3_4LFB_007	4LFB	0.1070	0	A	SSU rRNA	C	1063	G	1064	U	1065	C	1066	A	1067	G	1068	*	C	1107	G	1108	C	1109	A	1110	A	1111	C	1112	C	1113	*	G	1187	A	1188	C	1189	G	1190	A	1191	C	1192	G	1193	cWW	ntSS	tWH	cWW	cWW

3D structures

Complete motif including flanking bases

Sequence	Counts
CGUCAGCGCAACCGAUGACG	1
CGUCAGCGCAACCGACGACG	1

Non-Watson-Crick part of the motif

Sequence	Counts
GUCAGCAACAUGAC	1
GUCAGCAACACGAC	1

Release history

Release	4.0	4.1	4.2	4.3	4.4	4.5	4.6	4.7	4.8	4.9	4.10	4.11	4.12	4.13
Date	2025-08-13	2025-09-10	2025-10-08	2025-11-05	2025-12-03	2025-12-31	2026-01-28	2026-02-25	2026-03-25	2026-04-22	2026-05-20	2026-06-17	2026-07-15	2026-08-12
Status	New id, 1 parent	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match

Parent motifs

This motif has no parent motifs.

Children motifs

This motif has no children motifs.

Annotations: (2)
Basepair signature: cWW-tSS-F-F-tWH-F-F-cWW-F-cWW-F-F-F-F-F
Heat map statistics: Min 0.11 | Avg 0.05 | Max 0.11

Help

Coloring options: Nucleotide numbers

Copyright 2026 BGSU RNA group. Database contents are licensed under Creative Commons Attribution 4.0 International (CC BY 4.0). Page generated in 0.1729 s