Motif J3_42515.1 Version J3_42515.1 of this group appears in releases 4.1 to 4.1

Download

Csv

Json

Pairwise interactions
Sequence variants
History

#S	Loop id	PDB	Disc	#Non-core	Chain(s)	Standardized name for chain		1		2		3		4		5	break		6		7		8		9		10		11		12		13		14		15	break		16		17		18		19		20	1-20	2-11	3-7	4-13	5-6	7-12	9-20	11-18	14-17	15-16
1	J3_9UW0_001	9UW0	0.1024	1	X	RNA (65-MER)	A	10	U	11	A	12	U	13	C	14	*	G	34	G	35	A	37	A	38	U	39	A	40	C	41	A	42	U	43	A	44	*	U	60	U	61	A	62	C	63	U	64	cWW	cWW	tWS	cWH	cWW	cWW	cWS	cSW	cWw	cWW
2	J3_8KEB_001	8KEB	0.0000	1	A	RNA (72-MER)	A	9	U	10	A	11	U	12	C	13	*	G	33	G	34	A	36	A	37	U	38	A	39	C	40	A	41	U	42	A	43	*	U	59	U	60	A	61	C	62	U	63	cWW	cWW	tWS	cWH	cWW	cWW	cWS		cWw	cWW
3	J3_9LKV_001	9LKV	0.1311	1	X	RNA (73-MER)	A	10	U	11	A	12	U	13	C	14	*	G	34	G	35	A	37	A	38	U	39	A	40	C	41	A	42	U	43	A	44	*	U	60	U	61	A	62	C	63	U	64	cWW	cWW	tWS	cWH	cWW	cWW	ncWS		cWw	cWW

3D structures

Complete motif including flanking bases

Sequence	Counts
AUAUCGGCAAUACAUAUUACU	3

Non-Watson-Crick part of the motif

Sequence	Counts
UAUGCAAUACAUUAC	3

Release history

Release	4.1
Date	2025-09-10
Status	New id, 1 parent

Parent motifs

This motif has no parent motifs.

Children motifs

This motif has no children motifs.

Annotations: (3)
Basepair signature: cWW-cWS-cWW-F-tWS-F-cWH-cWW-cWW-cWW-cWW-F-F
Heat map statistics: Min 0.10 | Avg 0.10 | Max 0.20

Help

Coloring options: Nucleotide numbers

Copyright 2025 BGSU RNA group. Page generated in 0.1422 s