Motif J5_80259.1 Version J5_80259.1 of this group appears in releases 3.3 to 3.47

Download

Csv

Json

Pairwise interactions
Sequence variants
History

#S	Loop id	PDB	Disc	#Non-core	Chain(s)	Standardized name		1		2		3		4		5		6		7	break		8		9		10		11		12		13	break		14		15	break		16		17	break		18		19	1-5	1-19	2-3	3-12	4-10	5-11	6-9	7-8	13-14	15-16	17-18
1	J5_4IOA_001	4IOA	0.0000	1	X	LSU rRNA	C	46	G	47	A	48	G	50	A	51	A	52	G	53	*	C	114	G	115	A	116	A	117	U	118	G	119	*	C	128	A	129	*	U	142	A	143	*	U	154	G	155	ncsS	cWW	ncSs	cHW	tSH	tHH	tHS	cWW	cWW	cWW	cWW

3D structures

Complete motif including flanking bases

Sequence	Counts
CGAUGAAGCGAAUGCAUAUG	1

Non-Watson-Crick part of the motif

Sequence	Counts
GAUGAAGAAU**	1

Release history

Release	3.2	3.3	3.4	3.5	3.6	3.7	3.8	3.9	3.10	3.11	3.12	3.13	3.14	3.15	3.16	3.17	3.18	3.19	3.20	3.21	3.22	3.23	3.24	3.25	3.26	3.27	3.28	3.29	3.30	3.31	3.32	3.33	3.34	3.35	3.36	3.37	3.38	3.39	3.40	3.41	3.42	3.43	3.44	3.45	3.46	3.47
Date	2018-02-09	2018-03-08	2018-04-06	2018-05-04	2018-06-01	2018-06-29	2018-07-27	2018-08-24	2018-09-21	2018-10-19	2018-11-16	2018-12-14	2019-01-11	2019-02-08	2019-03-08	2019-04-05	2019-05-03	2019-05-31	2019-06-28	2019-07-26	2019-08-23	2019-09-19	2019-10-16	2019-11-13	2019-12-11	2020-01-08	2020-02-05	2020-03-04	2020-04-01	2020-04-29	2020-05-27	2020-06-24	2020-07-22	2020-08-19	2020-09-16	2020-10-14	2020-11-11	2020-12-09	2021-01-06	2021-02-03	2021-03-03	2021-03-31	2021-04-28	2021-05-26	2021-06-23	2021-07-21
Status	New id, no parents	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match

Parent motifs

This motif has no parent motifs.

Children motifs

This motif has no children motifs.

Annotations: (1)
Basepair signature: cWW-F-cWW-cHW-tSH-cWW-tHH-tHS-cWW-cWW
Heat map statistics: Min 0.00 | Avg 0.00 | Max 0.00

Help

loadScript https://rna.bgsu.edu/rna3dhub//js/jsmol/j2s//core/package.js

loadScript https://rna.bgsu.edu/rna3dhub//js/jsmol/j2s//core/corejmol.z.js

JSmol exec jmolApplet0 start applet null

Jmol JavaScript applet jmolApplet0__58132114861092__ initializing

Jmol getValue debug null

Jmol getValue logLevel null

Jmol getValue allowjavascript null

AppletRegistry.checkIn(jmolApplet0__58132114861092__)

vwrOptions:

{ "name":"jmolApplet0","applet":true,"documentBase":"https://rna.bgsu.edu/rna3dhub/motif/view/J5_80259.1","platform":"J.awtjs2d.Platform","fullName":"jmolApplet0__58132114861092__","codePath":"https://rna.bgsu.edu/rna3dhub//js/jsmol/j2s//","display":"jmolApplet0_canvas2d","signedApplet":"true","appletReadyCallback":"Jmol._readyCallback","statusListener":"[J.appletjs.Jmol object]","syncId":"58132114861092","bgcolor":"white" }

setting document base to "https://rna.bgsu.edu/rna3dhub/motif/view/J5_80259.1"

Jmol Version: 14.4.4_2016.04.25 2016-04-26 17:41

java.vendor: Java2Script (HTML5)

java.version: 2016-04-21 14:47:41 (JSmol/j2s)

os.name: Mozilla/5.0 AppleWebKit/537.36 (KHTML, like Gecko; compatible; ClaudeBot/1.0; +claudebot@anthropic.com)

Access: ALL

memory: 0.0/0.0

processors available: 1

useCommandThread: false

appletId:jmolApplet0 (signed)

loadScript https://rna.bgsu.edu/rna3dhub//js/jsmol/j2s//core/corescript.z.js

Jmol getValue emulate null

defaults = "Jmol"

Jmol getValue boxbgcolor null

Jmol getValue bgcolor white

backgroundColor = "white"

Jmol getValue ANIMFRAMECallback null

Jmol getValue APPLETREADYCallback Jmol._readyCallback

APPLETREADYCallback = "Jmol._readyCallback"

callback set for APPLETREADYCallback Jmol._readyCallback APPLETREADY

Jmol getValue ATOMMOVEDCallback null

Jmol getValue CLICKCallback null

Jmol getValue DRAGDROPCallback null

Jmol getValue ECHOCallback null

Jmol getValue ERRORCallback null

Jmol getValue EVALCallback null

Jmol getValue HOVERCallback null

Jmol getValue IMAGECallback null

Jmol getValue LOADSTRUCTCallback null

Jmol getValue MEASURECallback null

Jmol getValue MESSAGECallback null

Jmol getValue MINIMIZATIONCallback null

Jmol getValue SERVICECallback null

Jmol getValue PICKCallback null

Jmol getValue RESIZECallback null

Jmol getValue SCRIPTCallback null

Jmol getValue SYNCCallback null

Jmol getValue STRUCTUREMODIFIEDCallback null

Jmol getValue doTranslate null

language=en_US

Jmol getValue popupMenu null

Jmol getValue script null

Jmol getValue loadInline null

Jmol getValue load null

Jmol applet jmolApplet0__58132114861092__ ready

script 1 started

loadScript https://rna.bgsu.edu/rna3dhub//js/jsmol/j2s//core/coretext.z.js

Script completed

Jmol script terminated

script 2 started

Script completed

Jmol script terminated

script 3 started

Script completed

Jmol script terminated

script 4 started

Script completed

Jmol script terminated

Coloring options: Nucleotide numbers

Motif J5_80259.1 Version J5_80259.1 of this group appears in releases 3.3 to 3.47 Download Csv Json

3D structures

Complete motif including flanking bases

Non-Watson-Crick part of the motif

Release history

Parent motifs

Children motifs

Motif J5_80259.1 Version J5_80259.1 of this group appears in releases 3.3 to 3.47

Download

Csv

Json