Motif J7_21233.3 Version J7_21233.3 of this group appears in releases 3.54 to 3.86

Download

Csv

Json

Pairwise interactions
Sequence variants
History

#S	Loop id	PDB	Disc	#Non-core	Chain(s)	Standardized name		1		2		3		4		5		6	break		7		8	break		9		10		11	break		12		13		14		15		16		17	break		18		19		20		21		22	break		23		24	break		25		26		27		28		29		30	1-30	2-29	3-28	4-14	5-13	6-7	8-9	11-12	14-26	15-21	16-20	17-18	22-23	24-25	27-28
1	J7_4WF9_002	4WF9	0.1062	1	X	LSU rRNA	C	862	G	863	A	864	A	865	A	866	U	867	*	A	880	G	881	*	U	987	C	988	G	990	*	C	1015	G	1016	A	1017	A	1018	A	1019	G	1020	*	C	1031	A	1032	G	1033	A	1034	C	1035	*	G	1207	A	1208	*	U	1224	G	1225	G	1226	U	1227	A	1228	G	1229	cWW	tSH	tHW	tHH	tHS	cWW	cWW	cWW		ntSH	tHS	cWW	cWW	cWW	cSH
2	J7_7A0S_002	7A0S	0.0000	1	X	LSU rRNA	C	830	G	831	A	832	A	833	A	834	U	835	*	A	848	G	849	*	U	954	G	955	G	957	*	C	982	G	983	A	984	G	985	A	986	G	987	*	C	998	A	999	G	1000	A	1001	C	1002	*	G	1174	A	1175	*	U	1199	G	1200	G	1201	U	1202	A	1203	G	1204	cWW	tSH	tHW	ntHH	tHS	cWW	cWW	cWW	ncSW	ntSH	ntHS	cWW	cWW	cWW	cSH
3	J7_7RQB_002	7RQB	0.0852	2	1A	LSU rRNA	C	817	G	818	A	819	A	820	A	821	U	822	*	A	835	G	836	*	U	943	G	944	G	946	*	C	971	G	972	A	973	G	974	G	975\|\|\|A	C	976	*	G	987	A	988	G	989	A	990	C	991	*	G	1163	G	1164	*	C	1185	G	1186	G	1187	U	1188	A	1189	G	1190	cWW	tSH	tHW	tHH	tHS	cWW	cWW	cWW		tSH		cWW	cWW	cWW	cSH

3D structures

Complete motif including flanking bases

Sequence	Counts
CGAAAUAGUCAGCGAAAGCAGACGAUGGUAG	1
CGAAAUAGUGAGCGAGAGCAGACGAUGGUAG	1
CGAAAUAGUGAGCGAGCGCGAGACGGCGGUAG	1

Non-Watson-Crick part of the motif

Sequence	Counts
GAAA*CAGAAA*AGAGGUA	1
GAAA*GAGAGA*AGAGGUA	1
GAAA*GAGAGCG*AGAGGUA	1

Release history

Release	3.54	3.55	3.56	3.57	3.58	3.59	3.60	3.61	3.62	3.63	3.64	3.65	3.66	3.67	3.68	3.69	3.70	3.71	3.72	3.73	3.74	3.75	3.76	3.77	3.78	3.79	3.80	3.81	3.82	3.83	3.84	3.85	3.86
Date	2022-02-02	2022-03-02	2022-03-30	2022-04-27	2022-05-25	2022-06-22	2022-07-20	2022-08-17	2022-09-14	2022-10-12	2022-11-09	2022-12-07	2023-01-04	2023-02-01	2023-03-01	2023-03-29	2023-04-26	2023-05-24	2023-06-21	2023-07-19	2023-08-16	2023-09-13	2023-10-11	2023-11-08	2023-12-06	2024-01-03	2024-01-31	2024-02-28	2024-03-27	2024-04-24	2024-05-22	2024-06-19	2024-07-17
Status	Updated, 1 parent	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match	Exact match

Parent motifs

This motif has no parent motifs.

Children motifs

This motif has no children motifs.

Annotations: (3)
Basepair signature: cWW-tSH-tHW-cSH-tHH-tHS-F-cWW-cWW-cWW-cWW-F-tSH-cWW-tHS-F-cWW
Heat map statistics: Min 0.09 | Avg 0.07 | Max 0.11

Help

loadScript https://rna.bgsu.edu/rna3dhub//js/jsmol/j2s//core/package.js

loadScript https://rna.bgsu.edu/rna3dhub//js/jsmol/j2s//core/corejmol.z.js

JSmol exec jmolApplet0 start applet null

Jmol JavaScript applet jmolApplet0__682453144127975__ initializing

Jmol getValue debug null

Jmol getValue logLevel null

Jmol getValue allowjavascript null

AppletRegistry.checkIn(jmolApplet0__682453144127975__)

vwrOptions:

{ "name":"jmolApplet0","applet":true,"documentBase":"https://rna.bgsu.edu/rna3dhub/motif/view/J7_21233.3","platform":"J.awtjs2d.Platform","fullName":"jmolApplet0__682453144127975__","codePath":"https://rna.bgsu.edu/rna3dhub//js/jsmol/j2s//","display":"jmolApplet0_canvas2d","signedApplet":"true","appletReadyCallback":"Jmol._readyCallback","statusListener":"[J.appletjs.Jmol object]","syncId":"682453144127975","bgcolor":"white" }

setting document base to "https://rna.bgsu.edu/rna3dhub/motif/view/J7_21233.3"

Jmol Version: 14.4.4_2016.04.25 2016-04-26 17:41

java.vendor: Java2Script (HTML5)

java.version: 2016-04-21 14:47:41 (JSmol/j2s)

os.name: Mozilla/5.0 AppleWebKit/537.36 (KHTML, like Gecko; compatible; ClaudeBot/1.0; +claudebot@anthropic.com)

Access: ALL

memory: 0.0/0.0

processors available: 1

useCommandThread: false

appletId:jmolApplet0 (signed)

loadScript https://rna.bgsu.edu/rna3dhub//js/jsmol/j2s//core/corescript.z.js

Jmol getValue emulate null

defaults = "Jmol"

Jmol getValue boxbgcolor null

Jmol getValue bgcolor white

backgroundColor = "white"

Jmol getValue ANIMFRAMECallback null

Jmol getValue APPLETREADYCallback Jmol._readyCallback

APPLETREADYCallback = "Jmol._readyCallback"

callback set for APPLETREADYCallback Jmol._readyCallback APPLETREADY

Jmol getValue ATOMMOVEDCallback null

Jmol getValue CLICKCallback null

Jmol getValue DRAGDROPCallback null

Jmol getValue ECHOCallback null

Jmol getValue ERRORCallback null

Jmol getValue EVALCallback null

Jmol getValue HOVERCallback null

Jmol getValue IMAGECallback null

Jmol getValue LOADSTRUCTCallback null

Jmol getValue MEASURECallback null

Jmol getValue MESSAGECallback null

Jmol getValue MINIMIZATIONCallback null

Jmol getValue SERVICECallback null

Jmol getValue PICKCallback null

Jmol getValue RESIZECallback null

Jmol getValue SCRIPTCallback null

Jmol getValue SYNCCallback null

Jmol getValue STRUCTUREMODIFIEDCallback null

Jmol getValue doTranslate null

language=en_US

Jmol getValue popupMenu null

Jmol getValue script null

Jmol getValue loadInline null

Jmol getValue load null

Jmol applet jmolApplet0__682453144127975__ ready

script 1 started

loadScript https://rna.bgsu.edu/rna3dhub//js/jsmol/j2s//core/coretext.z.js

Script completed

Jmol script terminated

script 2 started