- Structure title
- NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
- Authors
- Finger, L.D., Trantirek, L., Johansson, C., Feigon, J.
- Release date
- 2003-11-25
- Experimental technique
- SOLUTION NMR
- Chains
-
1 RNA chain from
unknown source
-
0 other chains
- Nucleic acid compounds
18S ribosomal RNA, 5'ETS
- Other compounds
Pairwise Interactions
Interactions annotated by
FR3D:
View all
RNA 3D Motifs
In the current release of the
RNA 3D Motif Atlas, 1QWA contains:
-
17 hairpin loops from 0 motif groups
-
17 internal loops from 0 motif groups
-
0 junction loops from 0 motif groups
More
3D Redundancy
1QWA has chains which belong to the following equivalence classes in the current representative set:
Similar structures
None found
