Structure title
NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
Authors
Finger, L.D., Trantirek, L., Johansson, C., Feigon, J.
Release date
2003-11-25
Experimental technique
SOLUTION NMR
Chains
1 RNA chain from unknown source
0 other chains
Nucleic acid compounds
18S ribosomal RNA, 5'ETS
Other compounds

Pairwise Interactions

Interactions annotated by FR3D: View all

RNA 3D Motifs

In the current release of the RNA 3D Motif Atlas, 1QWA contains:
  • 17 hairpin loops from 0 motif groups
  • 17 internal loops from 0 motif groups
  • 0 junction loops from 0 motif groups
More

3D Redundancy

1QWA has chains which belong to the following equivalence classes in the current representative set:

Similar structures

None found
Copyright 2026 BGSU RNA group. Page generated in 0.109 s