Exact match 1384;

#Equivalence classRepresentativeResolutionNtsClass members
1NR_4.0_65795.24
Exact match
Thermus thermophilus
1FJG|1|A (1FJG)
  • 16S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å1507(368) 1FJG|1|A, 2UUA|1|A, 4OX9|1|A, 1J5E|1|A, 4YY3|1|A, 1IBL|1|A, 5DFE|1|XA, 1N32|1|A, 1HR0|1|A, 4B3M|1|A, 2UUC|1|A, 2UUB|1|A, 2UU9|1|A, 5DFE|1|QA, 1HNW|1|A, 4LF8|1|A, 4LF7|1|A, 2VQE|1|A, 4X64|1|A, 5J8B|1|a, 4W2I|1|AA, 4B3R|1|A, 5FDV|1|1a, 5J30|1|QA, 1HNX|1|A, 4W2I|1|CA, 5J4C|1|1a, 4LF6|1|A, 4X65|1|A, 4JI1|1|A, 4V9H|1|AA, 4Y4O|1|1a, 5J3C|1|QA, 2VQF|1|A, 5CZP|1|QA, 4Z8C|1|1a, 4B3T|1|A, 4Y4O|1|2a, 5FDU|1|1a, 1VY4|1|AA, 4LF9|1|A, 4W2G|1|AA, 5FDU|1|2a, 4LF4|1|A, 5J4B|1|1a, 1IBK|1|A, 4LFB|1|A, 4W2F|1|AA, 2UXC|1|A, 3T1Y|1|A, 4JI7|1|A, 1VY5|1|AA, 4W2E|1|a, 5J30|1|XA, 4ZSN|1|XA, 4X62|1|A, 4W2F|1|CA, 4WPO|1|DA, 4B3S|1|A, 5FDV|1|2a, 5CZP|1|XA, 5J3C|1|XA, 4W4G|1|XA, 5F8K|1|1a, 4Z3S|1|1a, 5BR8|1|A, 1VY5|1|CA, 5DOY|1|1a, 1HNZ|1|A, 1IBM|1|A, 4W2G|1|CA, 4AQY|1|A, 4WPO|1|BA, 4Y4P|1|1a, 5DOY|1|2a, 5IWA|1|A, 4DV6|1|A, 4YZV|1|XA, 4KHP|1|A, 4GKJ|1|A, 4DR6|1|A, 1XMQ|1|A, 4X66|1|A, 1XNQ|1|A, 1XNR|1|A, 4DR2|1|A, 5HAU|1|2a, 4ZER|1|2a, 4ZER|1|1a, 4V8I|1|AA, 4TUA|1|QA, 5J4B|1|2a, 4Z8C|1|2a, 4L47|1|QA, 4TUD|1|QA, 5HCQ|1|1a, 4TUD|1|XA, 4GKK|1|A, 4LFC|1|A, 4YPB|1|XA, 5HCQ|1|2a, 5HAU|1|1a, 4JYA|1|A, 4LNT|1|QA, 4TUE|1|QA, 4LT8|1|QA, 5HD1|1|2a, 4V67|1|AA, 4DR5|1|A, 4P6F|1|QA, 4TUE|1|XA, 4Z3S|1|2a, 4W2H|1|CA, 4V5R|1|AA, 5F8K|1|2a, 5HCP|1|2a, 4W2H|1|AA, 4V8D|1|CA, 4V67|1|CA, 5J4C|1|2a, 2E5L|1|A, 4V63|1|AA, 4V8I|1|CA, 4V5R|1|CA, 2ZM6|1|A, 4V83|1|AA, 5HCR|1|2a, 4V63|1|CA, 4WQY|1|BA, 4DUY|1|A, 4LNT|1|XA, 5HCR|1|1a, 4DR3|1|A, 4V83|1|CA, 4JI3|1|A, 4LFA|1|A, 4V9R|1|CA, 4V5P|1|CA, 4K0K|1|A, 4TUC|1|QA, 4Y4P|1|2a, 4JV5|1|A, 2HHH|1|A, 1VY4|1|CA, 4WT8|1|Ab, 4TUA|1|XA, 1VY6|1|AA, 4WQF|1|BA, 4LT8|1|XA, 4TUC|1|XA, 4L47|1|XA, 4P6F|1|XA, 5HCP|1|1a, 5HD1|1|1a, 4V6F|1|CA, 4V8B|1|CA, 4V8C|1|DA, 4JI6|1|A, 4V9S|1|AA, 4V5P|1|AA, 4V9S|1|CA, 4V87|1|CA, 4JI5|1|A, 1XMO|1|A, 4JI8|1|A, 4TUB|1|QA, 4WQ1|1|1G, 4DV7|1|A, 2UXD|1|A, 3T1H|1|A, 4WT8|1|Bb, 1VY7|1|AA, 4V95|1|AA, 4W4G|1|QA, 4V9I|1|AA, 4V6F|1|BA, 4TUB|1|XA, 4LSK|1|XA, 4V7M|1|CA, 4V5S|1|CA, 4ZSN|1|QA, 4V5Q|1|AA, 4V7P|1|AA, 4V5S|1|AA, 4V7P|1|DA, 4WQU|1|BA, 4YZV|1|QA, 4V8D|1|AA, 5LMN|1|A, 4LEL|1|QA, 1N33|1|A, 4V95|1|CA, 4V9Q|1|DA, 4V9Q|1|BA, 4V8U|1|CA, 4V9R|1|AA, 4WZD|1|1G, 1VY6|1|CA, 5IBB|1|1G, 4V87|1|BA, 4V5C|1|AA, 4V5L|1|AA, 4V7M|1|AA, 2UXB|1|A, 4LSK|1|QA, 4L71|1|QA, 4V8C|1|CA, 5IB7|1|13, 4V9J|1|AA, 4V9I|1|CA, 4V5C|1|CA, 4V8E|1|DA, 4V8U|1|AA, 4L71|1|XA, 4V8A|1|DA, 1VY7|1|CA, 4V8B|1|AA, 4V5F|1|AA, 4V5F|1|CA, 4WQ1|1|13, 4V9L|1|CA, 5IBB|1|13, 4WQY|1|DA, 4YPB|1|QA, 4WU1|1|1G, 4DV4|1|A, 4V8A|1|CA, 4V9J|1|CA, 4V8F|1|CA, 4WQF|1|DA, 4NXN|1|A, 4DR1|1|A, 4V8E|1|BA, 4V90|1|AA, 1VVJ|1|QA, 4DR4|1|A, 4V8J|1|CA, 4LF5|1|A, 4V8J|1|AA, 4V6G|1|AA, 4V6G|1|CA, 5E81|1|13, 4V9B|1|CA, 4V9M|1|CA, 4V7J|1|Aa, 4V9L|1|AA, 4V51|1|CA, 4V5D|1|CA, 4LEL|1|XA, 4WQU|1|DA, 4V9A|1|AA, 4V7J|1|Ba, 1VVJ|1|XA, 4V9M|1|AA, 4WZD|1|13, 4V6A|1|CA, 4V5J|1|AA, 4V5D|1|AA, 1I94|1|A, 5IB8|1|13, 5E81|1|1G, 4V97|1|AA, 4V51|1|AA, 5D8B|1|UC, 5D8B|1|YC, 4V9B|1|AA, 4V9K|1|AA, 4V5J|1|CA, 4LFZ|1|QA, 5DOX|1|1a, 5EL7|1|1G, 4DR7|1|A, 4V9K|1|CA, 4WRA|1|1G, 4DV0|1|A, 4NXM|1|A, 4V9A|1|CA, 4V9N|1|CA, 4JI2|1|A, 4P70|1|QA, 4WSD|1|13, 4V9N|1|AA, 4V5Q|1|CA, 4JI0|1|A, 4V8X|1|AA, 4V97|1|CA, 5EL7|1|13, 5DOX|1|2a, 5EL6|1|1G, 4WSD|1|1G, 4WSM|1|1G, 5EL6|1|13, 4XEJ|1|A16S, 4V8Q|1|BA, 4V8X|1|CA, 4WR6|1|1G, 4WRA|1|13, 5EL4|1|13, 4V8G|1|CA, 4WQR|1|1G, 4V7W|1|AA, 4P70|1|XA, 4DV3|1|A, 4V7K|1|Aa, 5IB8|1|1G, 5LMU|1|A, 4V7K|1|Ba, 4WR6|1|13, 4DV5|1|A, 5E7K|1|13, 4WU1|1|13, 4V7W|1|CA, 4WRO|1|1G, 5IB7|1|1G, 4WQR|1|13, 4WRO|1|13, 4V7X|1|AA, 4V5E|1|AA, 4WSM|1|13, 5EL4|1|1G, 4DUZ|1|A, 4V5E|1|CA, 4V7X|1|CA, 4V8F|1|BA, 4V8H|1|AA, 4V7Y|1|CA, 2F4V|1|A, 4DV1|1|A, 4V84|1|CA, 4W29|1|AA, 4V7Y|1|AA, 4V84|1|AA, 4XEJ|1|B16S, 4V8H|1|CA, 5E7K|1|1G, 4LFZ|1|XA, 4V6A|1|AA, 4V8N|1|AA, 4JI4|1|A, 4WT1|1|13, 4V8N|1|CA, 5EL5|1|13, 4V5K|1|AA, 4WZO|1|13, 4W29|1|CA, 4V7Z|1|AA, 4WT1|1|1G, 3OTO|1|A, 4V7Z|1|CA, 4DV2|1|A, 4V8G|1|AA, 4WZO|1|1G, 4V8O|1|AA, 4V7L|1|CA, 4V7L|1|AA, 4V4J|1|y, 4V5A|1|AA, 4V5K|1|CA, 4V5A|1|CA, 5EL5|1|1G, 4YHH|1|A, 4V5G|1|CA, 4V4I|1|y, 4V5G|1|AA, 1N34|1|A, 1N36|1|A, 5IMQ|1|A, 1FKA|1|A
2NR_4.0_42622.20
Exact match
Thermus thermophilus
4V8C|1|AB (4V8C)
  • 5S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): AB; model(s): 1
3.3 Å122(276) 4V8C|1|AB, 5J4D|1|C, 5J4D|1|HB, 4WU1|1|16, 5IB7|1|16, 4V8E|1|CB, 4Z3S|1|1B, 4Y4P|1|1B, 4WQF|1|AB, 4WQY|1|AB, 4V9R|1|BB, 4W2G|1|BB, 4V9S|1|BB, 1VY4|1|BB, 4TUE|1|RB, 4TUC|1|YB, 4P6F|1|YB, 4LT8|1|YB, 4TUE|1|YB, 4WZD|1|16, 5IB8|1|16, 5E81|1|16, 4WQ1|1|16, 4WRO|1|16, 4WQ1|1|1J, 4V87|1|AB, 4V6F|1|DB, 5HAU|1|1B, 5DOY|1|1B, 5FDV|1|1B, 5J4C|1|1B, 4ZER|1|1B, 4WPO|1|AB, 5J8B|1|B, 1VY7|1|BB, 1VY6|1|BB, 4V8H|1|BB, 4W2H|1|DB, 4TUB|1|RB, 4TUD|1|RB, 4L71|1|RB, 5CZP|1|YB, 4L47|1|YB, 5DFE|1|YB, 5J3C|1|YB, 4TUB|1|YB, 5J30|1|YB, 4TUD|1|YB, 5FDU|1|1B, 4V5P|1|BB, 4V5P|1|DB, 4WSD|1|16, 5EL4|1|16, 5E81|1|1J, 5IBB|1|1J, 4V8E|1|AB, 4V8D|1|BB, 4V8C|1|BB, 4V8B|1|BB, 4V8D|1|DB, 4Y4O|1|1B, 5HCQ|1|1B, 4ZER|1|2B, 5FDV|1|2B, 4Z3S|1|2B, 4WQU|1|AB, 4W2E|1|B, 4W2I|1|BB, 4W2F|1|BB, 4V95|1|BB, 1VY5|1|BB, 4WQY|1|CB, 4WPO|1|CB, 4V9R|1|DB, 4L47|1|RB, 4P6F|1|RB, 4LT8|1|RB, 5CZP|1|RB, 4LNT|1|RB, 4P70|1|YB, 4TUA|1|YB, 4LNT|1|YB, 5D8B|1|AD, 4V9I|1|BB, 4V8J|1|BB, 4V5C|1|BB, 4WT8|1|Cs, 4V5C|1|DB, 4V9M|1|DB, 5D8B|1|WC, 5EL6|1|16, 4WSM|1|16, 5E7K|1|16, 4WRA|1|16, 4V8F|1|AB, 4V87|1|DB, 4Z8C|1|1B, 5HCP|1|1B, 5HD1|1|1B, 5DOX|1|1B, 5F8K|1|2B, 5HAU|1|2B, 4Y4O|1|2B, 5FDU|1|2B, 5HCQ|1|2B, 4W2H|1|BB, 4WQU|1|CB, 4WQF|1|CB, 4V6G|1|DB, 4V8H|1|DB, 4V9S|1|DB, 5J3C|1|RB, 4TUA|1|RB, 4P70|1|RB, 5DFE|1|RB, 5J30|1|RB, 4LFZ|1|YB, 4L71|1|YB, 4LEL|1|YB, 4V9Q|1|AB, 4V5E|1|BB, 4V9Q|1|CB, 4V97|1|DB, 4V5E|1|DB, 4V9I|1|DB, 4V8J|1|DB, 4WT8|1|Ds, 4WT1|1|16, 4WQR|1|16, 5EL7|1|16, 5EL5|1|16, 4WR6|1|16, 5EL6|1|1J, 4WSM|1|1J, 5IB7|1|1J, 4V9A|1|BB, 4V8F|1|DB, 4V8B|1|DB, 4W4G|1|YB, 5HCR|1|1B, 5J4B|1|1B, 5F8K|1|1B, 4V8I|1|BB, 1VY5|1|DB, 4W2G|1|DB, 4W2I|1|DB, 4LEL|1|RB, 4TUC|1|RB, 4LSK|1|YB, 4V67|1|BB, 4V6A|1|BB, 4V83|1|BB, 4V9K|1|BB, 4V83|1|DB, 4V9L|1|DB, 4V5D|1|DB, 4V6A|1|DB, 4V67|1|DB, 4WZO|1|16, 5EL7|1|1J, 4WRA|1|1J, 5HCR|1|2B, 5DOX|1|2B, 4V8G|1|BB, 4V8I|1|DB, 1VVJ|1|RB, 4LSK|1|RB, 4LFZ|1|RB, 4V5D|1|BB, 4V5F|1|BB, 4V8U|1|BB, 4V5R|1|BB, 4V9N|1|BB, 4V97|1|BB, 4V7X|1|BB, 4V5J|1|BB, 4V63|1|DB, 4V8U|1|DB, 4V5F|1|DB, 4V5J|1|DB, 4V5R|1|DB, 4V9N|1|DB, 5IBB|1|16, 4WZD|1|1J, 5E7K|1|1J, 4ZSN|1|YB, 4YZV|1|YB, 4Z8C|1|2B, 4V8A|1|AB, 4V8A|1|BB, 4V8G|1|DB, 4V95|1|DB, 4W2F|1|DB, 4V7L|1|BB, 4V5Q|1|BB, 4V7M|1|BB, 4V9L|1|BB, 4V9H|1|BB, 4V7P|1|BB, 4V63|1|BB, 4V9M|1|BB, 4V7Y|1|BB, 4V7P|1|CB, 4V7Y|1|DB, 4V7X|1|DB, 4V9K|1|DB, 4V84|1|DB, 4WR6|1|1J, 4V9B|1|BB, 4V9A|1|DB, 4V9B|1|DB, 4W4G|1|RB, 4YZV|1|RB, 5HD1|1|2B, 5DOY|1|2B, 1VY4|1|DB, 1VVJ|1|YB, 4V7J|1|AB, 4V51|1|BB, 4V90|1|BB, 4V84|1|BB, 4V7W|1|BB, 4V7J|1|BB, 4V51|1|DB, 4V5Q|1|DB, 4V7W|1|DB, 4WSD|1|1J, 4WQR|1|1J, 4WU1|1|1J, 4V6F|1|AB, 4ZSN|1|RB, 4YPB|1|YB, 5J4C|1|2B, 5HCP|1|2B, 5J4B|1|2B, 4V4J|1|x, 4V7L|1|DB, 4V8N|1|BB, 4W29|1|BB, 4V8N|1|DB, 4YPB|1|RB, 1VY6|1|DB, 1VY7|1|DB, 4XEJ|1|A5S, 4V8Q|1|AB, 4V7K|1|AB, 4V7K|1|BB, 4V5S|1|BB, 4V9J|1|BB, 4V5S|1|DB, 4WZO|1|1J, 5EL4|1|1J, 5EL5|1|1J, 4Y4P|1|2B, 4XEJ|1|B5S, 4V5K|1|BB, 4V8X|1|BB, 4V5K|1|DB, 4V5A|1|DB, 4V8X|1|DB, 4V9J|1|DB, 4V6G|1|BB, 4V4I|1|x, 4WT1|1|1J, 5IB8|1|1J, 4V5G|1|BB, 4V5A|1|BB, 4WRO|1|1J, 4V5G|1|DB, 4V8O|1|BB, 4V5L|1|BB, 4W29|1|DB, 4V7Z|1|BB, 4V7Z|1|DB, 5IMQ|1|E, 4V7M|1|DB
3NR_4.0_97519.20
Exact match
Thermus thermophilus
5FDU|1|1A (5FDU)
  • 23S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): 1A; model(s): 1
2.9 Å2861(276) 5FDU|1|1A, 5HCQ|1|1A, 5HCR|1|1A, 5FDV|1|1A, 4Y4O|1|1A, 5HD1|1|1A, 4Z8C|1|1A, 5HCP|1|1A, 4V8I|1|DA, 4Y4P|1|1A, 4ZER|1|1A, 4V9R|1|BA, 5F8K|1|1A, 1VY4|1|BA, 4W2H|1|BA, 4V9S|1|BA, 5DFE|1|YA, 4WPO|1|AA, 4W2F|1|BA, 5J4B|1|1A, 5DOY|1|1A, 4Z3S|1|1A, 5DFE|1|RA, 4W2G|1|BA, 5CZP|1|RA, 4W2I|1|BA, 5FDV|1|2A, 5J4C|1|1A, 4V8I|1|BA, 4Y4O|1|2A, 5J30|1|RA, 5CZP|1|YA, 4V9R|1|DA, 4V9S|1|DA, 4V95|1|BA, 5J30|1|YA, 1VY5|1|BA, 5J8B|1|A, 5FDU|1|2A, 5HCQ|1|2A, 4Z8C|1|2A, 5F8K|1|2A, 5J3C|1|RA, 1VY4|1|DA, 1VY7|1|BA, 4W2H|1|DA, 4V8H|1|DA, 5HAU|1|1A, 4V8A|1|BA, 4V8G|1|DA, 4WQY|1|AA, 4W2F|1|DA, 4V8G|1|BA, 5J3C|1|YA, 4Z3S|1|2A, 4YZV|1|YA, 4W2I|1|DA, 4WQF|1|AA, 4WQU|1|AA, 1VY6|1|BA, 4V8A|1|AA, 5DOX|1|1A, 4V83|1|BA, 4V83|1|DA, 5HD1|1|2A, 4WPO|1|CA, 5HCR|1|2A, 4V8H|1|BA, 4W4G|1|YA, 4V95|1|DA, 4W2G|1|DA, 4YZV|1|RA, 1VY5|1|DA, 5J4B|1|2A, 4Y4P|1|2A, 4V9H|1|BA, 5HCP|1|2A, 1VY7|1|DA, 5HAU|1|2A, 4ZER|1|2A, 5J4C|1|2A, 4LNT|1|YA, 5DOY|1|2A, 4W4G|1|RA, 4V6F|1|DA, 5J4D|1|GB, 4LT8|1|YA, 4V84|1|DA, 4WQU|1|CA, 4W2E|1|A, 5J4D|1|B, 4ZSN|1|YA, 4ZSN|1|RA, 4V84|1|BA, 4V8B|1|BA, 4YPB|1|RA, 5DOX|1|2A, 4V9N|1|DA, 4WQY|1|CA, 4L47|1|RA, 4V5D|1|DA, 4YPB|1|YA, 4TUA|1|YA, 4V9N|1|BA, 4LT8|1|RA, 4V87|1|AA, 1VY6|1|DA, 4V5D|1|BA, 4V9I|1|DA, 4WQF|1|CA, 4V9I|1|BA, 4V5E|1|BA, 4V8C|1|AA, 4V7P|1|BA, 4P6F|1|YA, 4V97|1|DA, 4V7P|1|CA, 4V9Q|1|AA, 4V5E|1|DA, 4TUE|1|YA, 4V9Q|1|CA, 4V8N|1|DA, 4V67|1|DA, 4V8B|1|DA, 4P6F|1|RA, 4TUD|1|RA, 4LNT|1|RA, 4TUE|1|RA, 4V8N|1|BA, 5IBB|1|1H, 4V5C|1|DA, 4V67|1|BA, 4V87|1|DA, 4V8D|1|BA, 4WT8|1|D1, 4L47|1|YA, 4V5C|1|BA, 4V6G|1|DA, 4V7Y|1|BA, 4V8J|1|BA, 4V8J|1|DA, 4TUA|1|RA, 4TUB|1|YA, 4TUD|1|YA, 4V6F|1|AA, 4V7X|1|BA, 4V7J|1|BA, 4LSK|1|YA, 4V7Y|1|DA, 4V7J|1|AA, 4V7X|1|DA, 4WQ1|1|1H, 4V8F|1|AA, 5IB7|1|1H, 4L71|1|RA, 4V7W|1|BA, 4TUC|1|YA, 4WT8|1|C1, 4V7M|1|BA, 4V7W|1|DA, 5IBB|1|14, 4L71|1|YA, 4V8E|1|AA, 4TUB|1|RA, 4V6A|1|BA, 1VVJ|1|YA, 4V90|1|BA, 4V9B|1|BA, 4V7K|1|AA, 4V7K|1|BA, 5E81|1|1H, 4V5K|1|DA, 4V8D|1|DA, 4LSK|1|RA, 4V8C|1|BA, 4V5K|1|BA, 4WZD|1|1H, 5IB8|1|1H, 4V5J|1|DA, 4V5J|1|BA, 1VVJ|1|RA, 4V97|1|BA, 5E7K|1|1H, 4V8X|1|BA, 4V63|1|BA, 4V8E|1|CA, 4V8X|1|DA, 4V63|1|DA, 4WRO|1|1H, 5EL6|1|1H, 4V6G|1|BA, 5E81|1|14, 4WQ1|1|14, 4TUC|1|RA, 4V51|1|BA, 5IB7|1|14, 4V51|1|DA, 4WSD|1|1H, 4LEL|1|YA, 4WRA|1|1H, 4V7M|1|DA, 4WZD|1|14, 4WR6|1|1H, 5IB8|1|14, 4WQR|1|1H, 5EL4|1|1H, 4WT1|1|1H, 4V9A|1|BA, 4LEL|1|RA, 4WU1|1|1H, 5EL7|1|1H, 4V8F|1|DA, 4V9M|1|BA, 4V9K|1|DA, 5EL5|1|1H, 4WSM|1|1H, 4V9L|1|BA, 4V7Z|1|DA, 4V7Z|1|BA, 5EL7|1|14, 4WU1|1|14, 4V9B|1|DA, 4V9M|1|DA, 4V6A|1|DA, 4V9L|1|DA, 5EL4|1|14, 4V5P|1|DA, 5EL6|1|14, 4V9A|1|DA, 5D8B|1|VC, 4V8U|1|BA, 4WSD|1|14, 4WR6|1|14, 5D8B|1|ZC, 4V5P|1|BA, 4V5F|1|BA, 4P70|1|YA, 4V5F|1|DA, 4V9K|1|BA, 4V8Q|1|AA, 4V8U|1|DA, 4LFZ|1|YA, 4WRA|1|14, 4WRO|1|14, 4V5R|1|BA, 4V5R|1|DA, 5E7K|1|14, 4P70|1|RA, 4WQR|1|14, 5EL5|1|14, 4LFZ|1|RA, 4WZO|1|1H, 4WSM|1|14, 4XEJ|1|A23S, 4V9J|1|BA, 4V5L|1|BA, 4XEJ|1|B23S, 4V7L|1|BA, 4V9J|1|DA, 4V5S|1|BA, 4WT1|1|14, 4V5Q|1|BA, 4V5S|1|DA, 4WZO|1|14, 4W29|1|BA, 4V5Q|1|DA, 4W29|1|DA, 4V5A|1|BA, 4V5A|1|DA, 4V4J|1|w, 4V7L|1|DA, 4V4I|1|w, 4V8O|1|BA, 4V5G|1|DA, 4V5G|1|BA, 5IMQ|1|D
4NR_4.0_35542.35
Exact match
Escherichia coli
4V9R|1|AX (4V9R)
  • P-site tRNA
  • X-RAY DIFFRACTION
  • Chain(s): AX; model(s): 1
3.0 Å76(231) 4V9R|1|AX, 4V9S|1|AX, 5J30|1|QV, 4TUD|1|QV, 5J3C|1|QV, 4TUA|1|QV, 5U9G|1|W, 4P70|1|XV, 4V5F|1|AV, 4V9S|1|CX, 4V9R|1|CX, 3JCE|1|8, 4V7M|1|AX, 4V63|1|AY, 4V67|1|AY, 4V87|1|BC, 4V8F|1|CC, 4V9I|1|CV, 4V6A|1|CW, 4V63|1|CY, 4V67|1|CY, 4V8C|1|DC, 4YZV|1|QV, 4TUB|1|QV, 4TUB|1|XV, 5J30|1|XV, 4TUD|1|XV, 5J3C|1|XV, 5MDV|1|5, 5LZD|1|v, 4V5F|1|CV, 4Z3S|1|1x, 5DOY|1|2x, 5L4O|1|A, 5KPS|1|31, 5KPW|1|31, 5KPS|1|32, 4V8B|1|AC, 4V67|1|AZ, 4V63|1|AZ, 4V8E|1|BC, 4V8Q|1|BV, 4V8B|1|CC, 4V6G|1|CC, 4V8C|1|CC, 4V8J|1|CV, 4V63|1|CZ, 4V67|1|CZ, 4V8E|1|DC, 5D8B|1|ED, 5D8B|1|FD, 4TUC|1|QV, 4ZSN|1|QV, 4P70|1|QV, 4LT8|1|QV, 5U9F|1|W, 5CZP|1|XV, 4LNT|1|XV, 4W4G|1|XV, 4P6F|1|XV, 4LT8|1|XV, 4YZV|1|XV, 5DFE|1|XV, 5HCR|1|1x, 5HCP|1|1x, 5HCQ|1|1x, 4Y4P|1|1x, 4WRO|1|2K, 4Y4P|1|2x, 4Z8C|1|2x, 3CW5|1|A, 4W2I|1|AX, 4W2G|1|AX, 4W2H|1|AX, 4W2F|1|AX, 1VY5|1|AX, 4W2I|1|CX, 4W2G|1|CX, 4W2F|1|CX, 1VY5|1|CX, 5MDY|1|5, 5MDW|1|5, 5MDZ|1|5, 5H5U|1|5, 4V5C|1|AV, 5DOY|1|1x, 5IBB|1|2L, 4Z3S|1|2x, 1VY6|1|AX, 1VY4|1|AX, 1VY7|1|AX, 1VY6|1|CX, 4WPO|1|DX, 5KPX|1|31, 4V8D|1|AC, 4V9I|1|AV, 4V6A|1|AW, 4V87|1|CC, 4V7M|1|CX, 4LNT|1|QV, 4YPB|1|QV, 5DFE|1|QV, 4P6F|1|QV, 4TUC|1|XV, 4YPB|1|XV, 4TUA|1|XV, 4ZSN|1|XV, 5U4I|1|y, 5HAU|1|1w, 4Z8C|1|1x, 5J4B|1|1x, 4ZER|1|1x, 5HD1|1|1x, 5IB7|1|2K, 5EL4|1|2K, 4WQR|1|2K, 4WT1|1|2K, 4WSD|1|2K, 5EL6|1|2K, 5EL7|1|2K, 5IBB|1|2K, 5HAU|1|2w, 4ZER|1|2x, 5J4C|1|2x, 5HD1|1|2x, 5HCP|1|2x, 5HCR|1|2x, 5J4B|1|2x, 5HCQ|1|2x, 3CW6|1|A, 4WQY|1|BX, 5KPX|1|32, 4V8D|1|CC, 4V97|1|CV, 4L71|1|QV, 5CZP|1|QV, 4LEL|1|QV, 1VVJ|1|QV, 4W4G|1|QV, 4LFZ|1|QV, 4LSK|1|QV, 4LFZ|1|XV, 4LEL|1|XV, 4LSK|1|XV, 4L71|1|XV, 1VVJ|1|XV, 4WR6|1|2K, 4WPO|1|BX, 4V6G|1|CB, 5F8K|1|1x, 5J4C|1|1x, 5EL5|1|2K, 4WQ1|1|2K, 5E7K|1|2K, 5IB8|1|2K, 4WQ1|1|2L, 4WSD|1|2L, 5EL6|1|2L, 5F8K|1|2x, 4W2H|1|CX, 4WQY|1|DX, 4V51|1|AV, 4V51|1|CV, 4V5F|1|CW, 4WRA|1|2L, 4WZO|1|2L, 5J4D|1|IA, 5J4D|1|NC, 5LZA|1|v, 4V6G|1|AC, 4V5K|1|AV, 4V97|1|AV, 4V7P|1|AW, 4V7L|1|AX, 5D8B|1|BD, 4V7P|1|DW, 5D8B|1|XC, 5U4I|1|x, 1VY4|1|CX, 1VY7|1|CX, 4WZO|1|1K, 4WZO|1|2K, 5IB7|1|2L, 5E7K|1|2L, 5IB8|1|2L, 2FMT|1|C, 2FMT|1|D, 5LMU|1|Z, 4V5C|1|CV, 4WRA|1|2K, 3J9Y|1|v, 5AFI|1|v, 5KPW|1|32, 4V8F|1|BC, 4V6G|1|CD, 5U9F|1|X, 5U9G|1|X, 5EL4|1|2L, 4WRO|1|2L, 5IQR|1|5, 5J4D|1|D, 5J4D|1|IB, 5L3P|1|x, 4V8J|1|AV, 4V5K|1|CV, 5EL5|1|2L, 4WQR|1|2L, 4WT1|1|2L, 5EL7|1|2L, 4YPB|1|QW, 4W4G|1|QW, 4W4G|1|XW, 4YPB|1|XW, 4WR6|1|2L, 3JCJ|1|v, 4V6G|1|AD, 4V7L|1|CX, 4V5F|1|AW, 4V8Q|1|BW, 4V8O|1|AV, 5U4J|1|x+5U4J|1|z, 4V8C|1|CD, 4V8B|1|AD, 4V87|1|CD, 4V8C|1|DD, 4V87|1|BD, 4V8B|1|CD, 5AFI|1|w, 3QSY|1|D, 4V5K|1|AW, 4V5K|1|CW
5NR_4.0_19951.14
Exact match
Escherichia coli
4YCO|1|D (4YCO)
  • tRNAphe
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.1 Å74(160) 4YCO|1|D, 2ZXU|1|C, 2ZM5|1|C, 4YCO|1|E, 3FOZ|1|C, 3L0U|1|A, 4YCO|1|F, 4V5E|1|AV, 4V9D|1|BV, 3FOZ|1|D, 3JCE|1|6, 4V5D|1|AV, 4V5D|1|CV, 4V9C|1|AV, 4V5Q|1|AV, 4WOI|1|DW, 4V5P|1|AV, 4V5S|1|AV, 4V5L|1|AV, 4V5P|1|CV, 4Z3S|1|2w, 2ZM5|1|D, 4V6F|1|CC, 4V5J|1|CV, 4W2F|1|AW, 5AFI|1|y, 4V5R|1|AV, 4V5E|1|CV, 4V5R|1|CV, 4V5Q|1|CV, 5DOY|1|1w, 2ZXU|1|D, 4V6F|1|BC, 4Z3S|1|1w, 5J4B|1|1w, 4Y4P|1|1w, 5IQR|1|6, 4V5S|1|CV, 4W2E|1|w, 4V9H|1|AV, 1VY5|1|AW, 4WQU|1|BW, 4WQF|1|BW, 4WQU|1|DW, 4WQF|1|DW, 4V5J|1|AV, 5J4C|1|1w, 5DOY|1|1y, 4Z3S|1|1y, 5J4B|1|1y, 5DOY|1|2w, 4W2I|1|AW, 1VY4|1|AY, 4W2E|1|x, 3JCD|1|8, 5J4C|1|2y, 5J4B|1|2y, 4Y4P|1|2y, 5KPW|1|30, 5KPX|1|30, 4P6F|1|XW, 5J4C|1|1y, 4W2G|1|AW, 1VY5|1|CW, 4WPO|1|DW, 4Y4P|1|2w, 4V6F|1|CB, 1VY4|1|AW, 4V9D|1|AV, 4W2G|1|AY, 4W2F|1|AY, 4WQU|1|BY, 4WPO|1|BY, 4WQF|1|BY, 4V4I|1|z, 1VY4|1|CW, 5J4B|1|2w, 4W2G|1|CW, 4V6F|1|BB, 4V6F|1|BD, 4V6F|1|CD, 4Z3S|1|2y, 5DOY|1|2y, 4W2F|1|CY, 1VY4|1|CY, 4W2G|1|CY, 4V5G|1|AV, 4V51|1|AW, 4V5G|1|CV, 4Y4P|1|1y, 4W2I|1|AY, 1VY5|1|AY, 4W2I|1|CW, 4V9I|1|AW, 4V5D|1|AW, 4V5C|1|CW, 4P6F|1|QW, 4WPO|1|BW, 4W2I|1|CY, 4WQU|1|DY, 4WPO|1|DY, 4WQF|1|DY, 5J4C|1|2w, 4W2F|1|CW, 4V97|1|AW, 4V51|1|CW, 4V5D|1|CW, 1VY5|1|CY, 4WT1|1|3L, 4V8J|1|AW, 3JCD|1|9, 4V5C|1|AW, 3JBV|1|V, 4WSD|1|3L, 4V5Q|1|AW, 4V5E|1|CW, 4WSD|1|1L, 4WSD|1|3K, 4WT1|1|1K, 4WT1|1|1L, 4V5P|1|AW, 4V5R|1|AW, 4V8J|1|CW, 4V5P|1|CW, 4V97|1|CW, 4V9I|1|CW, 4WRO|1|1L, 4V5D|1|AY, 4V5J|1|CW, 4V5D|1|CY, 5IQR|1|4, 4V5L|1|AW, 4V9C|1|CV, 4WQR|1|3K, 4WQR|1|3L, 3JCE|1|9, 4V5S|1|AW, 4WOI|1|AX, 4V5R|1|CW, 4WQR|1|1K, 4V5C|1|CY, 4WSD|1|1K, 4V5G|1|AW, 4V5G|1|CW, 4WRO|1|1K, 4WRO|1|3K, 4WRO|1|3L, 4V5J|1|AW, 4WZO|1|3K, 4V5Q|1|CW, 4WQR|1|1L, 4WZO|1|3L, 4W2H|1|AY, 4WT1|1|3K, 4V5E|1|AW, 4V5C|1|AY, 4V5S|1|CW, 1VY7|1|AY, 1VY7|1|CY, 4W2H|1|CY
6NR_4.0_83717.25
Exact match
Escherichia coli
5J7L|1|DA (5J7L)
  • 23S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): DA; model(s): 1
3.0 Å2886(123) 5J7L|1|DA, 4V54|1|DB, 5J5B|1|DA, 5J91|1|DA, 4V54|1|BB, 5J8A|1|DA, 4WWW|1|RA, 5IT8|1|DA, 4V7T|1|BA, 5J88|1|DA, 4V6C|1|BA, 4V52|1|DB, 5JC9|1|DA, 4YBB|1|DA, 4V7S|1|BA, 4V52|1|BB, 5KCR|1|1A, 4V4Q|1|DB, 5MDV|1|1, 5MDZ|1|1, 4V7U|1|BA, 5J91|1|CA, 5J5B|1|CA, 5MDW|1|1, 4V4Q|1|BB, 4V50|1|DB, 4V53|1|DB, 5GAE|1|A, 4V9P|1|EA, 4V50|1|BB, 4V85|1|BA, 5H5U|1|A, 4V53|1|BB, 4V4H|1|DB, 5J8A|1|CA, 4V9O|1|EA, 4V4H|1|BB, 4V55|1|DB, 4V57|1|BB, 4V7V|1|BA, 5GAG|1|A, 4V64|1|BB, 4V57|1|DB, 5MDY|1|1, 4V64|1|DB, 5J7L|1|CA, 4V55|1|BB, 5JC9|1|CA, 5LZD|1|A, 4V89|1|BA, 4V6D|1|BA, 4V9D|1|CA, 5GAD|1|A, 5GAH|1|A, 4U27|1|BA, 4U25|1|BA, 5IQR|1|1, 4U24|1|BA, 4V6E|1|BA, 5IT8|1|CA, 4V9P|1|CA, 4V9P|1|AA, 4V9O|1|AA, 4WF1|1|BA, 4U1U|1|BA, 3J7Z|1|A, 4V9O|1|CA, 4V56|1|DB, 4UY8|1|A, 4U1V|1|BA, 4V56|1|BB, 4V9P|1|GA, 4U20|1|BA, 4U26|1|BA, 4YBB|1|CA, 4WOI|1|BA, 5MGP|1|A, 5J88|1|CA, 3J9Y|1|A, 5AFI|1|A, 4V9D|1|DA, 4U1U|1|DA, 4V6D|1|DA, 5JTE|1|BA, 5KPS|1|28, 4WOI|1|CA, 4U20|1|DA, 5KPW|1|27, 5JU8|1|BA, 5LZE|1|A, 5KPX|1|27, 5LZA|1|A, 5U9G|1|01, 4V6C|1|DA, 5U9F|1|01, 4V9C|1|DA, 4U1V|1|DA, 4U25|1|DA, 4V6E|1|DA, 4V9O|1|GA, 4U27|1|DA, 4V7S|1|DA, 4V7T|1|DA, 4V7V|1|DA, 3JCE|1|A, 4WF1|1|DA, 5U4I|1|A, 3J9Z|1|LA, 3JCJ|1|A, 4WWW|1|YA, 4U24|1|DA, 4U26|1|DA, 4V9C|1|BA, 5L3P|1|A, 5KCS|1|1A, 3JBV|1|b, 4V7U|1|DA, 3JA1|1|LA, 3JCD|1|A, 3JBU|1|b, 4V5B|1|AB, 4V5B|1|CB, 5U4J|1|A
7NR_4.0_10157.25
Exact match
Escherichia coli
4U26|1|BB (4U26)
  • 5S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): BB; model(s): 1
2.8 Å119(122) 4U26|1|BB, 5MDW|1|3, 3J9Y|1|B, 5AFI|1|B, 5J88|1|DB, 4U20|1|DB, 4WWW|1|RB, 4WF1|1|BB, 4U27|1|BB, 4U24|1|BB, 4V6E|1|DB, 4V6D|1|DB, 5KCR|1|1B, 5H5U|1|B, 5LZE|1|B, 5J8A|1|DB, 5J7L|1|DB, 4YBB|1|DB, 4V7T|1|BB, 4V7V|1|BB, 4V6D|1|BB, 5J88|1|CB, 4U1U|1|DB, 4U25|1|BB, 4U1U|1|BB, 4U1V|1|BB, 4V9C|1|DB, 4V56|1|BA, 4V56|1|DA, 4V6C|1|DB, 5MDY|1|3, 5GAG|1|B, 5MGP|1|B, 5J5B|1|DB, 5JC9|1|DB, 5IT8|1|DB, 5J91|1|DB, 5IQR|1|3, 5JU8|1|BB, 4V6C|1|BB, 4V7S|1|BB, 5J7L|1|CB, 4U20|1|BB, 4V9D|1|CB, 4V55|1|BA, 4V50|1|BA, 4V54|1|BA, 4V54|1|DA, 4V50|1|DA, 4V55|1|DA, 4V7S|1|DB, 5KPX|1|28, 5MDZ|1|3, 5GAH|1|B, 5LZD|1|B, 5GAD|1|B, 3J9Z|1|LB, 4V6E|1|BB, 4V7U|1|BB, 4V9P|1|CB, 5J8A|1|CB, 5IT8|1|CB, 5J91|1|CB, 4YBB|1|CB, 5J5B|1|CB, 4U27|1|DB, 4V9D|1|DB, 4WF1|1|DB, 4U25|1|DB, 4WOI|1|BB, 4V64|1|BA, 4V64|1|DA, 4V7T|1|DB, 5KPW|1|28, 5KPS|1|29, 5MDV|1|3, 5GAE|1|B, 4V9O|1|AB, 3J7Z|1|B, 4UY8|1|B, 5JTE|1|BB, 4WOI|1|CB, 5JC9|1|CB, 4U24|1|DB, 4U1V|1|DB, 4V57|1|BA, 4V4Q|1|BA, 4V53|1|BA, 4V52|1|BA, 4V4H|1|BA, 4V4Q|1|DA, 4V4H|1|DA, 4V53|1|DA, 4V52|1|DA, 4V57|1|DA, 3JA1|1|LB, 4V85|1|BB, 4V9O|1|CB, 4U26|1|DB, 4V7V|1|DB, 4WWW|1|YB, 5LZA|1|B, 4V9P|1|AB, 4V9P|1|EB, 5U9G|1|02, 3JCJ|1|0, 3JCD|1|B, 4V9O|1|EB, 4V89|1|BB, 5U9F|1|02, 3JCE|1|B, 5U4I|1|B, 4V9O|1|GB, 4V9P|1|GB, 5KCS|1|1B, 4V7U|1|DB, 3JBV|1|a, 5L3P|1|B, 3JBU|1|a, 4V9C|1|BB, 4V5B|1|AA, 4V5B|1|CA
8NR_4.0_04268.1
Exact match
Panicum mosaic virus
4V99|1|Jw (4V99)
  • 5'-R(P*UP*UP*AP*AP*UP*AP*UP*UP*UP*UP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): Jw; model(s): 1
2.9 Å17(120) 4V99|1|Jw, 4V99|1|A2, 4V99|1|A7, 4V99|1|AD, 4V99|1|AI, 4V99|1|AN, 4V99|1|AS, 4V99|1|AX, 4V99|1|Ac, 4V99|1|Ah, 4V99|1|Am, 4V99|1|Ar, 4V99|1|Aw, 4V99|1|B2, 4V99|1|B7, 4V99|1|BD, 4V99|1|BI, 4V99|1|BN, 4V99|1|BS, 4V99|1|BX, 4V99|1|Bc, 4V99|1|Bh, 4V99|1|Bm, 4V99|1|Br, 4V99|1|Bw, 4V99|1|C2, 4V99|1|C7, 4V99|1|CD, 4V99|1|CI, 4V99|1|CN, 4V99|1|CS, 4V99|1|CX, 4V99|1|Cc, 4V99|1|Ch, 4V99|1|Cm, 4V99|1|Cr, 4V99|1|Cw, 4V99|1|D2, 4V99|1|D7, 4V99|1|DD, 4V99|1|DI, 4V99|1|DN, 4V99|1|DS, 4V99|1|DX, 4V99|1|Dc, 4V99|1|Dh, 4V99|1|Dm, 4V99|1|Dr, 4V99|1|Dw, 4V99|1|E2, 4V99|1|E7, 4V99|1|ED, 4V99|1|EI, 4V99|1|EN, 4V99|1|ES, 4V99|1|EX, 4V99|1|Ec, 4V99|1|Eh, 4V99|1|Em, 4V99|1|Er, 4V99|1|Ew, 4V99|1|F2, 4V99|1|F7, 4V99|1|FD, 4V99|1|FI, 4V99|1|FN, 4V99|1|FS, 4V99|1|FX, 4V99|1|Fc, 4V99|1|Fh, 4V99|1|Fm, 4V99|1|Fr, 4V99|1|Fw, 4V99|1|G2, 4V99|1|G7, 4V99|1|GD, 4V99|1|GI, 4V99|1|GN, 4V99|1|GS, 4V99|1|GX, 4V99|1|Gc, 4V99|1|Gh, 4V99|1|Gm, 4V99|1|Gr, 4V99|1|Gw, 4V99|1|H2, 4V99|1|H7, 4V99|1|HD, 4V99|1|HI, 4V99|1|HN, 4V99|1|HS, 4V99|1|HX, 4V99|1|Hc, 4V99|1|Hh, 4V99|1|Hm, 4V99|1|Hr, 4V99|1|Hw, 4V99|1|I2, 4V99|1|I7, 4V99|1|ID, 4V99|1|II, 4V99|1|IN, 4V99|1|IS, 4V99|1|IX, 4V99|1|Ic, 4V99|1|Ih, 4V99|1|Im, 4V99|1|Ir, 4V99|1|Iw, 4V99|1|J2, 4V99|1|J7, 4V99|1|JD, 4V99|1|JI, 4V99|1|JN, 4V99|1|JS, 4V99|1|JX, 4V99|1|Jc, 4V99|1|Jh, 4V99|1|Jm, 4V99|1|Jr
9NR_4.0_56726.23
Exact match
Escherichia coli
4V4Q|1|CA (4V4Q)
  • 16S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): CA; model(s): 1
3.5 Å1530(117) 4V4Q|1|CA, 4V4H|1|CA, 4V52|1|CA, 4V52|1|AA, 4V54|1|CA, 4V4Q|1|AA, 5LZD|1|a, 4V64|1|CA, 4V6C|1|AA, 4V54|1|AA, 5J8A|1|AA, 4V64|1|AA, 5H5U|1|h, 5IT8|1|AA, 4V53|1|CA, 5J91|1|BA, 5J5B|1|BA, 5IT8|1|BA, 5J91|1|AA, 5J5B|1|AA, 4V4H|1|AA, 5J7L|1|AA, 4V53|1|AA, 4V7V|1|AA, 5J8A|1|BA, 5JC9|1|AA, 4V7S|1|AA, 4V55|1|AA, 5JC9|1|BA, 4V57|1|CA, 4V55|1|CA, 4WWW|1|QA, 5J7L|1|BA, 5MDV|1|2, 4V57|1|AA, 4V7T|1|AA, 4V6D|1|AA, 5LZA|1|a, 5J88|1|AA, 4V56|1|CA, 4V9P|1|FA, 5MDZ|1|2, 5MDW|1|2, 4YBB|1|AA, 4V9O|1|FA, 5IQR|1|2, 4U1U|1|CA, 5LZE|1|a+5LZE|1|y+5LZE|1|v+5LZE|1|x, 4V50|1|AA, 4V9O|1|BA, 5J88|1|BA, 5KPW|1|26, 5AFI|1|a, 4V6E|1|AA, 4U20|1|AA, 4V50|1|CA, 5MDY|1|2, 4V9P|1|BA, 5KPS|1|27, 4V56|1|AA, 4U1U|1|AA, 5MGP|1|a, 4V6C|1|CA, 4U26|1|AA, 4U24|1|AA, 4YBB|1|BA, 5KPX|1|26, 4U20|1|CA, 3J9Y|1|a, 4V6E|1|CA, 4V7U|1|AA, 4U27|1|AA, 4V6D|1|CA, 4WF1|1|AA, 4V9P|1|HA, 4U25|1|AA, 4V7T|1|CA, 4V9O|1|DA, 4U1V|1|CA, 4WOI|1|DA, 5U9G|1|A, 4V9P|1|DA, 4V7S|1|CA, 4WWW|1|XA, 4V9D|1|BA, 4WF1|1|CA, 4U27|1|CA, 4U1V|1|AA, 5KCR|1|1a, 5JTE|1|AA, 4V9D|1|AA, 5JU8|1|AA, 4V7V|1|CA, 5U9F|1|A, 4U25|1|CA, 4WOI|1|AA, 4V89|1|AA, 4V85|1|AA, 4U26|1|CA, 4U24|1|CA, 3J9Z|1|SA, 4V7U|1|CA, 3JCE|1|a, 3JCJ|1|g, 5KCS|1|1a, 5U4J|1|a, 5U4I|1|a, 5L3P|1|a, 3JA1|1|SA, 4V9O|1|HA, 4V9C|1|CA, 4V9C|1|AA, 3JBV|1|A, 3JCD|1|a, 3JBU|1|A, 4V5B|1|BA, 4V5B|1|DA
10NR_4.0_18586.15
Exact match
Saccharomyces cerevisiae
4U4U|1|7 (4U4U)
  • 5S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): 7; model(s): 1
3.0 Å121(72) 4U4U|1|7, 4U4N|1|7, 4U4R|1|7, 5FCJ|1|7, 4U4Q|1|7, 4U3M|1|7, 4U55|1|7, 4U6F|1|3, 5DAT|1|7, 4U51|1|7, 4U3U|1|3, 4U4R|1|3, 4U52|1|3, 4U3N|1|3, 4U3U|1|7, 4U50|1|7, 4U52|1|7, 4U4Z|1|7, 5LYB|1|7, 5APO|1|7, 4U3N|1|7, 5DGF|1|7, 4V88|1|A3, 4V88|1|A7, 5FCJ|1|3, 5I4L|1|3, 4U55|1|3, 4U4Q|1|3, 5FCI|1|3, 4U4N|1|3, 4U53|1|3, 4U3M|1|3, 4U4Z|1|3, 5LYB|1|3, 4U51|1|3, 5DAT|1|3, 4U4U|1|3, 5DGE|1|3, 5DGV|1|3, 5I4L|1|7, 5DC3|1|7, 4U4Y|1|7, 5TGA|1|7, 4U6F|1|7, 5DC3|1|3, 5TGM|1|3, 4U56|1|3, 4U4Y|1|3, 5TGA|1|3, 5DGV|1|7, 5TGM|1|7, 4U53|1|7, 5T62|1|B, 5JUP|1|D, 4U50|1|3, 4U4O|1|3, 5APN|1|7, 4U56|1|7, 5DGE|1|7, 5DGF|1|3, 5FCI|1|7, 5JUU|1|D, 5M1J|1|34, 4U4O|1|7, 5MC6|1|BR, 3JCT|1|3, 5JUT|1|D, 5H4P|1|3, 5GAK|1|3, 5JUO|1|D, 4V7R|1|D2, 4V7R|1|B2
11NR_4.0_90506.15
Exact match
Saccharomyces cerevisiae
4V88|1|A5+4V88|1|A8 (4V88)
  • 25S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): A5, A8; model(s): 1
3.0 Å3150(72) 4V88|1|A5+4V88|1|A8, 4V88|1|A1+4V88|1|A4, 4U4Q|1|5+4U4Q|1|8, 4U3U|1|1+4U3U|1|4, 4U4R|1|1+4U4R|1|4, 4U4R|1|5+4U4R|1|8, 4U52|1|5+4U52|1|8, 4U4U|1|1+4U4U|1|4, 4U4Z|1|1+4U4Z|1|4, 5LYB|1|5+5LYB|1|8, 5DGV|1|5+5DGV|1|8, 4U4Q|1|1+4U4Q|1|4, 5I4L|1|5+5I4L|1|8, 4U3U|1|5+4U3U|1|8, 4U3M|1|1+4U3M|1|4, 4U55|1|1+4U55|1|4, 4U4N|1|1+4U4N|1|4, 4U4U|1|5+4U4U|1|8, 5FCJ|1|5+5FCJ|1|8, 5DGV|1|1+5DGV|1|4, 4U52|1|1+4U52|1|4, 5DC3|1|5+5DC3|1|8, 4U4Y|1|5+4U4Y|1|8, 5FCJ|1|1+5FCJ|1|4, 4U3N|1|5+4U3N|1|8, 5DAT|1|1+5DAT|1|4, 4U4N|1|5+4U4N|1|8, 5LYB|1|1+5LYB|1|4, 4U6F|1|1+4U6F|1|4, 4U50|1|5+4U50|1|8, 4U50|1|1+4U50|1|4, 4U55|1|5+4U55|1|8, 4U3M|1|5+4U3M|1|8, 5DGE|1|5+5DGE|1|8, 5I4L|1|1+5I4L|1|4, 4U4Z|1|5+4U4Z|1|8, 4U3N|1|1+4U3N|1|4, 4U53|1|5+4U53|1|8, 5FCI|1|1+5FCI|1|4, 4U4Y|1|1+4U4Y|1|4, 5APO|1|5+5APO|1|8, 5DAT|1|5+5DAT|1|8, 5DGE|1|1+5DGE|1|4, 4U51|1|1+4U51|1|4, 5DC3|1|1+5DC3|1|4, 4U51|1|5+4U51|1|8, 4U6F|1|5+4U6F|1|8, 5TGA|1|1+5TGA|1|4, 5DGF|1|5+5DGF|1|8, 5DGF|1|1+5DGF|1|4, 4U53|1|1+4U53|1|4, 5TGA|1|5+5TGA|1|8, 4U56|1|1+4U56|1|4, 5FCI|1|5+5FCI|1|8, 4U56|1|5+4U56|1|8, 5TGM|1|1+5TGM|1|4, 5APN|1|5+5APN|1|8, 5TGM|1|5+5TGM|1|8, 5T62|1|A+5T62|1|C, 5MC6|1|BQ+5MC6|1|BS, 4U4O|1|5+4U4O|1|8, 5JUP|1|B+5JUP|1|C, 5M1J|1|14+5M1J|1|44, 4U4O|1|1+4U4O|1|4, 5H4P|1|1+5H4P|1|4, 5JUU|1|B+5JUU|1|C, 3JCT|1|1+3JCT|1|2, 5JUT|1|B+5JUT|1|C, 5GAK|1|1+5GAK|1|4, 5JUO|1|B+5JUO|1|C, 4V7R|1|B1+4V7R|1|B3, 4V7R|1|D1+4V7R|1|D3
12NR_4.0_26150.1
Exact match
Haloarcula marismortui
4V9F|1|0 (4V9F)
  • 23S Ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): 0; model(s): 1
2.4 Å2803(69) 4V9F|1|0, 1S72|1|0, 1VQO|1|0, 3CC2|1|0, 1VQK|1|0, 1VQP|1|0, 3CCU|1|0, 1JJ2|1|0, 1K73|1|A, 1VQ6|1|0, 3CPW|1|0, 1VQM|1|0, 3CC4|1|0, 3G6E|1|0, 1VQ4|1|0, 1VQ8|1|0, 1QVF|1|0, 1VQL|1|0, 1M90|1|A, 3CCM|1|0, 1VQ9|1|0, 1YHQ|1|0, 1NJI|1|A, 1VQ7|1|0, 1VQN|1|0, 1YI2|1|0, 3CC7|1|0, 1KQS|1|0, 3CXC|1|0, 1KC8|1|A, 1K9M|1|A, 1VQ5|1|0, 3OW2|1|0, 3CCL|1|0, 3CMA|1|0, 1YIT|1|0, 3CCV|1|0, 3CCQ|1|0, 1YIJ|1|0, 1YJW|1|0, 3G71|1|0, 1M1K|1|A, 1N8R|1|A, 1Q86|1|A, 1YJN|1|0, 1Q82|1|A, 1FFK|1|0, 2OTL|1|0, 3CD6|1|0, 1Q81|1|A, 1K8A|1|A, 1YJ9|1|0, 3CCE|1|0, 1KD1|1|A, 3I55|1|0, 3I56|1|0, 1Q7Y|1|A, 1QVG|1|0, 2OTJ|1|0, 3CCS|1|0, 2QEX|1|0, 3CME|1|0, 3CCR|1|0, 1W2B|1|0, 3CCJ|1|0, 2QA4|1|0, 3G4S|1|0, 1FG0|1|A, 1FFZ|1|A
13NR_4.0_25303.1
Exact match
Haloarcula marismortui
1S72|1|9 (1S72)
  • 5S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): 9; model(s): 1
2.4 Å122(67) 1S72|1|9, 3CCE|1|9, 3CCQ|1|9, 1VQ5|1|9, 1VQ4|1|9, 1M90|1|B, 1KQS|1|9, 1VQO|1|9, 1VQP|1|9, 3CPW|1|9, 3CXC|1|9, 1VQ6|1|9, 1YIJ|1|9, 1VQM|1|9, 3CCV|1|9, 1YHQ|1|9, 1Q86|1|B, 1NJI|1|B, 1YI2|1|9, 1VQK|1|9, 1VQL|1|9, 1JJ2|1|9, 3CCU|1|9, 1VQ7|1|9, 1FFK|1|9, 2QEX|1|9, 3CC4|1|9, 3CCL|1|9, 2OTJ|1|9, 3CC7|1|9, 1YIT|1|9, 1VQ8|1|9, 3CCM|1|9, 1YJW|1|9, 1VQN|1|9, 4V9F|1|9, 1QVG|1|9, 3CC2|1|9, 1VQ9|1|9, 3G6E|1|9, 1KC8|1|B, 1Q82|1|B, 1K9M|1|B, 1K73|1|B, 1K8A|1|B, 3CMA|1|9, 1QVF|1|9, 2OTL|1|9, 3OW2|1|9, 2QA4|1|9, 1N8R|1|B, 1Q7Y|1|B, 1KD1|1|B, 1W2B|1|9, 3CME|1|9, 3CCJ|1|9, 1YJN|1|9, 3CD6|1|9, 1M1K|1|B, 3CCR|1|9, 3G71|1|9, 3G4S|1|9, 1Q81|1|B, 1YJ9|1|9, 3CCS|1|9, 3I55|1|9, 3I56|1|9
14NR_4.0_03510.13
Exact match
Saccharomyces cerevisiae
4V88|1|A6 (4V88)
  • 18S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): A6; model(s): 1
3.0 Å1770(67) 4V88|1|A6, 4U4R|1|6, 4U50|1|6, 4U4Q|1|6, 4U3U|1|6, 5LYB|1|6, 4U52|1|6, 4U4U|1|6, 4V88|1|A2, 4U4R|1|2, 5FCJ|1|6, 5I4L|1|6, 4U3U|1|2, 5DC3|1|6, 5FCI|1|6, 4U3N|1|6, 4U4N|1|6, 4U55|1|6, 4U6F|1|6, 5DAT|1|6, 4U4Y|1|6, 4U53|1|6, 4U4Q|1|2, 4U4U|1|2, 4U4Z|1|6, 4U4N|1|2, 4U52|1|2, 4U3M|1|6, 4U51|1|6, 5DGV|1|6, 4U3M|1|2, 4U55|1|2, 4U51|1|2, 4U4Z|1|2, 5I4L|1|2, 5TGA|1|6, 4U3N|1|2, 5DGV|1|2, 4U50|1|2, 4U56|1|6, 5DGF|1|6, 4U4Y|1|2, 5LYB|1|2, 4U53|1|2, 4U6F|1|2, 5TGA|1|2, 5TGM|1|6, 5DGE|1|6, 5DC3|1|2, 5FCJ|1|2, 5DAT|1|2, 5TGM|1|2, 5FCI|1|2, 5DGE|1|2, 4U56|1|2, 5JUU|1|A, 5DGF|1|2, 4U4O|1|6, 5M1J|1|22, 5JUP|1|A, 5JUT|1|A, 5MC6|1|2, 5LL6|1|2, 4U4O|1|2, 5JUO|1|A, 4V7R|1|C1, 4V7R|1|A1
15NR_4.0_88987.5
Exact match
Deinococcus radiodurans
4IOA|1|X (4IOA)
  • 23S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.2 Å2686(44) 4IOA|1|X, 4IO9|1|X, 4IOC|1|X, 5DM6|1|X, 2ZJR|1|X, 3CF5|1|X, 5JVG|1|X, 5JVH|1|X, 2ZJP|1|X, 2ZJQ|1|X, 4U67|1|X, 4WFN|1|X, 3DLL|1|X, 5DM7|1|X, 2AAR|1|0, 2OGM|1|0, 3PIO|1|X, 3JQ4|1|A, 2D3O|1|0, 1Y69|1|0, 3PIP|1|X, 2OGO|1|0, 1JZY|1|A, 1K01|1|A, 1JZX|1|A, 1JZZ|1|A, 1J5A|1|A, 2O44|1|A, 2OGN|1|0, 1NWX|1|0, 1OND|1|0, 1NWY|1|0, 1NKW|1|0, 3FWO|1|A, 1NJO|1|0, 1P9X|1|0, 1NJP|1|0, 1NJM|1|0, 1NJN|1|0, 2O43|1|A, 1SM1|1|0, 1XBP|1|0, 1Z58|1|2, 2O45|1|A
16NR_4.0_21736.3
Exact match
Tobacco virtovirus 1
4OQ9|1|z (4OQ9)
  • RNA (5'-R(P*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): z; model(s): 1
1.5 Å2(37) 4OQ9|1|z, 4NIA|1|1, 4OQ9|1|1, 4NIA|1|2, 4OQ9|1|2, 4NIA|1|3, 4OQ9|1|3, 4NIA|1|4, 4OQ9|1|4, 4NIA|1|5, 4OQ9|1|5, 4NIA|1|6, 4OQ9|1|6, 4NIA|1|7, 4OQ9|1|7, 4NIA|1|8, 4OQ9|1|8, 3ER9|1|D, 4OQ8|1|D, 2VRT|1|E, 1DDL|1|E, 2VRT|1|F, 5KAL|1|Y, 5KAL|1|Z, 4NIA|1|t, 4OQ9|1|t, 4NIA|1|u, 4OQ9|1|u, 4NIA|1|v, 4OQ9|1|v, 4NIA|1|w, 4OQ9|1|w, 4NIA|1|x, 4OQ9|1|x, 4NIA|1|y, 4OQ9|1|y, 4NIA|1|z
17NR_4.0_51266.1
Exact match
1ZDK|1|S (1ZDK)
  • RNA (5'-R(P*AP*CP*AP*UP*GP*AP*GP*GP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): S; model(s): 1
2.9 Å19(36) 1ZDK|1|S, 2C4Z|1|R, 2C4Y|1|R, 2C4Q|1|R, 2BU1|1|R, 2C4Q|1|S, 2BU1|1|S, 2C4Z|1|S, 2IZ9|1|R, 2BQ5|1|S, 2BNY|1|R, 2C51|1|R, 2C4Y|1|S, 2BQ5|1|R, 1ZDI|1|R, 2IZ8|1|R, 1AQ3|1|R, 1AQ4|1|R, 2B2G|1|R, 2B2E|1|R, 1ZDH|1|R, 2IZM|1|R, 1ZDI|1|S, 1ZDH|1|S, 2IZM|1|S, 2IZ8|1|S, 2BNY|1|S, 2C50|1|S, 2C51|1|S, 2C50|1|R, 1AQ4|1|S, 2IZ9|1|S, 2B2E|1|S, 2B2G|1|S, 1ZDK|1|R, 1AQ3|1|S
18NR_4.0_20721.6
Exact match
Thermus thermophilus
4V9B|1|AC (4V9B)
  • TRNA-FMET
  • X-RAY DIFFRACTION
  • Chain(s): AC; model(s): 1
3.1 Å77(35) 4V9B|1|AC, 4V95|1|AV, 4V8X|1|CV, 4V9A|1|AC, 4V9N|1|AW, 4V9N|1|CW, 3J9Z|1|S6, 5J8B|1|x, 4V8X|1|AV, 4V7J|1|Av, 4V7J|1|Bv, 4V9B|1|CC, 4V95|1|CV, 5E81|1|2K, 5E81|1|2L, 4V7K|1|Bv, 4WT8|1|C4, 4V9A|1|CC, 4L47|1|QV, 3JA1|1|S2, 4L47|1|XV, 4V7K|1|Av, 4V8U|1|AW, 4V8U|1|CW, 4V4J|1|z, 4V9B|1|AD, 4V7K|1|Bw, 4V8X|1|CW, 4V5A|1|AW, 4V7K|1|Aw, 4V8X|1|AW, 4V7J|1|Bw, 4V7J|1|Aw, 4V5A|1|CW, 4V9B|1|CD
19NR_4.0_97151.1
Exact match
3TD1|1|B+3TD1|1|A (3TD1)
  • RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B; model(s): 1
2.1 Å22(34) 3TD1|1|B+3TD1|1|A, 3BNL|1|A+3BNL|1|B, 1MWL|1|A+1MWL|1|B, 5BWS|1|A+5BWS|1|B, 4PDQ|1|A+4PDQ|1|B, 2ESI|1|A+2ESI|1|B, 1YRJ|1|A+1YRJ|1|B, 2F4T|1|B+2F4T|1|A, 5BXK|1|C+5BXK|1|D, 5BWS|1|C+5BWS|1|D, 5BXK|1|A+5BXK|1|B, 4GPW|1|A+4GPW|1|B, 4WCP|1|A+4WCP|1|B+4WCP|1|C, 4GPY|1|A+4GPY|1|B, 4F8U|1|A+4F8U|1|B, 2BEE|1|A+2BEE|1|B, 4F8V|1|A+4F8V|1|B, 2ET4|1|A+2ET4|1|B, 2BE0|1|A+2BE0|1|B, 1LC4|1|A+1LC4|1|B, 4P20|1|A+4P20|1|B, 4GPX|1|A+4GPX|1|B, 3S4P|1|A+3S4P|1|B, 2ET5|1|A+2ET5|1|B, 4WCS|1|A+4WCS|1|B, 2PWT|1|A+2PWT|1|B, 4WCR|1|A+4WCR|1|B, 2ESJ|1|A+2ESJ|1|B, 3WRU|1|A+3WRU|1|B, 4K32|1|A+4K32|1|B, 2ET3|1|A+2ET3|1|B, 4WCQ|1|A+4WCQ|1|B, 1J7T|1|A+1J7T|1|B, 4P3S|1|B+4P3S|1|A
20NR_4.0_24132.2
Exact match
Tobacco virtovirus 1
4OQ9|1|d (4OQ9)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): d; model(s): 1
1.5 Å10(32) 4OQ9|1|d, 1A34|1|B+1A34|1|C, 4OQ8|1|B+4OQ8|1|C, 4OQ9|1|P+4OQ9|1|e, 4NIA|1|P+4NIA|1|e, 4NIA|1|Q, 4OQ9|1|Q, 4NIA|1|R+4NIA|1|g, 4OQ9|1|R+4OQ9|1|g, 4NIA|1|S+4NIA|1|h, 4OQ9|1|S+4OQ9|1|h, 4OQ9|1|T+4OQ9|1|i, 4NIA|1|T+4NIA|1|i, 4NIA|1|U, 4OQ9|1|U, 4NIA|1|V, 4OQ9|1|V, 4NIA|1|W, 4OQ9|1|W, 4OQ9|1|X+4OQ9|1|m, 4NIA|1|X+4NIA|1|m, 4NIA|1|Y+4NIA|1|n, 4OQ9|1|Y+4OQ9|1|n, 4OQ9|1|Z, 4NIA|1|Z, 4OQ9|1|a, 4NIA|1|a, 4OQ9|1|b, 4NIA|1|b, 4OQ9|1|c, 4NIA|1|c, 4NIA|1|d
21NR_4.0_89292.1
Exact match
4V8E|1|BB (4V8E)
  • TRNA-TYR
  • X-RAY DIFFRACTION
  • Chain(s): BB; model(s): 1
3.3 Å84(32) 4V8E|1|BB, 4V8D|1|AD, 4V8E|1|BD, 4V8E|1|DD, 4WQ1|1|3L, 4V8D|1|AB, 4V8E|1|DB, 4V8D|1|CD, 4WU1|1|3K, 4WQ1|1|3K, 4WR6|1|3K, 4WZD|1|3K, 4WZD|1|3L, 4V8F|1|BD, 4V8F|1|CD, 4WZD|1|2K, 4WU1|1|2K, 4WRA|1|3K, 4WU1|1|2L, 4V8F|1|BB, 4V8F|1|CB, 4V8D|1|CB, 4WQ1|1|1K, 4WRA|1|1K, 4WU1|1|3L, 4WZD|1|2L, 4WQ1|1|1L, 4WR6|1|1K, 4WRA|1|3L, 4WR6|1|1L, 4WR6|1|3L, 4WRA|1|1L
22NR_4.0_89429.2
Exact match
4FE5|1|B (4FE5)
  • xpt-pbuX guanine riboswitch aptamer doma[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.3 Å67(29) 4FE5|1|B, 3FO4|1|A, 3GOG|1|A, 2XNZ|1|A, 2EEV|1|A, 2G9C|1|A, 3FO6|1|A, 3GAO|1|A, 3GER|1|A, 2EET|1|A, 4FEN|1|B, 4FEO|1|B, 4FEP|1|B, 2EEW|1|A, 2EES|1|A, 2EEU|1|A, 3GES|1|A, 3DS7|1|A, 4FEJ|1|B, 5C7U|1|B, 3DS7|1|B, 4FEL|1|B, 2XO0|1|A, 2XNW|1|A, 2XO1|1|A, 3GOT|1|A, 3G4M|1|A, 2B57|1|A, 5C7W|1|C
23NR_4.0_35054.3
Exact match
Oceanobacillus iheyensis
5J01|1|A (5J01)
  • group II intron lariat
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.4 Å414(26) 5J01|1|A, 4FAW|1|A, 4FAU|1|A, 4Y1O|1|A, 5J02|1|A, 4Y1N|1|A, 3G78|1|A, 3IGI|1|A, 4Y1N|1|B, 4E8Q|1|A, 4E8N|1|A, 4E8K|1|A, 4FAR|1|A, 4Y1O|1|B, 4E8T|1|A, 4FB0|1|A, 4E8P|1|A, 4FAQ|1|A, 3BWP|1|A, 4E8R|1|A, 4DS6|1|A, 4E8M|1|A, 3EOH|1|A, 4FAX|1|A, 3EOG|1|A, 4E8V|1|A
24NR_4.0_98705.1
Exact match
2P7E|1|D+2P7E|1|C+2P7E|1|P (2P7E)
  • Ribozyme strand III
  • X-RAY DIFFRACTION
  • Chain(s): C, D, P; model(s): 1
2.1 Å19(25) 2P7E|1|D+2P7E|1|C+2P7E|1|P, 2D2K|1|D+2D2K|1|C+2D2K|1|A+2D2K|1|B, 3I2R|1|C, 3I2U|1|C, 3I2Q|1|C, 3CQS|1|C, 3CR1|1|C, 3I2S|1|C, 3GS8|1|D+3GS8|1|C+3GS8|1|A+3GS8|1|B, 1ZFV|1|D+1ZFV|1|C+1ZFV|1|A+1ZFV|1|B, 4G6R|1|D+4G6R|1|C+4G6R|1|A+4G6R|1|B, 2P7D|1|D+2P7D|1|C+2P7D|1|P, 1X9K|1|D+1X9K|1|C+1X9K|1|A+1X9K|1|B, 2NPZ|1|D+2NPZ|1|C+2NPZ|1|A+2NPZ|1|B, 1X9C|1|D+1X9C|1|C+1X9C|1|A+1X9C|1|B, 3GS1|1|D+3GS1|1|C+3GS1|1|A+3GS1|1|B, 2BCZ|1|D+2BCZ|1|C+2BCZ|1|A+2BCZ|1|B, 2NPY|1|D+2NPY|1|C+2NPY|1|A+2NPY|1|B, 2OUE|1|D+2OUE|1|C+2OUE|1|A+2OUE|1|B, 2BCY|1|D+2BCY|1|C+2BCY|1|A+2BCY|1|B, 1ZFT|1|D+1ZFT|1|C+1ZFT|1|A+1ZFT|1|B, 2FGP|1|D+2FGP|1|C+2FGP|1|A+2FGP|1|B, 1ZFX|1|D+1ZFX|1|C+1ZFX|1|A+1ZFX|1|B, 2P7F|1|D+2P7F|1|C+2P7F|1|A+2P7F|1|B, 2D2L|1|D+2D2L|1|C+2D2L|1|A+2D2L|1|B
25NR_4.0_08692.1
Exact match
2NZ4|1|Q (2NZ4)
  • GlmS ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
2.5 Å140(24) 2NZ4|1|Q, 3G9C|1|S, 3G96|1|Q, 2NZ4|1|R, 3L3C|1|R, 3L3C|1|Q, 3G96|1|R, 3G8T|1|P, 3G8S|1|R, 2NZ4|1|P, 3G8T|1|R, 3G9C|1|Q, 3G96|1|S, 3G96|1|P, 3G8T|1|Q, 3L3C|1|P, 3G8S|1|Q, 2NZ4|1|S, 3G9C|1|P, 3G8T|1|S, 3L3C|1|S, 3G8S|1|P, 3G9C|1|R, 3G8S|1|S
26NR_4.0_17405.5
Exact match
Deinococcus radiodurans
5DM6|1|Y (5DM6)
  • 5S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.9 Å122(24) 5DM6|1|Y, 4IOA|1|Y, 4IO9|1|Y, 2ZJR|1|Y, 2ZJP|1|Z, 2ZJQ|1|Y, 3CF5|1|Z, 3DLL|1|Z, 4IOC|1|Y, 5DM7|1|Y, 3FWO|1|B, 1Y69|1|9, 3JQ4|1|B, 5JVG|1|Y, 5JVH|1|Y, 1XBP|1|9, 4U67|1|Y, 3PIP|1|Y, 1SM1|1|9, 1NWX|1|9, 1NKW|1|9, 1NWY|1|9, 3PIO|1|Y, 4WFN|1|Y
27NR_4.0_31819.1
Exact match
Escherichia coli
1QRS|1|B (1QRS)
  • TRNAGLN2
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å74(22) 1QRS|1|B, 1O0C|1|B, 1QTQ|1|B, 1QRT|1|B, 1GTR|1|B, 1GTS|1|B, 1QRU|1|B, 1O0B|1|B, 1EUY|1|B, 4JXX|1|B, 1EXD|1|B, 2RE8|1|B, 2RD2|1|B, 1ZJW|1|B, 4V7L|1|AW, 1EUQ|1|B, 4V7M|1|AW, 4V7M|1|CW, 4V7L|1|CW, 4V7L|1|CY, 4V7L|1|AY, 1GSG|1|T
28NR_4.0_66387.1
Exact match
3OK4|1|Z (3OK4)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
1.2 Å10(22) 3OK4|1|Z, 3OK4|1|2, 3OK4|1|4, 3OK4|1|B, 3OK2|1|B, 3OK4|1|D, 3OK2|1|D, 2BJ6|1|E, 3OK4|1|F, 3OK2|1|F, 2BJ6|1|F, 2BJ6|1|G, 3OK4|1|H, 2BJ6|1|H, 3OK4|1|J, 3OK4|1|L, 3OK4|1|N, 3OK4|1|P, 3OK4|1|R, 3OK4|1|T, 3OK4|1|V, 3OK4|1|X
29NR_4.0_89906.2
Exact match
Thermotoga maritima
3WFS|1|A (3WFS)
  • RNA (74-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.3 Å74(22) 3WFS|1|A, 3WFS|1|B, 5HC9|1|D, 5HC9|1|C, 3WFR|1|C, 3WFR|1|D, 3WFQ|1|D, 3WFR|1|B, 3WFQ|1|C, 4WC5|1|B, 3WFR|1|A, 4WC6|1|B, 4WC2|1|B, 3WFQ|1|A, 3WFQ|1|B, 4WC4|1|B, 4WC7|1|B, 4WC3|1|B, 4X0A|1|B, 4X0B|1|B, 1VFG|1|C, 1VFG|1|D
30NR_4.0_29423.1
Exact match
4V4F|1|BZ (4V4F)
  • 5'-R(*UP*AP*GP*AP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): BZ; model(s): 1
1.9 Å3(22) 4V4F|1|BZ, 4V4F|1|A3, 4V4F|1|A5, 4V4F|1|B0, 4V4F|1|B6, 4V4F|1|A0, 4V4F|1|A1, 4V4F|1|A2, 4V4F|1|A4, 4V4F|1|A7, 4V4F|1|A8, 4V4F|1|A9, 4V4F|1|AZ, 4V4F|1|B1, 4V4F|1|B4, 4V4F|1|B5, 4V4F|1|B7, 4V4F|1|B8, 4V4F|1|B9, 4V4F|1|A6, 4V4F|1|B2, 4V4F|1|B3
31NR_4.0_94729.1
Exact match
1JBR|1|D (1JBR)
  • 31-mer SRD RNA analog
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.2 Å31(21) 1JBR|1|D, 1JBT|1|C, 1JBT|1|D, 480D|1|A, 4Y27|1|A, 4NLF|1|A, 1JBS|1|C, 1JBS|1|D, 3DW4|1|A, 1MSY|1|A, 3DW6|1|A, 5D99|1|A, 3DVZ|1|A, 3S7C|1|A, 4NXH|1|A, 3S8U|1|A, 1Q9A|1|A, 483D|1|A, 3DW5|1|A, 4NMG|1|A, 3DW7|1|A
32NR_4.0_73187.1
Exact match
Escherichia coli
2WJ8|1|t (2WJ8)
  • RNA (5'-R(*CP*CP*CP*CP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): t; model(s): 1
3.3 Å7(20) 2WJ8|1|t, 2WJ8|1|a, 2WJ8|1|b, 2WJ8|1|c, 2WJ8|1|d, 2WJ8|1|e, 2WJ8|1|f, 2WJ8|1|g, 2WJ8|1|h, 2WJ8|1|i, 2WJ8|1|j, 2WJ8|1|k, 2WJ8|1|l, 2WJ8|1|m, 2WJ8|1|n, 2WJ8|1|o, 2WJ8|1|p, 2WJ8|1|q, 2WJ8|1|r, 2WJ8|1|s
33NR_4.0_60167.2
Exact match
3C3Z|1|A+3C3Z|1|B (3C3Z)
  • HIV-1 subtype F genomic RNA
  • X-RAY DIFFRACTION
  • Chain(s): A, B, P; model(s): 1
1.5 Å22(20) 3C3Z|1|A+3C3Z|1|B, 1Y99|1|A+1Y99|1|B, 1O3Z|1|B+1O3Z|1|A, 1Y73|1|B+1Y73|1|A, 1Y95|1|B+1Y95|1|A, 1Y6T|1|B+1Y6T|1|A, 1NLC|1|B+1NLC|1|A, 1WVD|1|B+1WVD|1|A, 1Y6S|1|B+1Y6S|1|A, 462D|1|B+462D|1|A, 1Y90|1|B+1Y90|1|A, 2OIJ|1|A+2OIJ|1|B, 2QEK|1|A+2QEK|1|B, 3FAR|1|A+3FAR|1|B, 2OJ0|1|A+2OJ0|1|B, 2OIY|1|A+2OIY|1|B, 3C44|1|A+3C44|1|B, 3DVV|1|A+3DVV|1|B, 3C7R|1|A+3C7R|1|B, 3C5D|1|A+3C5D|1|B
34NR_4.0_74924.4
Exact match
3PEY|1|B (3PEY)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.4 Å6(20) 3PEY|1|B, 3PF5|1|R, 5ELX|1|B, 3PEW|1|B, 4ALP|1|E, 2HYI|1|F, 3EX7|1|F, 3EX7|1|J, 2HYI|1|L, 4Y91|1|N, 4Y91|1|O, 4NL3|1|R, 4NL3|1|Z, 3O8R|1|C, 3O8C|1|C, 5BTE|1|C, 5BTE|1|D, 1N34|1|Z, 5SZE|1|C, 3PF5|1|S
35NR_4.0_09128.1
Exact match
1XPU|1|M (1XPU)
  • 5'-R(*CP*UP*CP*UP*CP*UP*CP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
3.1 Å2(18) 1XPU|1|M, 1XPR|1|G, 1XPU|1|G, 1XPO|1|G, 1XPR|1|H, 1XPU|1|H, 1XPO|1|H, 1XPR|1|J, 1XPU|1|J, 1XPO|1|J, 1XPR|1|K, 1XPU|1|K, 1XPO|1|K, 1XPR|1|L, 1XPU|1|L, 1XPO|1|L, 1XPR|1|M, 1XPO|1|M
36NR_4.0_66108.1
Exact match
2DR8|1|B (2DR8)
  • tRNA (33-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å33(18) 2DR8|1|B, 2ZHA|1|B, 2DR7|1|B, 2ZH1|1|B, 2ZH9|1|B, 2ZH7|1|B, 2ZH5|1|B, 2ZH8|1|B, 2ZH4|1|B, 2ZHB|1|B, 2DR9|1|B, 2ZH6|1|B, 2DVI|1|B, 2ZH3|1|B, 2ZH2|1|B, 2DRA|1|B, 2DRB|1|B, 2DR5|1|B
37NR_4.0_32185.1
Exact match
3OX0|1|A (3OX0)
  • Domain II of glycine riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å86(18) 3OX0|1|A, 3OWZ|1|B, 3OXJ|1|A, 3OXE|1|A, 3OWZ|1|A, 3OWW|1|A, 3OXM|1|A, 3OWW|1|B, 3OWI|1|B, 3OXE|1|B, 3OXM|1|B, 3OX0|1|B, 3OXJ|1|B, 3OWI|1|A, 3OXB|1|A, 3OXD|1|A, 3OXD|1|B, 3OXB|1|B
38NR_4.0_51111.1
Exact match
Tobacco virtovirus 1
4OQ9|1|s (4OQ9)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): s; model(s): 1
1.5 Å10(18) 4OQ9|1|s, 4OQ9|1|f, 4NIA|1|f, 4OQ9|1|j, 4NIA|1|j, 4OQ9|1|k, 4NIA|1|k, 4OQ9|1|l, 4NIA|1|l, 4OQ9|1|o, 4NIA|1|o, 4NIA|1|p, 4OQ9|1|p, 4OQ9|1|q, 4NIA|1|q, 4OQ9|1|r, 4NIA|1|r, 4NIA|1|s
39NR_4.0_51503.1
Exact match
Homo sapiens
4X4O|1|D (4X4O)
  • G70A tRNA minihelix
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.2 Å34(18) 4X4O|1|D, 4X4T|1|D, 4X4O|1|B, 4X4S|1|B, 4X4R|1|B, 4X4Q|1|B, 4X4T|1|B, 4X4N|1|D, 4X4N|1|B, 4X4P|1|D, 4X4Q|1|D, 4X4P|1|H, 4X4P|1|B, 4X4S|1|D, 4X4R|1|D, 4X4P|1|F, 4X4T|1|G, 4X4N|1|G
40NR_4.0_67726.2
Exact match
synthetic construct
5F9F|1|L (5F9F)
  • RNA (5'-R(*GP*AP*AP*UP*AP*UP*AP*AP*UP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
2.6 Å24(18) 5F9F|1|L, 5F98|1|B, 5F9F|1|B, 5F98|1|D, 5F9F|1|D, 5F98|1|F, 5F9F|1|F, 5F9F|1|H, 5F98|1|H, 5F98|1|J, 5F9F|1|J, 5F98|1|L, 5F9H|1|B, 5F9H|1|D, 5F9H|1|F, 5F9H|1|H, 5F9H|1|J, 5F9H|1|L
41NR_4.0_55511.1
Exact match
1N7A|1|H (1N7A)
  • RNA/DNA (5'-R(*U)-D(P*(BGM))-R(P*AP*GP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
1.2 Å5(17) 1N7A|1|H, 1N7B|1|A, 1MDG|1|A, 1N7A|1|A, 1N7B|1|B, 1N7A|1|B, 1N7B|1|C, 1N7A|1|C, 1N7B|1|D, 1N7A|1|D, 1N7B|1|E, 1N7A|1|E, 1N7A|1|F, 1N7B|1|F, 1N7B|1|G, 1N7A|1|G, 1N7B|1|H
42NR_4.0_78706.1
Exact match
1XPE|1|A+1XPE|1|B (1XPE)
  • 5'-R(*CP*UP*UP*GP*CP*UP*GP*AP*AP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, P; model(s): 1
1.9 Å23(17) 1XPE|1|A+1XPE|1|B, 2B8S|1|A+2B8S|1|B, 1XP7|1|A+1XP7|1|B, 2B8R|1|A+2B8R|1|B, 1XPF|1|A+1XPF|1|B, 2FCY|1|A+2FCY|1|B, 2FCX|1|A+2FCX|1|B, 1ZCI|1|A+1ZCI|1|B, 2FD0|1|A+2FD0|1|B, 1Y3S|1|A+1Y3S|1|B, 1Y3O|1|A+1Y3O|1|B, 2FCZ|1|A+2FCZ|1|B, 1YXP|1|A+1YXP|1|B, 1ZCI|1|C+1ZCI|1|D, 2FCZ|1|C+2FCZ|1|D, 1K9W|1|B, 1K9W|1|D
43NR_4.0_76703.3
Exact match
Escherichia coli
5E7K|1|1K (5E7K)
  • tRNALys
  • X-RAY DIFFRACTION
  • Chain(s): 1K; model(s): 1
3.2 Å66(16) 5E7K|1|1K, 5JTE|1|AW, 5IB7|1|1L, 5IB7|1|1K, 5E81|1|1K, 5IB8|1|1K, 5EL6|1|1L, 5E7K|1|1L, 5EL7|1|1L, 5EL4|1|1K, 5EL7|1|1K, 5E81|1|1L, 5EL4|1|1L, 5EL6|1|1K, 5EL5|1|1L, 5EL5|1|1K
44NR_4.0_35133.1
Exact match
2GCS|1|B (2GCS)
  • glmS ribozyme RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.1 Å122(15) 2GCS|1|B, 2HO7|1|B, 2H0X|1|B, 2Z75|1|B, 2HO6|1|B, 3B4B|1|B, 2GCV|1|B, 2H0W|1|B, 2H0S|1|B, 2Z74|1|B, 3B4A|1|B, 4MEG|1|B, 2H0Z|1|B, 3B4C|1|B, 4MEH|1|B
45NR_4.0_31074.1
Exact match
1J8G|1|D (1J8G)
  • 5'-R(*UP*GP*GP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
0.6 Å6(14) 1J8G|1|D, 4RKV|1|A, 4RNE|1|A, 4RNE|1|F, 1J8G|1|A, 4RJ1|1|A, 4RNE|1|B, 1J8G|1|C, 4XK0|1|C, 4RNE|1|C, 4RNE|1|D, 4RNE|1|E, 4RNE|1|G, 4RNE|1|H
46NR_4.0_29085.1
Exact match
2CV1|1|D (2CV1)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å75(14) 2CV1|1|D, 2CV2|1|C, 1N77|1|C, 2CV1|1|C, 2CV0|1|C, 2DXI|1|C, 1N78|1|C, 1G59|1|D, 2DXI|1|D, 1G59|1|B, 1N77|1|D, 1N78|1|D, 2CV2|1|D, 2CV0|1|D
47NR_4.0_42241.1
Exact match
2GDI|1|Y (2GDI)
  • TPP riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.1 Å78(14) 2GDI|1|Y, 4NYA|1|A, 2GDI|1|X, 2HOJ|1|A, 4NYB|1|A, 2HOK|1|A, 4NYD|1|A, 2HOL|1|A, 4NYC|1|A, 2HOM|1|A, 2HOO|1|A, 4NYA|1|B, 4NYG|1|A, 2HOP|1|A
48NR_4.0_27023.1
Exact match
Escherichia coli
2PXV|1|B (2PXV)
  • 4.5 S RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å49(14) 2PXV|1|B, 2PXT|1|B, 2PXQ|1|B, 2PXP|1|B, 2PXB|1|B, 2PXE|1|B, 2PXD|1|B, 2PXK|1|B, 1HQ1|1|B, 3LQX|1|B, 1DUL|1|B, 2PXU|1|B, 2PXF|1|B, 2PXL|1|B
49NR_4.0_10255.1
Exact match
Oryctolagus cuniculus
3J92|1|7 (3J92)
  • 5S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 7; model(s): 1
3.6 Å120(14) 3J92|1|7, 3JAG|1|7, 3JAH|1|7, 5LZZ|1|7, 3JAI|1|7, 5LZS|1|7, 5LZY|1|7, 5LZW|1|7, 5LZT|1|7, 5LZX|1|7, 5LZU|1|7, 5LZV|1|7, 3JAN|1|7, 3JAJ|1|7
50NR_4.0_09880.2
Exact match
3ULD|1|B (3ULD)
  • RNA (5'-R(*UP*CP*GP*AP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.6 Å6(14) 3ULD|1|B, 2G8K|1|B, 2G8I|1|B, 5USE|1|B, 2G8F|1|B, 5USA|1|B, 2G8U|1|B, 2R7Y|1|B, 5USG|1|B, 5US2|1|B, 2G8H|1|B, 3TWH|1|B, 2G8V|1|B, 2G8W|1|B
51NR_4.0_47763.1
Exact match
4MSR|1|A+4MSR|1|B (4MSR)
  • RNA 10mer duplex with six 2'-5'-linkages
  • X-RAY DIFFRACTION
  • Chain(s): A, B, P; model(s): 1
1.2 Å12(14) 4MSR|1|A+4MSR|1|B, 4MS9|1|A, 4MSB|1|A+4MSB|1|B, 5TDJ|1|A, 5TDK|1|A+5TDK|1|B, 5TDJ|1|B, 4MSB|1|C+4MSB|1|D, 4MSB|1|E+4MSB|1|F, 394D|1|A+394D|1|B, 100D|1|A+100D|1|B, 161D|1|A, 393D|1|A, 161D|1|B, 393D|1|B
52NR_4.0_07733.2
Exact match
Escherichia coli
5EL4|1|3L (5EL4)
  • tRNA-Lys
  • X-RAY DIFFRACTION
  • Chain(s): 3L; model(s): 1
3.2 Å73(14) 5EL4|1|3L, 5E7K|1|3L, 5IB8|1|3L, 5EL6|1|3L, 5IB7|1|3L, 5E7K|1|3K, 5EL6|1|3K, 5EL5|1|3K, 5IB7|1|3K, 5IB8|1|3K, 5EL5|1|3L, 5EL7|1|3K, 5EL4|1|3K, 5EL7|1|3L
53NR_4.0_96683.1
Exact match
Homo sapiens
5GMF|1|H (5GMF)
  • RNA (5'-R(P*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.5 Å4(14) 5GMF|1|H, 5GMG|1|C, 5GMG|1|D, 3IE1|1|E, 1NB7|1|E, 5GMF|1|E, 3IE1|1|F, 1NB7|1|F, 5GMF|1|F, 5GMF|1|G, 3IE1|1|H, 2QQP|1|R, 4DR7|1|V, 3IE1|1|G
54NR_4.0_06650.1
Exact match
Oryctolagus cuniculus
5LZS|1|5+5LZS|1|8 (5LZS)
  • 28S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 5, 8, P; model(s): 1
3.3 Å3543(14) 5LZS|1|5+5LZS|1|8, 5LZZ|1|5+5LZZ|1|8, 5LZX|1|5+5LZX|1|8, 5LZU|1|5+5LZU|1|8, 5LZW|1|5+5LZW|1|8, 5LZT|1|5+5LZT|1|8, 5LZY|1|5+5LZY|1|8, 5LZV|1|5+5LZV|1|8, 3J92|1|5+3J92|1|8, 3JAI|1|5+3JAI|1|8, 3JAG|1|5+3JAG|1|8, 3JAH|1|5+3JAH|1|8, 3JAJ|1|5+3JAJ|1|8, 3JAN|1|5+3JAN|1|8
55NR_4.0_21280.1
Exact match
Oryctolagus cuniculus
5LZT|1|9 (5LZT)
  • 18S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 9; model(s): 1
3.7 Å1698(14) 5LZT|1|9, 5LZV|1|9, 5LZX|1|9, 5LZU|1|9, 5LZY|1|9, 5LZZ|1|9, 5LZW|1|9, 5LZS|1|9, 3JAG|1|9, 3JAH|1|9, 3JAI|1|9, 5FLX|1|1, 3JAN|1|S2, 3JAJ|1|S2
56NR_4.0_73165.1
Exact match
1VBY|1|B (1VBY)
  • Hepatitis Delta virus ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å73(13) 1VBY|1|B, 1VC5|1|B, 4PRF|1|B, 2OIH|1|B, 1VC0|1|B, 1VBZ|1|B, 1VBX|1|B, 1SJ4|1|R, 1SJ3|1|R, 1SJF|1|B, 1DRZ|1|B, 1VC6|1|B, 2OJ3|1|B
57NR_4.0_52453.1
Exact match
3OL9|1|J+3OL9|1|N+3OL9|1|K+3OL9|1|O+3OL9|1|L+3OL9|1|P (3OL9)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): J, K, L, N, O, P; model(s): 1
2.3 Å19(13) 3OL9|1|J+3OL9|1|N+3OL9|1|K+3OL9|1|O+3OL9|1|L+3OL9|1|P, 3OL6|1|J+3OL6|1|N+3OL6|1|K+3OL6|1|O+3OL6|1|L+3OL6|1|P, 3OLB|1|J+3OLB|1|N+3OLB|1|K+3OLB|1|O+3OLB|1|L+3OLB|1|P, 3OLB|1|B+3OLB|1|F+3OLB|1|C+3OLB|1|G+3OLB|1|D+3OLB|1|H, 3OL7|1|B+3OL7|1|F+3OL7|1|C+3OL7|1|G+3OL7|1|D+3OL7|1|H, 3OL9|1|B+3OL9|1|F+3OL9|1|C+3OL9|1|G+3OL9|1|D+3OL9|1|H, 3OL6|1|B+3OL6|1|F+3OL6|1|C+3OL6|1|G+3OL6|1|D+3OL6|1|H, 3OLA|1|J+3OLA|1|N+3OLA|1|K+3OLA|1|O+3OLA|1|L+3OLA|1|P, 3OL8|1|B+3OL8|1|F+3OL8|1|C+3OL8|1|G+3OL8|1|D+3OL8|1|H, 3OLA|1|B+3OLA|1|D, 3OLA|1|F+3OLA|1|H, 3OL8|1|J+3OL8|1|N+3OL8|1|K+3OL8|1|O+3OL8|1|L+3OL8|1|P, 3OL7|1|J+3OL7|1|N+3OL7|1|K+3OL7|1|O+3OL7|1|L+3OL7|1|P
58NR_4.0_02615.1
Exact match
Escherichia coli
4AQ7|1|B (4AQ7)
  • E. COLI TRNALEU UAA ISOACCEPTOR
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å79(13) 4AQ7|1|B, 3ZGZ|1|E, 4AQ7|1|E, 4ARI|1|B, 4CQN|1|B, 3ZGZ|1|B, 3ZJV|1|B, 3ZJU|1|B, 4AS1|1|B, 4ARC|1|B, 4CQN|1|E, 3ZJT|1|B, 2NQP|1|F
59NR_4.0_31222.1
Exact match
Caldanaerobacter subterraneus
5FJC|1|A (5FJC)
  • SAM-I RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.7 Å96(13) 5FJC|1|A, 5FK4|1|A, 5FKE|1|A, 4B5R|1|A, 5FK2|1|A, 5FK3|1|A, 5FK1|1|A, 5FK5|1|A, 5FKF|1|A, 5FKD|1|A, 5FKG|1|A, 5FKH|1|A, 5FK6|1|A
60NR_4.0_19539.1
Exact match
synthetic construct
5HNJ|1|E+5HNJ|1|F (5HNJ)
  • RNA (5'-R(*GP*UP*AP*(OFC)P*GP*UP*AP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): E, F, K, L, O, P; model(s): 1
1.2 Å7(13) 5HNJ|1|E+5HNJ|1|F, 5HN2|1|B+5HN2|1|A, 5HNJ|1|A+5HNJ|1|B, 5HNQ|1|A+5HNQ|1|B, 5HNQ|1|C+5HNQ|1|D, 5HNJ|1|C+5HNJ|1|D, 5HN2|1|C+5HN2|1|D, 5HNQ|1|E+5HNQ|1|F, 5HN2|1|E+5HN2|1|F, 5HNQ|1|G+5HNQ|1|H, 5HNQ|1|I+5HNQ|1|J, 5HNQ|1|K+5HNQ|1|L, 5HNQ|1|M
61NR_4.0_29848.1
Exact match
3DIR|1|A (3DIR)
  • RNA (174-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å172(12) 3DIR|1|A, 3DJ0|1|A, 3DIL|1|A, 3DIQ|1|A, 3DJ2|1|A, 3DIX|1|A, 3DIS|1|A, 3DIM|1|A, 3DIG|1|X, 3DIY|1|A, 3DIZ|1|A, 3DIO|1|X
62NR_4.0_68467.1
Exact match
Oryctolagus cuniculus
3JAH|1|2 (3JAH)
  • tRNA(Val)
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
3.5 Å76(12) 3JAH|1|2, 3JAI|1|2, 3JAG|1|2, 5LZW|1|2, 5LZZ|1|2, 5LZT|1|2, 5LZX|1|2, 5LZS|1|2, 5LZV|1|2, 5LZU|1|2, 3JAJ|1|3, 3JAN|1|3
63NR_4.0_36481.1
Exact match
synthetic construct
4CSF|1|w (4CSF)
  • RNA (5'-R(*UP*GP*UP*GP*UP*UP*UP*CP*UP)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): w; model(s): 1
2.6 Å9(12) 4CSF|1|w, 4CSF|1|a, 4CSF|1|c, 4CSF|1|g, 4CSF|1|i, 4CSF|1|k, 4CSF|1|m, 4CSF|1|q, 4CSF|1|s, 4CSF|1|u, 4CSF|1|e, 4CSF|1|o
64NR_4.0_88517.2
Exact match
4JNG|1|L (4JNG)
  • RNA (42-MER)
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
2.1 Å42(12) 4JNG|1|L, 4J1G|1|E, 3PU4|1|R, 2GIC|1|R, 3HHZ|1|R, 5UK4|1|u, 5UK4|1|v, 5UK4|1|w, 5UK4|1|x, 3ZLA|1|I, 3ZLA|1|J, 4BHH|1|R
65NR_4.0_72500.1
Exact match
Homo sapiens
4WZJ|1|YYYY (4WZJ)
  • U4 small nuclear RNA variant: Native seq[...]
  • X-RAY DIFFRACTION
  • Chain(s): YYYY; model(s): 1
3.6 Å68(12) 4WZJ|1|YYYY, 4WZJ|1|V, 4WZJ|1|VV, 4WZJ|1|VVV, 4WZJ|1|VVVV, 4WZJ|1|X, 4WZJ|1|XX, 4WZJ|1|XXX, 4WZJ|1|XXXX, 4WZJ|1|Y, 4WZJ|1|YY, 4WZJ|1|YYY
66NR_4.0_30153.3
Exact match
Saccharomyces cerevisiae
5AXM|1|P (5AXM)
  • RNA (75-MER)
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.2 Å72(12) 5AXM|1|P, 1I9V|1|A, 1EHZ|1|A, 4TRA|1|A, 1TRA|1|A, 6TNA|1|A, 5AXN|1|P, 1OB2|1|B, 1TN1|1|A, 4TNA|1|A, 1TN2|1|A, 5M1J|1|A3
67NR_4.0_36843.1
Exact match
Oryctolagus cuniculus
5LZY|1|2 (5LZY)
  • tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
4.0 Å75(12) 5LZY|1|2, 5LZU|1|3, 5LZS|1|3, 5LZW|1|3, 5LZV|1|3, 5LZZ|1|3, 5LZY|1|3, 5LZT|1|3, 5LZX|1|3, 3JAI|1|3, 3JAH|1|3, 3JAG|1|3
68NR_4.0_62528.1
Exact match
1GTF|1|W (1GTF)
  • (GAGUU)10GAG 53-NUCLEOTIDE RNA
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
1.8 Å44(11) 1GTF|1|W, 5EEY|1|W, 5EF2|1|W, 5EF3|1|W, 5EEZ|1|W, 5EEW|1|W, 5EEV|1|W, 5EF1|1|W, 5EEU|1|W, 5EF0|1|W, 5EEX|1|W
69NR_4.0_39627.1
Exact match
1X8W|1|A (1X8W)
  • Tetrahymena ribozyme RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.8 Å242(11) 1X8W|1|A, 1GID|1|B, 1HR2|1|B, 1GID|1|A, 2R8S|1|R, 1HR2|1|A, 1L8V|1|A, 1L8V|1|B, 1X8W|1|B, 1X8W|1|D, 1X8W|1|C
70NR_4.0_82809.2
Exact match
3GX5|1|A (3GX5)
  • RNA (94-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.4 Å94(11) 3GX5|1|A, 2GIS|1|A, 2YGH|1|A, 3GX6|1|A, 3IQR|1|A, 3IQP|1|A, 3GX2|1|A, 3IQN|1|A, 2YDH|1|A, 3GX7|1|A, 3GX3|1|A
71NR_4.0_12260.3
Exact match
3UCZ|1|R (3UCZ)
  • RNA (92-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.8 Å91(11) 3UCZ|1|R, 3UD3|1|R, 3UCU|1|R, 3MXH|1|R, 3MUR|1|R, 3MUV|1|R, 4YB1|1|R, 3UD4|1|R, 3MUM|1|R, 3IRW|1|R, 3MUT|1|R
72NR_4.0_54592.1
Exact match
466D|1|C+466D|1|D (466D)
  • RNA (5'-R(*UP*AP*GP*CP*UP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C, D, K, L, O, P; model(s): 1
1.2 Å7(11) 466D|1|C+466D|1|D, 4U38|1|A+4U38|1|B, 466D|1|A+466D|1|B, 4U37|1|A+4U37|1|B, 464D|1|A+464D|1|B, 434D|1|A+434D|1|B, 4U38|1|C+4U38|1|D, 434D|1|C+434D|1|D, 464D|1|C+464D|1|D, 4U38|1|E+4U38|1|F, 4U38|1|G+4U38|1|H
73NR_4.0_40540.1
Exact match
4V8C|1|CB (4V8C)
  • TRNA-LEU
  • X-RAY DIFFRACTION
  • Chain(s): CB; model(s): 1
3.3 Å87(11) 4V8C|1|CB, 5KCR|1|1x, 4V8B|1|AB, 4V8C|1|DB, 4WSM|1|2K, 4WSM|1|2L, 4V8B|1|CB, 4V87|1|BB, 4WSM|1|1L, 4WSM|1|1K, 4V87|1|CB
74NR_4.0_95556.5
Exact match
Thermus thermophilus
4V8U|1|CV (4V8U)
  • MRNA
  • X-RAY DIFFRACTION
  • Chain(s): CV; model(s): 1
3.7 Å76(11) 4V8U|1|CV, 4V8U|1|AV, 5J8B|1|w, 5J8B|1|y, 4V90|1|AV, 4WT8|1|D3, 3J9Z|1|S7, 4V5A|1|AV+4V5A|1|AX, 4V5A|1|CV+4V5A|1|CX, 4WT8|1|C3, 4WT8|1|C2
75NR_4.0_25585.2
Exact match
synthetic construct
4Z4D|1|B+4Z4D|1|D (4Z4D)
  • RNA (5'-R(P*UP*UP*CP*AP*CP*AP*UP*UP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, D, K, L, O, P; model(s): 1
1.6 Å20(11) 4Z4D|1|B+4Z4D|1|D, 4W5O|1|B+4W5O|1|D, 4Z4H|1|B+4Z4H|1|D, 4Z4G|1|B+4Z4G|1|D, 4Z4I|1|B+4Z4I|1|D, 4Z4C|1|B+4Z4C|1|D, 4Z4E|1|B+4Z4E|1|D, 4W5Q|1|B+4W5Q|1|D, 4Z4F|1|B+4Z4F|1|D, 4W5T|1|B+4W5T|1|D, 4W5R|1|B+4W5R|1|D
76NR_4.0_65028.2
Exact match
1NYI|1|B+1NYI|1|A (1NYI)
  • 5'-R(*GP*CP*CP*GP*AP*AP*AP*CP*UP*CP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, K, L, O, P; model(s): 1
2.9 Å24(10) 1NYI|1|B+1NYI|1|A, 1Q29|1|B+1Q29|1|A, 1MME|1|B+1MME|1|A, 299D|1|B+299D|1|A, 301D|1|B+301D|1|A, 359D|1|B+359D|1|A, 300D|1|B+300D|1|A, 1MME|1|D+1MME|1|C, 488D|1|D+488D|1|B+488D|1|A+488D|1|C, 379D|1|B+379D|1|A
77NR_4.0_16130.1
Exact match
1UTD|1|Z (1UTD)
  • 5'-R(*GP*UP*UP*UP*GP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
2.1 Å4(10) 1UTD|1|Z, 1UTD|1|0, 1UTD|1|2, 1UTD|1|3, 1UTD|1|4, 1UTD|1|5, 1UTD|1|6, 1UTD|1|7, 1UTD|1|8, 1UTD|1|9
78NR_4.0_09332.1
Exact match
2JLV|1|D (2JLV)
  • 5'-R(*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.9 Å7(10) 2JLV|1|D, 2JLX|1|C, 2JLX|1|D, 2JLU|1|C, 2JLV|1|C, 2JLZ|1|C, 2JLY|1|C, 2JLU|1|D, 2JLY|1|D, 2JLZ|1|D
79NR_4.0_02086.1
Exact match
3B5S|1|B+3B5S|1|C+3B5S|1|A (3B5S)
  • 29-mer Loop A and Loop B Ribozyme strand
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, L, O, P; model(s): 1
2.3 Å29(10) 3B5S|1|B+3B5S|1|C+3B5S|1|A, 3B5F|1|B+3B5F|1|C+3B5F|1|A, 3BBM|1|B+3BBM|1|C+3BBM|1|A, 3B91|1|B+3B91|1|C+3B91|1|A, 4G6S|1|B+4G6S|1|C+4G6S|1|A, 3BBI|1|B+3BBI|1|C+3BBI|1|A, 3B58|1|B+3B58|1|C+3B58|1|A, 3B5A|1|B+3B5A|1|C+3B5A|1|A, 3BBK|1|B+3BBK|1|C+3BBK|1|A, 4G6P|1|B+4G6P|1|C+4G6P|1|A
80NR_4.0_25521.1
Exact match
synthetic construct
4PEI|1|Z (4PEI)
  • RNA (5'-R(*UP*AP*AP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
2.0 Å3(10) 4PEI|1|Z, 5K77|1|V, 5K77|1|W, 5K77|1|X, 5K77|1|Y, 5K77|1|Z, 4PEI|1|V, 4PEI|1|W, 4PEI|1|X, 4PEI|1|Y
81NR_4.0_78233.1
Exact match
Escherichia coli
4V9L|1|AW (4V9L)
  • transfer RNA
  • X-RAY DIFFRACTION
  • Chain(s): AW; model(s): 1
3.5 Å77(10) 4V9L|1|AW, 4V9M|1|AW, 4V9M|1|CW, 4V9L|1|CW, 4V9J|1|AW, 4V9K|1|AW, 4V9K|1|CW, 4V9J|1|CW, 4W29|1|AW, 4W29|1|CW
82NR_4.0_51962.2
Exact match
Escherichia coli
4YCP|1|B (4YCP)
  • tRNATrp
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å62(10) 4YCP|1|B, 4V5R|1|AY, 4V5L|1|AY, 4V5R|1|CY, 4V5Q|1|AY, 4V5S|1|AY, 4V5P|1|AY, 4V5Q|1|CY, 4V5S|1|CY, 4V5P|1|CY
83NR_4.0_78372.2
Exact match
1B2M|1|E (1B2M)
  • 5'-R(*GP*(U34))-3'
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.0 Å1(9) 1B2M|1|E, 5F6C|1|C, 5K77|1|v, 5K77|1|w, 5K77|1|x, 5K77|1|y, 5K77|1|z, 1B2M|1|C, 1B2M|1|D
84NR_4.0_88496.1
Exact match
1ET4|1|E (1ET4)
  • RNA APTAMER, 35-MER
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.3 Å35(9) 1ET4|1|E, 1ET4|1|A, 1ET4|1|B, 1ET4|1|D, 1DDY|1|E, 1DDY|1|G, 1DDY|1|A, 1ET4|1|C, 1DDY|1|C
85NR_4.0_24819.1
Exact match
Saccharomyces cerevisiae
1IL2|1|C (1IL2)
  • ASPARTYL TRANSFER RNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.6 Å67(9) 1IL2|1|C, 1IL2|1|D, 3TRA|1|A, 1VTQ|1|A, 1ASZ|1|R, 1ASY|1|R, 1ASZ|1|S, 1ASY|1|S, 2TRA|1|A
86NR_4.0_38950.2
Exact match
2XD0|1|V (2XD0)
  • TOXI
  • X-RAY DIFFRACTION
  • Chain(s): V; model(s): 1
3.0 Å35(9) 2XD0|1|V, 2XDD|1|F, 2XDB|1|G, 2XDD|1|H, 2XD0|1|H, 2XDD|1|G, 2XD0|1|G, 2XD0|1|I, 2XD0|1|U
87NR_4.0_65533.1
Exact match
3OVA|1|C (3OVA)
  • RNA (34-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.0 Å34(9) 3OVA|1|C, 3OV7|1|C, 3OVS|1|C, 3OVB|1|C, 3OVS|1|D, 3OUY|1|C, 3OVB|1|D, 3OV7|1|D, 3OUY|1|D
88NR_4.0_17782.1
Exact match
3R1C|1|a+3R1C|1|b (3R1C)
  • RNA (5'-R(*GP*CP*GP*GP*CP*GP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, L, O, P, a, b; model(s): 1
2.1 Å8(9) 3R1C|1|a+3R1C|1|b, 3R1C|1|G+3R1C|1|H, 3R1C|1|A+3R1C|1|B, 3R1C|1|M+3R1C|1|N, 3R1C|1|O+3R1C|1|P, 3R1C|1|Q+3R1C|1|R, 3R1C|1|S+3R1C|1|Y, 3R1C|1|T+3R1C|1|U, 3R1C|1|V+3R1C|1|Z
89NR_4.0_89612.1
Exact match
synthetic construct
4AFY|1|D (4AFY)
  • 5'-R(*GP*GP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.0 Å2(9) 4AFY|1|D, 4AFY|1|C, 3U2E|1|C, 3U2E|1|D, 4X4U|1|H, 4LQ3|1|R, 1UVK|1|B, 1UVK|1|D, 1UVK|1|F
90NR_4.0_26836.2
Exact match
Haloarcula marismortui
4BW0|1|A (4BW0)
  • HMKT-7
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å26(9) 4BW0|1|A, 5FJ1|1|A, 5FJ1|1|B, 5FJ1|1|C, 5FJ1|1|D, 5FJ1|1|E, 5FJ1|1|F, 5FJ1|1|G, 5FJ1|1|H
91NR_4.0_71520.1
Exact match
Escherichia virus T7
1H38|1|O (1H38)
  • 5'-R(*AP*AP*CP*UP*GP*CP*GP*GP*CP*GP *AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): O; model(s): 1
2.9 Å8(8) 1H38|1|O, 1S0V|1|F, 1H38|1|F, 1S0V|1|I, 1H38|1|I, 1S0V|1|L, 1H38|1|L, 1S0V|1|O
92NR_4.0_14947.1
Exact match
1KOG|1|P (1KOG)
  • Threonyl-tRNA synthetase mRNA
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.5 Å37(8) 1KOG|1|P, 1KOG|1|I, 1KOG|1|J, 1KOG|1|L, 1KOG|1|M, 1KOG|1|N, 1KOG|1|O, 1KOG|1|K
93NR_4.0_75326.1
Exact match
1M5K|1|E (1M5K)
  • RNA HAIRPIN RIBOZYME
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.4 Å91(8) 1M5K|1|E, 1M5K|1|B, 1M5P|1|B, 1M5O|1|B, 1M5V|1|E, 1M5O|1|E, 1M5V|1|B, 1M5P|1|E
94NR_4.0_51779.2
Exact match
1Z7F|1|A (1Z7F)
  • 5'-R(*GP*CP*AP*GP*AP*CP*UP*UP*AP*AP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.1 Å16(8) 1Z7F|1|A, 405D|1|A+405D|1|B, 1Z79|1|A+1Z79|1|B, 1YY0|1|A+1YY0|1|B, 1YRM|1|A+1YRM|1|B, 1YY0|1|C, 1YRM|1|C, 1Z79|1|C
95NR_4.0_84537.1
Exact match
2AWE|1|H (2AWE)
  • 5'-R(*UP*(BGM)P*GP*UP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.1 Å5(8) 2AWE|1|H, 2AWE|1|A, 2AWE|1|B, 2AWE|1|C, 2AWE|1|D, 2AWE|1|E, 2AWE|1|F, 2AWE|1|G
96NR_4.0_52425.1
Exact match
2EZ6|1|D (2EZ6)
  • 28-MER
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.1 Å28(8) 2EZ6|1|D, 2NUF|1|C, 2EZ6|1|C, 2NUF|1|D, 4M30|1|C, 4M2Z|1|C, 4M30|1|D, 4M2Z|1|D
97NR_4.0_58299.1
Exact match
2GRB|1|H (2GRB)
  • 5'-R(*(U33)P*GP*IP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
1.4 Å4(8) 2GRB|1|H, 2GRB|1|A, 2GRB|1|B, 2GRB|1|C, 2GRB|1|D, 2GRB|1|E, 2GRB|1|F, 2GRB|1|G
98NR_4.0_27756.1
Exact match
Arabidopsis thaliana
3D2V|1|A (3D2V)
  • TPP-specific riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å77(8) 3D2V|1|A, 3D2G|1|A, 3D2X|1|A, 3D2V|1|B, 3D2G|1|B, 3D2X|1|B, 2CKY|1|A, 2CKY|1|B
99NR_4.0_45040.1
Exact match
3EPK|1|E (3EPK)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.2 Å69(8) 3EPK|1|E, 3EPJ|1|E, 3EPH|1|E, 3EPL|1|F, 3EPL|1|E, 3EPJ|1|F, 3EPH|1|F, 3EPK|1|F
100NR_4.0_26629.1
Exact match
3HK2|1|F (3HK2)
  • 5'-R(*UP*AP*UP*AP*CP*AP*AP*CP*CP*UP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.8 Å15(8) 3HK2|1|F, 3HK2|1|D, 3HM9|1|Y, 3HVR|1|D, 3F73|1|H, 3F73|1|Y, 3HVR|1|N, 3HXM|1|Y
101NR_4.0_21705.1
Exact match
3SKI|1|A (3SKI)
  • RNA (68-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å66(8) 3SKI|1|A, 3SKZ|1|A, 3SLQ|1|A, 3SLM|1|A, 3SKZ|1|B, 3SLQ|1|B, 3SLM|1|B, 3SKI|1|B
102NR_4.0_47330.1
Exact match
3SKL|1|A (3SKL)
  • RNA (66-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å64(8) 3SKL|1|A, 3SKT|1|B, 3SKR|1|B, 3SKT|1|A, 3SKR|1|A, 3SKL|1|B, 3SKW|1|A, 3SKW|1|B
103NR_4.0_61644.1
Exact match
3T1Y|1|X+3T1Y|1|W (3T1Y)
  • tRNA ASL human Lys3
  • X-RAY DIFFRACTION
  • Chain(s): A, L, O, P, W, X; model(s): 1
2.8 Å8(8) 3T1Y|1|X+3T1Y|1|W, 1XMO|1|X+1XMO|1|W, 1XMQ|1|X+1XMQ|1|W, 3T1H|1|X+3T1H|1|W, 4X66|1|b+4X66|1|a, 4X64|1|b+4X64|1|a, 4X65|1|b+4X65|1|a, 4X62|1|b+4X62|1|a
104NR_4.0_91231.1
Exact match
3VYX|1|B+3VYX|1|C (3VYX)
  • RNA (5'-R(P*GP*CP*GP*CP*GP*CP*GP*CP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, L, O, P; model(s): 1
2.3 Å10(8) 3VYX|1|B+3VYX|1|C, 3ZD7|1|C+3ZD7|1|D, 4BPB|1|C+4BPB|1|D, 3ZD6|1|C+3ZD6|1|D, 2YKG|1|C+2YKG|1|D, 3VYY|1|C+3VYY|1|D, 3VYY|1|E+3VYY|1|F, 3VYY|1|G
105NR_4.0_41594.1
Exact match
4ILM|1|R (4ILM)
  • RNA (5'-R(*GP*CP*UP*AP*AP*UP*CP*UP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.1 Å16(8) 4ILM|1|R, 4ILM|1|C, 4ILM|1|G, 4ILM|1|K, 4ILM|1|M, 4ILM|1|E, 4ILM|1|I, 4ILM|1|O
106NR_4.0_81203.2
Exact match
4K4Z|1|N+4K4Z|1|O+4K4Z|1|P (4K4Z)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): L, N, O, P; model(s): 1
2.2 Å17(8) 4K4Z|1|N+4K4Z|1|O+4K4Z|1|P, 4K4Z|1|F+4K4Z|1|G+4K4Z|1|H, 4K4Z|1|J+4K4Z|1|K+4K4Z|1|L, 4K4Z|1|B+4K4Z|1|C+4K4Z|1|D, 4K4X|1|B+4K4X|1|C+4K4X|1|D, 4K4X|1|F+4K4X|1|G+4K4X|1|H, 4K4X|1|J+4K4X|1|K+4K4X|1|L, 4K4X|1|N+4K4X|1|O+4K4X|1|P
107NR_4.0_51487.1
Exact match
4L8H|1|R (4L8H)
  • RNA operator hairpin
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.4 Å20(8) 4L8H|1|R, 2BS1|1|S, 1ZSE|1|R, 2B2D|1|R, 2BS0|1|S, 2BS0|1|R, 2BS1|1|R, 2B2D|1|S
108NR_4.0_48149.1
Exact match
synthetic construct
4RMO|1|P (4RMO)
  • RNA (45-MER)
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.2 Å44(8) 4RMO|1|P, 4RMO|1|B, 4RMO|1|D, 4RMO|1|F, 4RMO|1|H, 4RMO|1|J, 4RMO|1|L, 4RMO|1|N
109NR_4.0_68446.1
Exact match
synthetic construct
4U6K|1|C (4U6K)
  • RNA (5'-R(*GP*AP*AP*GP*AP*AP*GP*AP*G)-3'[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.5 Å9(8) 4U6K|1|C, 4U6M|1|A, 4U6L|1|A, 4U6K|1|A, 2DQP|1|B, 479D|1|B, 2DQO|1|B, 2DQQ|1|B
110NR_4.0_04935.1
Exact match
Thermotoga maritima
4YVI|1|C (4YVI)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.0 Å71(8) 4YVI|1|C, 4YVJ|1|C, 4YVK|1|C, 3AL0|1|E, 3AKZ|1|G, 3AKZ|1|H, 3AKZ|1|F, 3AKZ|1|E
111NR_4.0_10054.2
Exact match
synthetic construct
5EAQ|1|A (5EAQ)
  • RNA (48-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.2 Å48(8) 5EAQ|1|A, 5DQK|1|A, 5EAO|1|A, 5DH6|1|A, 5DI2|1|A, 5DH8|1|A, 5DH7|1|A, 5DI4|1|A
112NR_4.0_19067.1
Exact match
synthetic construct
5EBI|1|H (5EBI)
  • DNA/RNA (5'-D(*C)-R(P*G)-D(P*C)-R(P*G)-D[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
1.1 Å7(8) 5EBI|1|H, 5EBI|1|F, 5EBI|1|A, 5EBI|1|C, 5EBI|1|B, 5EBI|1|D, 5EBI|1|E, 5EBI|1|G
113NR_4.0_25852.1
Exact match
1M8V|1|U (1M8V)
  • 5'-R(P*UP*UP*UP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): U; model(s): 1
2.6 Å6(7) 1M8V|1|U, 1M8V|1|O, 1M8V|1|P, 1M8V|1|Q, 1M8V|1|R, 1M8V|1|S, 1M8V|1|T
114NR_4.0_64047.1
Exact match
1PVO|1|L (1PVO)
  • 5'-R(P*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
3.0 Å2(7) 1PVO|1|L, 1PVO|1|G, 1PVO|1|H, 1PVO|1|J, 2HT1|1|J, 1PVO|1|K, 2HT1|1|K
115NR_4.0_57955.2
Exact match
1Q93|1|B (1Q93)
  • Sarcin/Ricin 28S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å27(7) 1Q93|1|B, 1Q93|1|A, 1Q96|1|A, 1Q96|1|B, 1Q93|1|C, 1Q96|1|C, 430D|1|A
116NR_4.0_60049.1
Exact match
1VQO|1|4 (1VQO)
  • 5'-R(*CP*CP*(PPU))-3'
  • X-RAY DIFFRACTION
  • Chain(s): 4; model(s): 1
2.2 Å2(7) 1VQO|1|4, 1QVG|1|3, 3CMA|1|5, 5LZD|1|w, 5LZE|1|w, 3CD6|1|4, 3CME|1|5
117NR_4.0_34359.1
Exact match
synthetic construct
2NVQ|1|R (2NVQ)
  • 5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*GP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.9 Å10(7) 2NVQ|1|R, 1R9T|1|R, 2YU9|1|R, 2E2H|1|R, 2NVX|1|R, 2E2I|1|R, 1SFO|1|R
118NR_4.0_04852.2
Exact match
Moorella thermoacetica
2UWM|1|D (2UWM)
  • 5'-R(*GP*GP*CP*GP*UP*UP*GP*CP*CP*GP *GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.3 Å23(7) 2UWM|1|D, 2PLY|1|C, 2PLY|1|E, 1WSU|1|E, 1WSU|1|F, 2UWM|1|C, 1WSU|1|G
119NR_4.0_90840.2
Exact match
3A3A|1|A (3A3A)
  • selenocysteine tRNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å86(7) 3A3A|1|A, 4RQF|1|C, 4RQE|1|B, 4RQE|1|D, 4ZDO|1|E, 4ZDP|1|E, 3HL2|1|E
120NR_4.0_08831.2
Exact match
Methanocaldococcus jannaschii
3NDB|1|M (3NDB)
  • SRP RNA
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
3.0 Å136(7) 3NDB|1|M, 4XCO|1|E, 4XCO|1|M, 2V3C|1|N, 1LNG|1|B, 2V3C|1|M, 1Z43|1|A
121NR_4.0_28980.1
Exact match
3P4C|1|B (3P4C)
  • 5'-R(*(CFZ)P*GP*(AF2)P*AP*(UFT)P*UP*(CFZ[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.2 Å4(7) 3P4C|1|B, 3P4B|1|A, 3P4B|1|B, 3P4B|1|C, 3P4B|1|D, 3P4B|1|E, 3P4B|1|F
122NR_4.0_35293.2
Exact match
3P6Y|1|W (3P6Y)
  • 5'-R(*UP*GP*UP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
2.9 Å1(7) 3P6Y|1|W, 3P6Y|1|R, 3P6Y|1|S, 3P6Y|1|T, 3P6Y|1|U, 3P6Y|1|V, 3P6Y|1|Q
123NR_4.0_56092.1
Exact match
4DB2|1|I+4DB2|1|J (4DB2)
  • 5'-R(*GP*GP*GP*CP*GP*GP*GP*CP*CP*CP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): I, J, L, O, P; model(s): 1
3.2 Å14(7) 4DB2|1|I+4DB2|1|J, 4DB2|1|E+4DB2|1|F, 4DB2|1|H+4DB2|1|G, 4DB4|1|C, 4DB4|1|D, 4DB4|1|E, 4DB4|1|F
124NR_4.0_57733.1
Exact match
4H8K|1|C (4H8K)
  • RNA (5'-R(*CP*GP*AP*CP*AP*CP*CP*UP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.3 Å14(7) 4H8K|1|C, 2QKK|1|C, 2QKK|1|G, 2QKK|1|K, 2QKK|1|O, 2QKK|1|T, 2QKK|1|X
125NR_4.0_78797.1
Exact match
4LVZ|1|A (4LVZ)
  • THF riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.8 Å89(7) 4LVZ|1|A, 3SD3|1|A, 4LVX|1|A, 4LVW|1|A, 4LVY|1|A, 4LVV|1|A, 4LW0|1|A
126NR_4.0_10487.1
Exact match
4NFQ|1|B+4NFQ|1|C (4NFQ)
  • GCAG(7AT)CUUAAGUCUGC
  • X-RAY DIFFRACTION
  • Chain(s): B, C, L, O, P; model(s): 1
1.7 Å15(7) 4NFQ|1|B+4NFQ|1|C, 4NFO|1|A, 4NFO|1|B+4NFO|1|C, 4NFQ|1|A, 4NFP|1|A, 4NFP|1|B+4NFP|1|C, 1YZD|1|C
127NR_4.0_19502.2
Exact match
synthetic construct
4RGE|1|B (4RGE)
  • env22 twister ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å55(7) 4RGE|1|B, 4RGE|1|C, 4RGE|1|A, 5DUN|1|A, 4RGF|1|A, 4RGF|1|B, 4RGF|1|C
128NR_4.0_83891.4
Exact match
Staphylococcus aureus
4WFA|1|Y (4WFA)
  • 5S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
3.4 Å114(7) 4WFA|1|Y, 5HKV|1|Y, 4WFB|1|Y, 4WCE|1|Y, 5HL7|1|Y, 5LI0|1|B, 4WF9|1|Y
129NR_4.0_92081.4
Exact match
synthetic construct
5FW3|1|A (5FW3)
  • SGRNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å81(7) 5FW3|1|A, 4UN5|1|A, 5FQ5|1|A, 5FW1|1|A, 4UN3|1|A, 5FW2|1|A, 4UN4|1|A
130NR_4.0_30457.4
Exact match
Saccharomyces cerevisiae
5GAN|1|U (5GAN)
  • Saccharomyces cerevisiae strain UOA_M2 c[...]
  • ELECTRON MICROSCOPY
  • Chain(s): U; model(s): 1
3.7 Å141(7) 5GAN|1|U, 5LJ3|1|U, 5MPS|1|5, 5GAM|1|U, 5GMK|1|D, 5WSG|1|D, 3JCM|1|F
131NR_4.0_90633.4
Exact match
Staphylococcus aureus
5HL7|1|X (5HL7)
  • 23S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.6 Å2705(7) 5HL7|1|X, 4WCE|1|X, 4WF9|1|X, 4WFB|1|X, 4WFA|1|X, 5HKV|1|X, 5LI0|1|A
132NR_4.0_49785.2
Exact match
Homo sapiens
5M73|1|A (5M73)
  • Human gene for small cytoplasmic 7SL RNA[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.4 Å144(7) 5M73|1|A, 1MFQ|1|A, 3KTV|1|C, 5M73|1|E, 4P3E|1|A, 1L9A|1|B, 3KTV|1|A
133NR_4.0_78670.1
Exact match
1CVJ|1|T (1CVJ)
  • 5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.6 Å7(6) 1CVJ|1|T, 1CVJ|1|N, 1CVJ|1|O, 1CVJ|1|S, 1CVJ|1|P, 1CVJ|1|R
134NR_4.0_27949.4
Exact match
1I5L|1|Y (1I5L)
  • 5'-R(*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.8 Å3(6) 1I5L|1|Y, 5IP2|1|D, 5IP2|1|F, 1I5L|1|U, 4DR7|1|b, 4DR6|1|b
135NR_4.0_31741.1
Exact match
1IBL|1|X (1IBL)
  • P-SITE MESSENGER RNA FRAGMENT
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.1 Å6(6) 1IBL|1|X, 1IBM|1|X, 1HR0|1|X, 1HNZ|1|X, 1HNW|1|X, 1IBK|1|X
136NR_4.0_95614.1
Exact match
1QA6|1|D (1QA6)
  • 58 NUCLEOTIDE RIBOSOMAL RNA DOMAIN
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.8 Å58(6) 1QA6|1|D, 1QA6|1|C, 1HC8|1|C, 1Y39|1|C, 1HC8|1|D, 1Y39|1|D
137NR_4.0_90215.1
Exact match
1YKV|1|D (1YKV)
  • Diels-Alder ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.3 Å38(6) 1YKV|1|D, 1YLS|1|B, 1YLS|1|D, 1YKQ|1|B, 1YKQ|1|D, 1YKV|1|B
138NR_4.0_23989.1
Exact match
Thermus thermophilus
2BTE|1|E (2BTE)
  • TRNALEU TRANSCRIPT WITH ANTICODON CAG
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.9 Å78(6) 2BTE|1|E, 2V0G|1|F, 2BTE|1|B, 2BYT|1|B, 2BYT|1|E, 2V0G|1|B
139NR_4.0_35629.1
Exact match
2O5I|1|Y (2O5I)
  • 5'-R(P*GP*AP*GP*UP*CP*UP*GP*CP*GP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.5 Å16(6) 2O5I|1|Y, 2O5J|1|H, 2O5I|1|H, 2PPB|1|H, 2PPB|1|Y, 2O5J|1|Y
140NR_4.0_02858.1
Exact match
2QUX|1|R (2QUX)
  • RNA (25-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.4 Å25(6) 2QUX|1|R, 2QUX|1|C, 2QUX|1|F, 2QUX|1|I, 2QUX|1|L, 2QUX|1|O
141NR_4.0_33592.3
Exact match
2TMV|1|R (2TMV)
  • RNA (5'-R(P*GP*AP*A)-3')
  • FIBER DIFFRACTION
  • Chain(s): R; model(s): 1
2.9 Å3(6) 2TMV|1|R, 1RMV|1|B, 1CGM|1|I, 1VTM|1|R, 4UDV|1|R, 3PDM|1|R
142NR_4.0_63789.1
Exact match
Methanopyrus kandleri
3ADD|1|C (3ADD)
  • selenocysteine tRNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.4 Å88(6) 3ADD|1|C, 3ADD|1|D, 3ADC|1|C, 3ADB|1|C, 3ADB|1|D, 3ADC|1|D
143NR_4.0_38099.1
Exact match
3BNS|1|C+3BNS|1|D (3BNS)
  • A site of human mitochondrial ribosome, [...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, L, O, P; model(s): 1
1.9 Å22(6) 3BNS|1|C+3BNS|1|D, 3BNS|1|A+3BNS|1|B, 3BNQ|1|A+3BNQ|1|B, 3BNR|1|A+3BNR|1|B, 3BNR|1|C+3BNR|1|D, 3BNQ|1|C+3BNQ|1|D
144NR_4.0_11791.1
Exact match
3BSU|1|I (3BSU)
  • RNA (5'-R(*GP*AP*CP*AP*CP*CP*UP*GP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
2.1 Å12(6) 3BSU|1|I, 4WKJ|1|A, 4WKJ|1|C, 4WKJ|1|D, 3BSU|1|D, 4WKJ|1|G
145NR_4.0_47203.1
Exact match
3F2Q|1|X (3F2Q)
  • FMN riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.0 Å107(6) 3F2Q|1|X, 3F2Y|1|X, 3F2W|1|X, 3F30|1|X, 3F2X|1|X, 3F2T|1|X
146NR_4.0_22826.1
Exact match
3GPQ|1|F (3GPQ)
  • RNA (5'-R(*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.0 Å2(6) 3GPQ|1|F, 4OAU|1|A, 2A1R|1|C, 2A1R|1|D, 1LAJ|1|R, 3GPQ|1|E
147NR_4.0_66484.2
Exact match
3HHN|1|E (3HHN)
  • Class I ligase ribozyme, self-ligation p[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.0 Å136(6) 3HHN|1|E, 3HHN|1|C, 3R1L|1|F, 3R1H|1|F, 3R1H|1|C, 3R1L|1|C
148NR_4.0_72076.2
Exact match
Kluyveromyces lactis
3JAM|1|2 (3JAM)
  • 18S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
3.5 Å1780(6) 3JAM|1|2, 5IT7|1|2, 5IT9|1|2, 3J80|1|2, 3J81|1|2, 4V92|1|A2
149NR_4.0_39651.1
Exact match
3LWR|1|D (3LWR)
  • H/ACA RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.2 Å58(6) 3LWR|1|D, 3LWV|1|D, 3LWP|1|D, 3HJW|1|D, 3LWO|1|D, 3LWQ|1|D
150NR_4.0_96295.1
Exact match
3M7N|1|Z (3M7N)
  • 5'-R(*C*UP*CP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
2.4 Å4(6) 3M7N|1|Z, 3M7N|1|X, 3M7N|1|Y, 3M85|1|X, 3M85|1|Y, 3M85|1|Z
151NR_4.0_22904.1
Exact match
3R1C|1|e+3R1C|1|f (3R1C)
  • RNA (5'-R(*GP*CP*GP*GP*CP*GP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): L, O, P, e, f; model(s): 1
2.1 Å8(6) 3R1C|1|e+3R1C|1|f, 3R1C|1|C+3R1C|1|D, 3R1C|1|I+3R1C|1|J, 3R1C|1|K+3R1C|1|L, 3R1C|1|W+3R1C|1|X, 3R1C|1|c+3R1C|1|d
152NR_4.0_15508.1
Exact match
3TRZ|1|Z (3TRZ)
  • RNA (5'-R(*GP*GP*GP*CP*AP*GP*GP*GP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
2.9 Å20(6) 3TRZ|1|Z, 3TRZ|1|U, 3TRZ|1|V, 3TRZ|1|W, 3TRZ|1|X, 3TRZ|1|Y
153NR_4.0_06843.2
Exact match
3WC2|1|P (3WC2)
  • 76mer-tRNA
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.6 Å74(6) 3WC2|1|P, 1TTT|1|F, 1EVV|1|A, 1TTT|1|E, 3WC2|1|Q, 1TTT|1|D
154NR_4.0_80911.1
Exact match
Tetrahymena thermophila
4BTS|1|DA (4BTS)
  • 18S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): DA; model(s): 1
3.7 Å1717(6) 4BTS|1|DA, 4BTS|1|CA, 4BTS|1|AA, 4BTS|1|BA, 4V5O|1|BA, 4V5O|1|AA
155NR_4.0_51862.1
Exact match
Oceanobacillus iheyensis
4LCK|1|E (4LCK)
  • tRNA-Gly
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.2 Å75(6) 4LCK|1|E, 4TZZ|1|H, 4TZZ|1|K, 4TZZ|1|B, 4LCK|1|B, 4TZZ|1|E
156NR_4.0_22632.1
Exact match
4M6D|1|H (4M6D)
  • aptamer
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.7 Å42(6) 4M6D|1|H, 4M6D|1|D, 4M6D|1|L, 4M6D|1|B, 4M6D|1|F, 4M6D|1|J
157NR_4.0_26576.1
Exact match
Oceanobacillus iheyensis
4TZZ|1|I (4TZZ)
  • T-box Stem I RNA
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
3.6 Å102(6) 4TZZ|1|I, 4TZZ|1|C, 4TZZ|1|L, 4LCK|1|C, 4TZZ|1|F, 4LCK|1|F
158NR_4.0_04974.3
Exact match
synthetic construct
4U3L|1|A+4U3L|1|B (4U3L)
  • RNA (5'-R(*UP*CP*GP*UP*AP*CP*GP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
1.5 Å8(6) 4U3L|1|A+4U3L|1|B, 4U78|1|A+4U78|1|B, 4U3P|1|A+4U3P|1|B, 4U3R|1|A+4U3R|1|B, 4U47|1|A+4U47|1|B, 4U3O|1|A+4U3O|1|B
159NR_4.0_15756.1
Exact match
Saccharomyces cerevisiae
4U8T|1|T (4U8T)
  • RNA (5'-R(*AP*GP*GP*(6MZ)P*CP*AP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.7 Å6(6) 4U8T|1|T, 4U8T|1|O, 4U8T|1|P, 4U8T|1|Q, 4U8T|1|R, 4U8T|1|S
160NR_4.0_02142.1
Exact match
Haloarcula marismortui
4V8N|1|CV (4V8N)
  • E-SITE TRNA ILE2 AGMATIDINE OR P-SITE TR[...]
  • X-RAY DIFFRACTION
  • Chain(s): CV; model(s): 1
3.1 Å77(6) 4V8N|1|CV, 4V8N|1|AV, 4V8N|1|CY, 4V8N|1|AY, 4V8N|1|CW, 4V8N|1|AW
161NR_4.0_78862.1
Exact match
4V9E|1|Bm (4V9E)
  • 35-mer poly(U) RNA
  • X-RAY DIFFRACTION
  • Chain(s): Bm; model(s): 1
3.4 Å36(6) 4V9E|1|Bm, 4V9E|1|Aa, 4V9E|1|Ag, 4V9E|1|Am, 4V9E|1|Ba, 4V9E|1|Bg
162NR_4.0_70313.2
Exact match
Escherichia coli
5CD4|1|X (5CD4)
  • crRNA
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.2 Å60(6) 5CD4|1|X, 4TVX|1|L, 4TVX|1|X, 5CD4|1|L, 5H9F|1|L, 5H9E|1|L
163NR_4.0_46720.1
Exact match
Synechococcus elongatus
5DDP|1|B (5DDP)
  • RNA (61-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å61(6) 5DDP|1|B, 5DDQ|1|B, 5DDQ|1|A, 5DDP|1|A, 5DDR|1|B, 5DDR|1|A
164NR_4.0_33278.1
Exact match
Homo sapiens
5LYV|1|B (5LYV)
  • RNA (57-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å56(6) 5LYV|1|B, 5LYS|1|B, 5LYU|1|B, 5LYU|1|A, 5LYV|1|A, 5LYS|1|A
165NR_4.0_18996.1
Exact match
1DI2|1|G (1DI2)
  • RNA (5'-R(*GP*GP*CP*GP*CP*GP*CP*GP*CP*C)[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
1.9 Å10(5) 1DI2|1|G, 1RC7|1|B+1RC7|1|C, 1DI2|1|C+1DI2|1|D, 1RC7|1|D+1RC7|1|E, 1DI2|1|E
166NR_4.0_99963.1
Exact match
1IBL|1|Y+1IBL|1|Z (1IBL)
  • ANTICODON STEM-LOOP OF PHENYLALANINE TRA[...]
  • X-RAY DIFFRACTION
  • Chain(s): L, O, P, Y, Z; model(s): 1
3.1 Å15(5) 1IBL|1|Y+1IBL|1|Z, 1IBM|1|Y+1IBM|1|Z, 4DR4|1|W+4DR4|1|V, 4DR5|1|W+4DR5|1|V, 4AQY|1|Z+4AQY|1|W
167NR_4.0_36712.2
Exact match
1K8W|1|B (1K8W)
  • 5'-R(*GP*GP*CP*AP*AP*CP*GP*GP*UP*(FHU)P*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å21(5) 1K8W|1|B, 1ZL3|1|B, 1ZE2|1|C, 1ZE2|1|D, 2AB4|1|B
168NR_4.0_49890.1
Exact match
1NUJ|1|E+1NUJ|1|F (1NUJ)
  • 5'-R(*CP*GP*GP*AP*CP*CP*GP*AP*GP*CP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): E, F, L, O, P; model(s): 1
1.8 Å13(5) 1NUJ|1|E+1NUJ|1|F, 429D|1|C+429D|1|D, 1NUV|1|C+1NUV|1|D, 1NUJ|1|C+1NUJ|1|D, 1NUV|1|E+1NUV|1|F
169NR_4.0_07779.1
Exact match
1NUJ|1|G+1NUJ|1|H (1NUJ)
  • 5'-R(*CP*GP*GP*AP*CP*CP*GP*AP*GP*CP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): G, H, L, O, P; model(s): 1
1.8 Å15(5) 1NUJ|1|G+1NUJ|1|H, 1NUV|1|A+1NUV|1|B, 1NUJ|1|A+1NUJ|1|B, 1NUV|1|G+1NUV|1|H, 429D|1|A+429D|1|B
170NR_4.0_30944.1
Exact match
1U6B|1|B (1U6B)
  • 197-MER
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.1 Å195(5) 1U6B|1|B, 3BO2|1|B, 3BO3|1|B, 3BO4|1|B, 1ZZN|1|B
171NR_4.0_40597.1
Exact match
1ZHO|1|H (1ZHO)
  • mRNA
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.6 Å38(5) 1ZHO|1|H, 1ZHO|1|D, 1ZHO|1|F, 2HW8|1|B, 1ZHO|1|B
172NR_4.0_79496.3
Exact match
2DER|1|D (2DER)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.1 Å71(5) 2DER|1|D, 2DER|1|C, 2DET|1|C, 2DEU|1|C, 2DEU|1|D
173NR_4.0_92683.1
Exact match
2G3S|1|I+2G3S|1|J (2G3S)
  • 5'-R(*GP*GP*CP*GP*UP*GP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): I, J, L, O, P; model(s): 1
1.5 Å8(5) 2G3S|1|I+2G3S|1|J, 2G3S|1|A+2G3S|1|B, 2G3S|1|C+2G3S|1|D, 2G3S|1|E+2G3S|1|F, 2G3S|1|G+2G3S|1|H
174NR_4.0_14663.1
Exact match
2NR0|1|E (2NR0)
  • leucyl tRNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.9 Å81(5) 2NR0|1|E, 2NR0|1|G, 2NR0|1|H, 2NRE|1|F, 2NR0|1|F
175NR_4.0_86436.1
Exact match
2PN4|1|C+2PN4|1|D (2PN4)
  • 5'-R(*CP*GP*GP*AP*GP*GP*AP*AP*CP*UP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, L, O, P; model(s): 1
2.3 Å24(5) 2PN4|1|C+2PN4|1|D, 2NOK|1|A+2NOK|1|B, 2PN4|1|A+2PN4|1|B, 2PN3|1|A+2PN3|1|B, 2NOK|1|C+2NOK|1|D
176NR_4.0_46403.1
Exact match
3BNN|1|C+3BNN|1|D (3BNN)
  • A site of human ribosome
  • X-RAY DIFFRACTION
  • Chain(s): C, D, L, O, P; model(s): 1
2.0 Å21(5) 3BNN|1|C+3BNN|1|D, 3BNP|1|A+3BNP|1|B, 3BNN|1|A+3BNN|1|B, 3BNO|1|A+3BNO|1|B, 3BNO|1|C+3BNO|1|D
177NR_4.0_64404.1
Exact match
Thermus thermophilus
3TUP|1|T (3TUP)
  • Thermus thermophilus tRNAPhe
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
3.1 Å74(5) 3TUP|1|T, 1EIY|1|C, 2IY5|1|T, 3B0V|1|A, 3B0V|1|B
178NR_4.0_65600.1
Exact match
Pseudomonas aeruginosa
4AL6|1|B (4AL6)
  • CRRNA, 5'-R(CP*UP*GP*CP*CP*GP*UP*AP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å16(5) 4AL6|1|B, 2XLI|1|B, 2XLJ|1|B, 2XLK|1|C, 2XLK|1|D
179NR_4.0_82984.1
Exact match
Thermotoga petrophila
4ENB|1|A (4ENB)
  • Fluoride riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å51(5) 4ENB|1|A, 4ENA|1|A, 3VRS|1|A, 4ENC|1|A, 4EN5|1|A
180NR_4.0_69766.1
Exact match
4MCF|1|H+4MCF|1|G (4MCF)
  • Gas5 GREM Rev
  • X-RAY DIFFRACTION
  • Chain(s): G, H, L, O, P; model(s): 1
1.9 Å10(5) 4MCF|1|H+4MCF|1|G, 4MCF|1|B+4MCF|1|D+4MCF|1|C+4MCF|1|A, 4MCE|1|D+4MCE|1|C, 4MCE|1|B+4MCE|1|A, 4MCF|1|F+4MCF|1|E
181NR_4.0_33394.1
Exact match
4OO8|1|E (4OO8)
  • RNA (97-MER)
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.5 Å97(5) 4OO8|1|E, 4OO8|1|B, 5B2S|1|A, 5B2R|1|A, 5B2T|1|A
182NR_4.0_73731.1
Exact match
Thermus thermophilus
4QVI|1|B (4QVI)
  • fragment of 23S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å80(5) 4QVI|1|B, 3UMY|1|B, 3U4M|1|B, 4QG3|1|B, 3U56|1|B
183NR_4.0_52096.2
Exact match
synthetic construct
4TUX|1|C (4TUX)
  • RNA (26-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.1 Å25(5) 4TUX|1|C, 4TV0|1|B, 4TUW|1|D, 4TUX|1|D, 4TUW|1|C
184NR_4.0_11986.2
Exact match
Escherichia coli
4V5V|1|BX (4V5V)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): BX; model(s): 1
3.6 Å70(5) 4V5V|1|BX, 4V5V|1|AK, 4V5V|1|AM, 4V5V|1|BR, 2YHM|1|K
185NR_4.0_94396.3
Exact match
4WAN|1|H (4WAN)
  • RNA (5'-R(P*UP*AP*CP*UP*AP*AP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
1.8 Å9(5) 4WAN|1|H, 4WAN|1|D, 4WAN|1|F, 4WAN|1|B, 4WAL|1|B
186NR_4.0_95478.6
Exact match
Homo sapiens
5A2Q|1|2 (5A2Q)
  • 18S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
3.9 Å1665(5) 5A2Q|1|2, 5AJ0|1|B1, 5A8L|1|B, 5LKS|1|S2, 5T2C|1|AA
187NR_4.0_67574.1
Exact match
synthetic construct
5F8N|1|B+5F8N|1|C (5F8N)
  • RNA (35-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B, C, L, O, P; model(s): 1
2.5 Å9(5) 5F8N|1|B+5F8N|1|C, 4K4W|1|B+4K4W|1|C, 4K4W|1|F+4K4W|1|G, 5F8L|1|B+5F8L|1|C, 5F8M|1|B+5F8M|1|C
188NR_4.0_64208.1
Exact match
Haloarcula marismortui
5G4U|1|I+5G4U|1|J (5G4U)
  • HMKT-7
  • X-RAY DIFFRACTION
  • Chain(s): I, J, L, O, P; model(s): 1
2.7 Å19(5) 5G4U|1|I+5G4U|1|J, 5G4U|1|A+5G4U|1|B, 5G4V|1|A+5G4V|1|B, 5G4V|1|E+5G4V|1|F, 5G4U|1|E+5G4U|1|F
189NR_4.0_87852.1
Exact match
unidentified
5JCF|1|C+5JCF|1|D (5JCF)
  • RNA (5'-R(P*GP*GP*UP*AP*CP*GP*UP*AP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, L, O, P; model(s): 1
2.6 Å10(5) 5JCF|1|C+5JCF|1|D, 5JC3|1|C+5JC3|1|D, 5JCH|1|U+5JCH|1|V, 5JCH|1|X+5JCH|1|Y, 5JC3|1|X+5JC3|1|Y
190NR_4.0_89026.2
Exact match
synthetic construct
5L00|1|C+5L00|1|D (5L00)
  • RNA (5'-R(*(LCC)P*(LCC)P*(LCC)P*(LCG)P*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, L, O, P; model(s): 1
1.3 Å13(5) 5L00|1|C+5L00|1|D, 5L00|1|A+5L00|1|B, 5V0H|1|A+5V0H|1|B, 5KRG|1|A+5KRG|1|B, 5KRG|1|C+5KRG|1|D
191NR_4.0_50424.1
Exact match
Alicyclobacillus acidoterrestris
5U31|1|B (5U31)
  • sgRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å99(5) 5U31|1|B, 5WQE|1|B, 5U30|1|B, 5U33|1|B, 5U34|1|B
192NR_4.0_49339.2
Exact match
synthetic construct
5V0J|1|A+5V0J|1|B (5V0J)
  • RNA (5'-R(*(LCC)P*(LCC)P*(LCA)P*(LCG)P*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
1.5 Å10(5) 5V0J|1|A+5V0J|1|B, 5HBX|1|A+5HBX|1|B, 5DHC|1|A+5DHC|1|B, 5DHC|1|C+5DHC|1|D, 5HBX|1|C+5HBX|1|D
193NR_4.0_24974.1
Exact match
1DUQ|1|H+1DUQ|1|G (1DUQ)
  • THE REV BINDING ELEMENT
  • X-RAY DIFFRACTION
  • Chain(s): G, H, L, O, P; model(s): 1
2.1 Å14(4) 1DUQ|1|H+1DUQ|1|G, 1DUQ|1|B+1DUQ|1|A, 1DUQ|1|D+1DUQ|1|C, 1DUQ|1|F+1DUQ|1|E
194NR_4.0_57348.1
Exact match
1IVS|1|C (1IVS)
  • tRNA (Val)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å75(4) 1IVS|1|C, 1GAX|1|C, 1GAX|1|D, 1IVS|1|D
195NR_4.0_81653.1
Exact match
1J6S|1|D (1J6S)
  • 5'-R(*(BRUP*GP*AP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.4 Å5(4) 1J6S|1|D, 1J6S|1|A, 1J6S|1|B, 1J6S|1|C
196NR_4.0_28334.1
Exact match
1KNZ|1|Z (1KNZ)
  • 5'-R(*UP*GP*AP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
2.5 Å5(4) 1KNZ|1|Z, 1KNZ|1|W, 1KNZ|1|X, 1KNZ|1|Y
197NR_4.0_51549.1
Exact match
1PJO|1|A (1PJO)
  • 5'-R(*CP*AP*AP*AP*GP*AP*AP*AP*AP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å14(4) 1PJO|1|A, 1PJG|1|A, 1G4Q|1|A, 1JB8|1|A
198NR_4.0_01597.1
Exact match
1Q2R|1|F (1Q2R)
  • RNA (5'-R(*AP*GP*CP*AP*CP*GP*GP*CP*UP*(N[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.9 Å19(4) 1Q2R|1|F, 1Q2R|1|E, 1Q2S|1|E, 1Q2S|1|F
199NR_4.0_18961.1
Exact match
1WMQ|1|D (1WMQ)
  • 5'-R(P*UP*UP*UP*AP*GP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.6 Å7(4) 1WMQ|1|D, 1WRQ|1|C, 1WMQ|1|C, 1WRQ|1|D
200NR_4.0_85514.1
Exact match
1YYK|1|E+1YYK|1|F (1YYK)
  • 5'-R(*CP*GP*CP*GP*AP*AP*UP*UP*CP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): E, F, L, O, P; model(s): 1
2.5 Å12(4) 1YYK|1|E+1YYK|1|F, 1YYO|1|C+1YYO|1|D, 1YYK|1|C+1YYK|1|D, 1YYO|1|E+1YYO|1|F
201NR_4.0_24746.1
Exact match
1YYW|1|K+1YYW|1|L (1YYW)
  • 5'-R(*AP*AP*AP*UP*AP*UP*AP*UP*AP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): K, L, O, P; model(s): 1
2.8 Å12(4) 1YYW|1|K+1YYW|1|L, 1YYW|1|E+1YYW|1|F, 1YYW|1|G+1YYW|1|H, 1YYW|1|I+1YYW|1|J
202NR_4.0_23650.1
Exact match
259D|1|A+259D|1|B (259D)
  • RNA (5'-R(*CP*CP*CP*CP*GP*GP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
1.5 Å8(4) 259D|1|A+259D|1|B, 1RXA|1|A, 1RXB|1|A+1RXB|1|B, 2A0P|1|A+2A0P|1|B
203NR_4.0_58761.1
Exact match
2CT8|1|D (2CT8)
  • RNA (74-MER)
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.7 Å74(4) 2CT8|1|D, 2CSX|1|C, 2CT8|1|C, 2CSX|1|D
204NR_4.0_39150.1
Exact match
2CZJ|1|H (2CZJ)
  • tmRNA (63-MER)
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.0 Å60(4) 2CZJ|1|H, 2CZJ|1|D, 2CZJ|1|B, 2CZJ|1|F
205NR_4.0_59612.1
Exact match
2DB3|1|H (2DB3)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.2 Å6(4) 2DB3|1|H, 2DB3|1|E, 2DB3|1|F, 2DB3|1|G
206NR_4.0_33389.1
Exact match
2DU3|1|D (2DU3)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.6 Å71(4) 2DU3|1|D, 2DU4|1|C, 2DU6|1|D, 2DU5|1|D
207NR_4.0_54657.1
Exact match
2FQN|1|A+2FQN|1|B (2FQN)
  • 5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*UP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
2.3 Å22(4) 2FQN|1|A+2FQN|1|B, 2O3Y|1|A+2O3Y|1|B, 2G5K|1|A+2G5K|1|B, 2O3W|1|A+2O3W|1|B
208NR_4.0_98374.1
Exact match
2I82|1|H (2I82)
  • 5'-R(*GP*AP*GP*GP*GP*GP*AP*UP*UP*GP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.1 Å20(4) 2I82|1|H, 2I82|1|E, 2I82|1|F, 2I82|1|G
209NR_4.0_58198.1
Exact match
2R20|1|A+2R20|1|B (2R20)
  • RNA (5'-R(*GP*CP*GP*UP*UP*(5BU)P*GP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
1.3 Å12(4) 2R20|1|A+2R20|1|B, 2R22|1|A+2R22|1|B, 2R1S|1|A+2R1S|1|B, 2R21|1|A+2R21|1|B
210NR_4.0_16115.1
Exact match
2R7W|1|X (2R7W)
  • RNA (5'-R(*UP*GP*UP*GP*AP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.6 Å7(4) 2R7W|1|X, 2R7X|1|X, 2R7R|1|X, 2R7X|1|Y
211NR_4.0_03697.3
Exact match
Thermus thermophilus
2UUA|1|Y+2UUA|1|X (2UUA)
  • 5'-R(*CP*CP*UP*CP*CP*CP*UP*CM0P*AP*CP*6M[...]
  • X-RAY DIFFRACTION
  • Chain(s): L, O, P, X, Y; model(s): 1
2.9 Å11(4) 2UUA|1|Y+2UUA|1|X, 2UUC|1|Y+2UUC|1|X, 2UU9|1|Y+2UU9|1|X, 2UUB|1|Y+2UUB|1|X
212NR_4.0_95171.1
Exact match
3B31|1|A (3B31)
  • RNA (29-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.4 Å29(4) 3B31|1|A, 3MJA|1|B, 3MJB|1|A, 3MJ3|1|B
213NR_4.0_64844.1
Exact match
3BSO|1|T+3BSO|1|P (3BSO)
  • RNA (5'-R(P*UP*GP*CP*CP*CP*GP*GP*GP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): L, O, P, T; model(s): 1
1.7 Å9(4) 3BSO|1|T+3BSO|1|P, 3H5X|1|T+3H5X|1|P, 3H5Y|1|T+3H5Y|1|P, 3BSN|1|T+3BSN|1|P
214NR_4.0_49553.1
Exact match
3CUL|1|D (3CUL)
  • RNA (92-MER)
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.8 Å92(4) 3CUL|1|D, 3CUL|1|C, 3CUN|1|C, 3CUN|1|D
215NR_4.0_22479.1
Exact match
3D0U|1|A (3D0U)
  • Lysine Riboswitch RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å161(4) 3D0U|1|A, 4ERJ|1|A, 4ERL|1|A, 3D0X|1|A
216NR_4.0_95363.2
Exact match
3FU2|1|A (3FU2)
  • PreQ1 riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å32(4) 3FU2|1|A, 3FU2|1|B, 3FU2|1|C, 3K1V|1|A
217NR_4.0_18955.1
Exact match
3I2S|1|A (3I2S)
  • 5'-R(*UP*CP*CP*CP*(A2M)P*GP*UP*CP*CP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å13(4) 3I2S|1|A, 3I2R|1|A, 3I2U|1|A, 3I2Q|1|A
218NR_4.0_51748.1
Exact match
3I5X|1|B (3I5X)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å10(4) 3I5X|1|B, 3I61|1|B, 3I62|1|B, 3I5Y|1|B
219NR_4.0_26483.1
Exact match
Sus scrofa
3J7P|1|5+3J7P|1|8 (3J7P)
  • 28S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 5, 8, L, O, P; model(s): 1
3.5 Å3662(4) 3J7P|1|5+3J7P|1|8, 3J7O|1|5+3J7O|1|8, 3J7Q|1|5+3J7Q|1|8, 3J7R|1|5+3J7R|1|8
220NR_4.0_62824.1
Exact match
Sus scrofa
3J7Q|1|7 (3J7Q)
  • 5S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 7; model(s): 1
3.4 Å120(4) 3J7Q|1|7, 3J7P|1|7, 3J7R|1|7, 3J7O|1|7
221NR_4.0_50890.1
Exact match
3JXR|1|K (3JXR)
  • r[CGCG(5-fluoro)CG]2
  • X-RAY DIFFRACTION
  • Chain(s): K; model(s): 1
1.3 Å5(4) 3JXR|1|K, 3JXQ|1|B+3JXQ|1|A, 3JXQ|1|L+3JXQ|1|K, 3JXR|1|A+3JXR|1|B
222NR_4.0_79254.1
Exact match
Thermus thermophilus
3KFU|1|L (3KFU)
  • tRNA-Asn
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
3.0 Å71(4) 3KFU|1|L, 3KFU|1|K, 3KFU|1|M, 3KFU|1|N
223NR_4.0_56855.1
Exact match
3KMS|1|B+3KMS|1|C (3KMS)
  • RNA (5'-R(*AP*UP*GP*GP*GP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B, C, L, O, P; model(s): 1
2.2 Å7(4) 3KMS|1|B+3KMS|1|C, 3KLV|1|B+3KLV|1|C, 4IQX|1|B+4IQX|1|C, 3KNA|1|B+3KNA|1|C
224NR_4.0_25369.1
Exact match
3NJ6|1|A (3NJ6)
  • 5'-R(*GP*GP*CP*AP*GP*CP*AP*GP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.0 Å10(4) 3NJ6|1|A, 3NJ7|1|A+3NJ7|1|B, 3NJ7|1|C+3NJ7|1|D, 3NJ7|1|E+3NJ7|1|F
225NR_4.0_83027.1
Exact match
Ralstonia solanacearum
3NPN|1|A (3NPN)
  • S-ADENOSYLHOMOCYSTEINE RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å50(4) 3NPN|1|A, 3NPQ|1|C, 3NPQ|1|A, 3NPQ|1|B
226NR_4.0_41959.1
Exact match
3P22|1|G (3P22)
  • Core ENE hairpin from KSHV PAN RNA
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.5 Å39(4) 3P22|1|G, 3P22|1|A, 3P22|1|C, 3P22|1|E
227NR_4.0_76114.1
Exact match
3RKF|1|B (3RKF)
  • Guanine riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å67(4) 3RKF|1|B, 3RKF|1|A, 3RKF|1|D, 3RKF|1|C
228NR_4.0_59870.1
Exact match
3S49|1|G (3S49)
  • RNA (5'-R(*GP*UP*AP*UP*AP*(RUS)P*AP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.3 Å7(4) 3S49|1|G, 3S49|1|A+3S49|1|B, 3S49|1|C+3S49|1|D, 3S49|1|E+3S49|1|F
229NR_4.0_94275.1
Exact match
synthetic construct
3ZP8|1|A (3ZP8)
  • HAMMERHEAD RIBOZYME, ENZYME STRAND
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.6 Å42(4) 3ZP8|1|A, 3ZD4|1|A, 2OEU|1|A, 3ZD5|1|A
230NR_4.0_54627.2
Exact match
Saccharomyces cerevisiae
4A3G|1|P (4A3G)
  • TRANSCRIPT RNA 5'-R(*CP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.5 Å2(4) 4A3G|1|P, 4A3J|1|P, 3J9M|1|u, 5MMI|1|z
231NR_4.0_72182.1
Exact match
Escherichia coli
4AM3|1|I (4AM3)
  • RNA, 5'-R(*UP*AP*AP*CP*UP*UP*UP*GP*GP)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
3.0 Å1(4) 4AM3|1|I, 4AM3|1|E, 4AM3|1|D, 4AM3|1|H
232NR_4.0_95734.1
Exact match
Thermus thermophilus
4B3T|1|Z+4B3T|1|W (4B3T)
  • 5'-R(*GP*GP*GP*AP*UP*UP*GP*AP*AP*AP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): L, O, P, W, Z; model(s): 1
3.0 Å15(4) 4B3T|1|Z+4B3T|1|W, 4B3R|1|Z+4B3R|1|W, 4B3S|1|Z+4B3S|1|W, 4B3M|1|Z+4B3M|1|W
233NR_4.0_87746.1
Exact match
4IQS|1|F (4IQS)
  • RNA (5'-R(*GP*UP*GP*(S5)P*AP*CP*AP*C)-3'[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.6 Å7(4) 4IQS|1|F, 4IQS|1|A+4IQS|1|B, 4IQS|1|C+4IQS|1|D, 4IQS|1|E
234NR_4.0_81920.1
Exact match
4K4Y|1|N+4K4Y|1|P (4K4Y)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): L, N, O, P; model(s): 1
2.7 Å17(4) 4K4Y|1|N+4K4Y|1|P, 4K4Y|1|B+4K4Y|1|D, 4K4Y|1|J+4K4Y|1|L, 4K4Y|1|F+4K4Y|1|H
235NR_4.0_31091.1
Exact match
4K50|1|F (4K50)
  • RNA (33-MER)
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.9 Å31(4) 4K50|1|F, 4K50|1|N, 4K50|1|B, 4K50|1|J
236NR_4.0_06951.1
Exact match
4KZD|1|R (4KZD)
  • RNA (84-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.2 Å83(4) 4KZD|1|R, 4KZE|1|R, 4Q9R|1|R, 4Q9Q|1|R
237NR_4.0_24235.1
Exact match
4LGT|1|F (4LGT)
  • stem-loop of 23S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
1.3 Å19(4) 4LGT|1|F, 4LGT|1|E, 3DH3|1|F+3DH3|1|E, 3DH3|1|G+3DH3|1|H
238NR_4.0_80093.2
Exact match
4LJ0|1|E (4LJ0)
  • polyadenosine RNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.2 Å2(4) 4LJ0|1|E, 5LZY|1|hh, 4LJ0|1|C, 4LJ0|1|D
239NR_4.0_31699.1
Exact match
4MGN|1|B (4MGN)
  • tRNA-glycine
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.2 Å71(4) 4MGN|1|B, 4MGM|1|A, 4MGM|1|B, 4MGN|1|D
240NR_4.0_40559.1
Exact match
synthetic construct
4PEH|1|Y (4PEH)
  • RNA (5'-R(*CP*UP*AP*(A2P)P*AP*CP*AP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.1 Å4(4) 4PEH|1|Y, 4PEH|1|X, 4PEH|1|W, 4PEH|1|V
241NR_4.0_84961.1
Exact match
Homo sapiens
4PJO|1|3 (4PJO)
  • U1 RNA variant (48-MER) with 4-helix jun[...]
  • X-RAY DIFFRACTION
  • Chain(s): 3; model(s): 1
3.3 Å46(4) 4PJO|1|3, 4PJO|1|1, 4PJO|1|2, 4PJO|1|4
242NR_4.0_67439.2
Exact match
4PQU|1|T (4PQU)
  • 5'-R(*AP*UP*GP*GP*UP*CP*GP*GP*CP*GP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.5 Å21(4) 4PQU|1|T, 4PQU|1|E, 4PUO|1|T, 4PUO|1|E
243NR_4.0_19645.1
Exact match
4QI2|1|E (4QI2)
  • RNA (5'-R(*AP*CP*AP*UP*GP*UP*UP*UP*UP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.0 Å19(4) 4QI2|1|E, 4QI2|1|F, 4QI2|1|G, 4QI2|1|H
244NR_4.0_34740.1
Exact match
4QJD|1|H (4QJD)
  • Twister RNA sequence
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.1 Å46(4) 4QJD|1|H, 4QJD|1|B, 4QJD|1|F, 4QJD|1|D
245NR_4.0_26321.1
Exact match
4QOZ|1|A (4QOZ)
  • histone mRNA stem-loop
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å26(4) 4QOZ|1|A, 4L8R|1|A, 4QOZ|1|D, 4L8R|1|D
246NR_4.0_30317.1
Exact match
synthetic construct
4S3N|1|B+4S3N|1|C (4S3N)
  • RNA (5'-R(*GP*GP*CP*UP*UP*UP*UP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, L, O, P; model(s): 1
2.0 Å19(4) 4S3N|1|B+4S3N|1|C, 4RWP|1|B+4RWP|1|C, 4RWN|1|B+4RWN|1|C, 4RWO|1|B+4RWO|1|C
247NR_4.0_17333.1
Exact match
4V50|1|CW (4V50)
  • PHE TRNA (UNMODIFIED BASES)
  • X-RAY DIFFRACTION
  • Chain(s): CW; model(s): 1
3.2 Å17(4) 4V50|1|CW, 4V6D|1|AV, 4V50|1|AW, 4V6D|1|CV
248NR_4.0_13728.1
Exact match
Tetrahymena thermophila
4V8P|1|F1+4V8P|1|E2 (4V8P)
  • 26S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): E2, F1, L, O, P; model(s): 1
3.5 Å3119(4) 4V8P|1|F1+4V8P|1|E2, 4V8P|1|D1+4V8P|1|C2, 4V8P|1|H1+4V8P|1|G2, 4V8P|1|A1+4V8P|1|B2
249NR_4.0_42832.1
Exact match
Tetrahymena thermophila
4V8P|1|G3 (4V8P)
  • 5S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): G3; model(s): 1
3.5 Å120(4) 4V8P|1|G3, 4V8P|1|B3, 4V8P|1|C3, 4V8P|1|E3
250NR_4.0_29909.1
Exact match
Alcaligenes sp.
4V9Q|1|DV (4V9Q)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): DV; model(s): 1
3.4 Å77(4) 4V9Q|1|DV, 4V9Q|1|BV, 4V9Q|1|BW, 4V9Q|1|DW
251NR_4.0_73795.1
Exact match
Pseudomonas aeruginosa
4WJ3|1|T (4WJ3)
  • 76mer-tRNA
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
3.7 Å76(4) 4WJ3|1|T, 4WJ3|1|Q, 4WJ3|1|S, 4WJ3|1|R
252NR_4.0_74156.3
Exact match
Influenza B virus
4WRT|1|V+4WRT|1|R (4WRT)
  • Influenza virus polymerase vRNA promoter[...]
  • X-RAY DIFFRACTION
  • Chain(s): L, O, P, R, V; model(s): 1
2.7 Å14(4) 4WRT|1|V+4WRT|1|R, 5MSG|1|V+5MSG|1|R, 4WSA|1|V+4WSA|1|R, 5M3J|1|V+5M3J|1|R
253NR_4.0_49730.1
Exact match
Homo sapiens
4X4V|1|B (4X4V)
  • Human MenBeta minihelix ending in CCACC
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å34(4) 4X4V|1|B, 4X4U|1|D, 4X4U|1|B, 4X4V|1|D
254NR_4.0_00143.1
Exact match
Lactococcus lactis
4Y1J|1|A (4Y1J)
  • yybP-ykoY riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.2 Å100(4) 4Y1J|1|A, 4Y1I|1|B, 4Y1I|1|A, 4Y1J|1|B
255NR_4.0_31480.1
Exact match
4YAZ|1|R (4YAZ)
  • RNA (84-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.0 Å83(4) 4YAZ|1|R, 4YAZ|1|A, 4YB0|1|A, 4YB0|1|R
256NR_4.0_65123.1
Exact match
Streptococcus pyogenes
4ZT0|1|D (4ZT0)
  • single-guide RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.9 Å72(4) 4ZT0|1|D, 4ZT0|1|B, 4ZT9|1|B, 4ZT9|1|D
257NR_4.0_91467.5
Exact match
Homo sapiens
5AJ0|1|A2+5AJ0|1|A3 (5AJ0)
  • 28S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A2, A3, L, O, P; model(s): 1
3.5 Å3612(4) 5AJ0|1|A2+5AJ0|1|A3, 5T2C|1|A+5T2C|1|C, 5A8L|1|A, 5LKS|1|L5+5LKS|1|L8
258NR_4.0_49464.1
Exact match
synthetic construct
5AY3|1|A+5AY3|1|B (5AY3)
  • RNA (5'-R(*GP*GP*AP*CP*UP*(CBR)P*GP*A*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
1.2 Å12(4) 5AY3|1|A+5AY3|1|B, 5AY2|1|A+5AY2|1|B, 5AY4|1|A+5AY4|1|B, 5AY2|1|C+5AY2|1|D
259NR_4.0_20325.1
Exact match
synthetic construct
5C3E|1|R (5C3E)
  • Synthetic RNA
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.7 Å9(4) 5C3E|1|R, 5C4X|1|R, 5C4J|1|R, 5C44|1|R
260NR_4.0_18889.3
Exact match
Fusobacterium nucleatum
5C45|1|X+5C45|1|Y (5C45)
  • FMN Riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): L, O, P, X, Y; model(s): 1
2.9 Å54(4) 5C45|1|X+5C45|1|Y, 5KX9|1|X+5KX9|1|Y, 3F4G|1|X+3F4G|1|Y, 2YIE|1|X+2YIE|1|Z
261NR_4.0_72172.1
Exact match
Homo sapiens
5CCB|1|N (5CCB)
  • tRNA3Lys
  • X-RAY DIFFRACTION
  • Chain(s): N; model(s): 1
2.0 Å78(4) 5CCB|1|N, 5CCX|1|N, 5CD1|1|N, 5CD1|1|M
262NR_4.0_55964.1
Exact match
Lactobacillus rhamnosus
5D5L|1|D (5D5L)
  • PreQ1-II riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.5 Å76(4) 5D5L|1|D, 5D5L|1|A, 5D5L|1|B, 5D5L|1|C
263NR_4.0_56345.1
Exact match
Vibrio vulnificus
5E54|1|B (5E54)
  • Vibrio vulnificus strain 93U204 chromoso[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å68(4) 5E54|1|B, 5SWD|1|B, 5E54|1|A, 5SWD|1|A
264NR_4.0_06496.1
Exact match
Homo sapiens
5E6M|1|E (5E6M)
  • tRNA(Gly)
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.9 Å73(4) 5E6M|1|E, 4KR2|1|C, 4KR3|1|C, 5E6M|1|C
265NR_4.0_08138.1
Exact match
Homo sapiens
5F0Q|1|E (5F0Q)
  • RNA (5'-R(P*GP*GP*CP*GP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.2 Å5(4) 5F0Q|1|E, 5F0S|1|C, 5F0Q|1|C, 5F0S|1|E
266NR_4.0_20758.1
Exact match
synthetic construct
5F8H|1|B+5F8H|1|C (5F8H)
  • RNA (35-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B, C, L, O, P; model(s): 1
2.5 Å12(4) 5F8H|1|B+5F8H|1|C, 5F8J|1|B+5F8J|1|C, 5F8G|1|B+5F8G|1|C, 5F8I|1|B+5F8I|1|C
267NR_4.0_99969.1
Exact match
Taura syndrome virus
5JUP|1|EC (5JUP)
  • IRES
  • ELECTRON MICROSCOPY
  • Chain(s): EC; model(s): 1
3.5 Å198(4) 5JUP|1|EC, 5JUT|1|EC, 5JUO|1|EC, 5JUU|1|EC
268NR_4.0_73988.1
Exact match
Saccharomyces cerevisiae
5L2L|1|H (5L2L)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*G)[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
1.6 Å11(4) 5L2L|1|H, 5L2L|1|D, 5L2L|1|G, 5L2L|1|C
269NR_4.0_20305.2
Exact match
Spinacia oleracea
5MMI|1|A (5MMI)
  • 23S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.2 Å2798(4) 5MMI|1|A, 5MMM|1|A, 5MLC|1|A, 5H1S|1|A
270NR_4.0_50314.2
Exact match
Spinacia oleracea
5MMI|1|B (5MMI)
  • 5S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
3.2 Å121(4) 5MMI|1|B, 5MMM|1|B, 5MLC|1|B, 5H1S|1|B
271NR_4.0_05530.2
Exact match
Spinacia oleracea
5MMM|1|W (5MMM)
  • 4.5S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): W; model(s): 1
3.4 Å106(4) 5MMM|1|W, 5MLC|1|C, 5MMI|1|W, 5H1S|1|C
272NR_4.0_59689.3
Exact match
Vibrio vulnificus
5SWE|1|X (5SWE)
  • Vibrio vulnificus strain 93U204 chromoso[...]
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.0 Å71(4) 5SWE|1|X, 4TZY|1|X, 4TZX|1|X, 4XNR|1|X
273NR_4.0_42653.1
Exact match
5T16|1|P (5T16)
  • RNA substrate analog
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.8 Å33(4) 5T16|1|P, 5T16|1|G, 5T16|1|H, 5T16|1|O
274NR_4.0_88047.1
Exact match
unidentified
5UDI|1|B (5UDI)
  • RNA (5'-D(*(GTA))-R(P*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.6 Å3(4) 5UDI|1|B, 5UDK|1|B, 5UDL|1|B, 5UDJ|1|B
275NR_4.0_93599.1
Exact match
Homo sapiens
5UDZ|1|W (5UDZ)
  • let-7f-1 pre-element
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
2.0 Å23(4) 5UDZ|1|W, 5UDZ|1|V, 3TS0|1|U, 3TS0|1|V
276NR_4.0_63260.1
Exact match
165D|1|A+165D|1|B (165D)
  • DNA/RNA (5'-R(*GP*CP*UP*UP*CP*GP*GP*CP*)[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
1.6 Å8(3) 165D|1|A+165D|1|B, 1IDW|1|A+1IDW|1|B, 1IHA|1|A+1IHA|1|B
277NR_4.0_03710.1
Exact match
Escherichia coli
1EFW|1|D (1EFW)
  • ASPARTYL-TRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å63(3) 1EFW|1|D, 1EFW|1|C, 1C0A|1|B
278NR_4.0_23049.1
Exact match
1F7Y|1|B (1F7Y)
  • 16S RIBOSOMAL RNA FRAGMENT
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å60(3) 1F7Y|1|B, 1DK1|1|B, 1KUQ|1|B
279NR_4.0_61174.1
Exact match
Escherichia coli
1H2C|1|R (1H2C)
  • 5'-R(*UP*GP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
1.6 Å3(3) 1H2C|1|R, 1H2D|1|R, 1H2D|1|S
280NR_4.0_52295.1
Exact match
Escherichia coli
1O9M|1|A+1O9M|1|B (1O9M)
  • EUBACTERIAL A-SITE
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
2.4 Å21(3) 1O9M|1|A+1O9M|1|B, 2ET8|1|A+2ET8|1|B, 2F4U|1|A+2F4U|1|B
281NR_4.0_08416.1
Exact match
1QBP|1|E+1QBP|1|F (1QBP)
  • 5'-R(*UP*GP*(CBV)P*(CBV)P*AP*GP*UP*UP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): E, F, L, O, P; model(s): 1
2.1 Å13(3) 1QBP|1|E+1QBP|1|F, 1QBP|1|A+1QBP|1|B, 1QBP|1|C+1QBP|1|D
282NR_4.0_03715.1
Exact match
Staphylococcus aureus
1QU2|1|T (1QU2)
  • ISOLEUCYL-TRNA
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.2 Å75(3) 1QU2|1|T, 1FFY|1|T, 1QU3|1|T
283NR_4.0_99363.1
Exact match
1SA9|1|E (1SA9)
  • 5'-R(*GP*GP*CP*GP*AP*GP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.9 Å8(3) 1SA9|1|E, 1SA9|1|A+1SA9|1|B, 1SA9|1|C+1SA9|1|D
284NR_4.0_16422.1
Exact match
1SAQ|1|E (1SAQ)
  • 5'-R(*GP*IP*CP*GP*AP*GP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.7 Å7(3) 1SAQ|1|E, 1SAQ|1|A+1SAQ|1|B, 1SAQ|1|C+1SAQ|1|D
285NR_4.0_73551.1
Exact match
1SDS|1|F (1SDS)
  • box H/ACA sRNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
1.8 Å15(3) 1SDS|1|F, 1SDS|1|D, 1SDS|1|E
286NR_4.0_79612.1
Exact match
1UVI|1|F (1UVI)
  • 5'-R(*UP*UP*UP*UP*CP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.2 Å4(3) 1UVI|1|F, 1UVI|1|D, 1UVI|1|E
287NR_4.0_81635.1
Exact match
1UVJ|1|F (1UVJ)
  • 5'-R(*UP*UP*CP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
1.9 Å4(3) 1UVJ|1|F, 1UVJ|1|D, 1UVJ|1|E
288NR_4.0_96572.1
Exact match
1UVL|1|F (1UVL)
  • 5'-R(*UP*UP*UP*CP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.0 Å5(3) 1UVL|1|F, 1UVL|1|B, 1UVL|1|D
289NR_4.0_95409.1
Exact match
1UVM|1|F (1UVM)
  • 5'-R(*UP*UP*UP*CP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.0 Å5(3) 1UVM|1|F, 1UVM|1|D, 1UVM|1|E
290NR_4.0_31949.1
Exact match
1UVN|1|F (1UVN)
  • 5'-R(*UP*UP*UP*UP*CP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.0 Å4(3) 1UVN|1|F, 1UVN|1|B, 1UVN|1|D
291NR_4.0_42126.1
Exact match
2B3J|1|E (2B3J)
  • anticodon stem-loop of t-RNA-Arg2 (nucle[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.0 Å14(3) 2B3J|1|E, 2B3J|1|H, 2B3J|1|F
292NR_4.0_29524.1
Exact match
2J0S|1|E (2J0S)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP *UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.2 Å6(3) 2J0S|1|E, 2J0Q|1|E, 2J0Q|1|H
293NR_4.0_47665.1
Exact match
synthetic construct
2JA7|1|6 (2JA7)
  • 5'-R(*UP*UP*CP*GP*AP*CP*CP*AP*GP*GP*AP)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6; model(s): 1
3.8 Å10(3) 2JA7|1|6, 2JA7|1|3, 2JA5|1|P
294NR_4.0_83080.1
Exact match
2QWY|1|C (2QWY)
  • SAM-II riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å52(3) 2QWY|1|C, 2QWY|1|A, 2QWY|1|B
295NR_4.0_58167.1
Exact match
3E5C|1|A (3E5C)
  • SMK box (SAM-III) Riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å52(3) 3E5C|1|A, 3E5F|1|A, 3E5E|1|A
296NR_4.0_68503.1
Exact match
3F4H|1|Y+3F4H|1|X (3F4H)
  • FMN riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): L, O, P, X, Y; model(s): 1
3.0 Å56(3) 3F4H|1|Y+3F4H|1|X, 3F4E|1|Y+3F4E|1|X, 2YIF|1|Z+2YIF|1|X
297NR_4.0_81896.1
Exact match
3GLP|1|E (3GLP)
  • 5'-R(*GP*CP*UP*GP*CP*UP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.2 Å8(3) 3GLP|1|E, 3GLP|1|B+3GLP|1|A, 3GLP|1|C+3GLP|1|D
298NR_4.0_92727.1
Exact match
3K49|1|F (3K49)
  • RNA (5'-R(*CP*CP*UP*GP*UP*AP*AP*AP*UP*A)[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.5 Å10(3) 3K49|1|F, 3K49|1|B, 3K49|1|D
299NR_4.0_06376.1
Exact match
3K4E|1|F (3K4E)
  • RNA (5'-R(P*CP*UP*UP*GP*UP*AP*UP*AP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.2 Å10(3) 3K4E|1|F, 3K4E|1|B, 3K4E|1|D
300NR_4.0_53884.1
Exact match
3O7V|1|A (3O7V)
  • RNA (5'-R(*GP*CP*GP*AP*AP*UP*AP*UP*UP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.1 Å13(3) 3O7V|1|A, 3O3I|1|A, 3O6E|1|A
301NR_4.0_40560.1
Exact match
3OIN|1|C (3OIN)
  • 5'-R(*GP*GP*GP*CP*UP*UP*CP*AP*AP*CP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.9 Å14(3) 3OIN|1|C, 3OIJ|1|C, 3OIJ|1|D
302NR_4.0_47162.1
Exact match
Bacillus subtilis
3PDR|1|A (3PDR)
  • M-box Riboswitch RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.9 Å161(3) 3PDR|1|A, 2QBZ|1|X, 3PDR|1|X
303NR_4.0_81724.1
Exact match
3Q0N|1|D (3Q0N)
  • 5'-R(UP*GP*UP*AP*CP*AP*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å7(3) 3Q0N|1|D, 3Q0O|1|C, 3Q0O|1|D
304NR_4.0_54128.1
Exact match
3Q0R|1|B (3Q0R)
  • 5'-R(UP*GP*UP*AP*GP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å8(3) 3Q0R|1|B, 3Q0M|1|C, 3Q0M|1|D
305NR_4.0_89202.1
Exact match
3Q50|1|A (3Q50)
  • PREQ1 RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å33(3) 3Q50|1|A, 3Q51|1|A, 3GCA|1|A
306NR_4.0_68171.1
Exact match
3R1C|1|i+3R1C|1|j (3R1C)
  • RNA (5'-R(*GP*CP*GP*GP*CP*GP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): L, O, P, i, j; model(s): 1
2.1 Å8(3) 3R1C|1|i+3R1C|1|j, 3R1C|1|g+3R1C|1|h, 3R1C|1|E+3R1C|1|F
307NR_4.0_10541.1
Exact match
3S1R|1|R (3S1R)
  • RNA (5'-R(*AP*GP*AP*GP*G*)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.2 Å5(3) 3S1R|1|R, 3RZD|1|R, 3S1Q|1|R
308NR_4.0_20814.1
Exact match
[Eubacterium] siraeum
3SUX|1|X (3SUX)
  • Riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.9 Å100(3) 3SUX|1|X, 3SUH|1|X, 3SUY|1|X
309NR_4.0_45159.1
Exact match
3SYW|1|A+3SYW|1|B (3SYW)
  • RNA (5'-R(*UP*UP*GP*GP*GP*CP*CP*UP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
1.6 Å21(3) 3SYW|1|A+3SYW|1|B, 4YN6|1|A+4YN6|1|B, 4J50|1|A+4J50|1|B
310NR_4.0_66740.1
Exact match
Escherichia coli
3T5N|1|C (3T5N)
  • RNA (5'-R(P*UP*AP*UP*CP*UP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.8 Å6(3) 3T5N|1|C, 3T5Q|1|H, 3T5Q|1|L
311NR_4.0_18396.1
Exact match
synthetic construct
3ZC0|1|O (3ZC0)
  • 5'-R(*UP*UP*CP*GP*AP*CP*GP*CP*GP*UP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): O; model(s): 1
3.0 Å28(3) 3ZC0|1|O, 3ZC0|1|M, 3ZC0|1|N
312NR_4.0_57688.1
Exact match
409D|1|E+409D|1|F (409D)
  • RNA (5'-R(*CP*CP*CP*IP*UP*GP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): E, F, L, O, P; model(s): 1
2.5 Å7(3) 409D|1|E+409D|1|F, 409D|1|A+409D|1|B, 409D|1|C+409D|1|D
313NR_4.0_37735.1
Exact match
437D|1|A (437D)
  • RNA PSEUDOKNOT
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.6 Å32(3) 437D|1|A, 1L3D|1|A, 1L2X|1|A
314NR_4.0_54480.1
Exact match
4G7O|1|S (4G7O)
  • 5'-R(*GP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): S; model(s): 1
3.0 Å2(3) 4G7O|1|S, 4G7O|1|I, 5UH6|1|I
315NR_4.0_02622.1
Exact match
4GHA|1|I+4GHA|1|J (4GHA)
  • RNA (5'-R(*CP*UP*AP*GP*AP*CP*GP*UP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): I, J, L, O, P; model(s): 1
2.5 Å12(3) 4GHA|1|I+4GHA|1|J, 4LG2|1|I+4LG2|1|J, 4LG2|1|E+4LG2|1|F
316NR_4.0_85566.1
Exact match
4GV3|1|C+4GV3|1|B (4GV3)
  • RNA (5'-R(P*CP*GP*CP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B, C, L, O, P; model(s): 1
1.7 Å4(3) 4GV3|1|C+4GV3|1|B, 4GV9|1|F+4GV9|1|E, 4GV6|1|C+4GV6|1|B
317NR_4.0_73115.1
Exact match
Homo sapiens
4HT9|1|D (4HT9)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.8 Å7(3) 4HT9|1|D, 4HT8|1|I, 4HT8|1|K
318NR_4.0_88706.1
Exact match
synthetic construct
4JAH|1|E+4JAH|1|F (4JAH)
  • RNA (5'-R(*GP*UP*GP*UP*AP*(RUS)P*AP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): E, F, L, O, P; model(s): 1
1.5 Å7(3) 4JAH|1|E+4JAH|1|F, 4JAH|1|A+4JAH|1|B, 4JAH|1|C+4JAH|1|D
319NR_4.0_25361.2
Exact match
4JNX|1|B+4JNX|1|G (4JNX)
  • 5'-R(P*GP*CP*UP*GP*CP*UP*GP*CP*UP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, G, L, O, P; model(s): 1
2.0 Å39(3) 4JNX|1|B+4JNX|1|G, 4E48|1|A+4E48|1|B, 4E48|1|D
320NR_4.0_09443.2
Exact match
4K4S|1|B+4K4S|1|F+4K4S|1|C+4K4S|1|G+4K4S|1|D+4K4S|1|H (4K4S)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H; model(s): 1
2.4 Å17(3) 4K4S|1|B+4K4S|1|F+4K4S|1|C+4K4S|1|G+4K4S|1|D+4K4S|1|H, 4K4T|1|B+4K4T|1|C+4K4T|1|D, 4K4T|1|F+4K4T|1|G+4K4T|1|H
321NR_4.0_48777.1
Exact match
4NKU|1|H (4NKU)
  • 5'-R(*AP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
1.9 Å2(3) 4NKU|1|H, 4NKU|1|D, 1CWP|1|E
322NR_4.0_50478.2
Exact match
4OHY|1|B (4OHY)
  • RNA (5'-R(*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å2(3) 4OHY|1|B, 4OI1|1|B, 4OI0|1|B
323NR_4.0_33558.1
Exact match
Endothia gyrosa
4PCO|1|E (4PCO)
  • RNA (5'-D(*GP*GP*UP*GP*GP*CP*UP*GP*UP*U)[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.3 Å16(3) 4PCO|1|E, 4PCO|1|A+4PCO|1|B, 4PCO|1|C+4PCO|1|D
324NR_4.0_37008.1
Exact match
Homo sapiens
4PLX|1|A (4PLX)
  • Core ENE hairpin and A-rich tract from M[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å74(3) 4PLX|1|A, 4PLX|1|B, 4PLX|1|C
325NR_4.0_91665.2
Exact match
4QCL|1|B (4QCL)
  • RNA PRIMER
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å10(3) 4QCL|1|B, 4Q5V|1|B, 4Q5V|1|F
326NR_4.0_05707.1
Exact match
4QJH|1|F (4QJH)
  • Twister Ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.9 Å47(3) 4QJH|1|F, 4QJH|1|B, 4QJH|1|D
327NR_4.0_22602.1
Exact match
synthetic construct
4QU7|1|X (4QU7)
  • RNA 5'-(*AP*GP*GP*GP*AP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.5 Å3(3) 4QU7|1|X, 4QU7|1|V, 4QU7|1|U
328NR_4.0_53105.1
Exact match
Pyrococcus horikoshii
4UYK|1|R (4UYK)
  • SRP RNA
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.2 Å133(3) 4UYK|1|R, 4UYJ|1|S, 4UYJ|1|R
329NR_4.0_02491.1
Exact match
4V6E|1|CX (4V6E)
  • P-site tRNA ASL fragment
  • X-RAY DIFFRACTION
  • Chain(s): CX; model(s): 1
3.7 Å17(3) 4V6E|1|CX, 4V6E|1|AX, 4V6E|1|CV
330NR_4.0_27096.1
Exact match
Bacillus subtilis
4WFL|1|A (4WFL)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.5 Å105(3) 4WFL|1|A, 4WFM|1|B, 4WFM|1|A
331NR_4.0_50058.1
Exact match
synthetic construct
4WTF|1|T+4WTF|1|P (4WTF)
  • RNA PRIMER TEMPLATE CAAAAUUU
  • X-RAY DIFFRACTION
  • Chain(s): C, D, G, H, P, T; model(s): 1
2.7 Å8(3) 4WTF|1|T+4WTF|1|P, 4WTA|1|T+4WTA|1|P, 4WTG|1|T+4WTG|1|P
332NR_4.0_14903.1
Exact match
Methanococcus maripaludis
4Z7L|1|I (4Z7L)
  • RNA (5'-R(*GP*CP*AP*AP*AP*AP*UP*AP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
3.5 Å14(3) 4Z7L|1|I, 4Z7L|1|C, 4Z7L|1|F
333NR_4.0_90160.2
Exact match
synthetic construct
5B2P|1|B (5B2P)
  • Guide RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.7 Å93(3) 5B2P|1|B, 5B2O|1|B, 5B2Q|1|B
334NR_4.0_25771.1
Exact match
Escherichia coli
5D0A|1|F (5D0A)
  • RNA (5'-R(*G*CP*AP*GP*AP*CP*UP*GP*UP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.1 Å14(3) 5D0A|1|F, 5D0A|1|E, 5T8Y|1|X
335NR_4.0_34346.1
Exact match
synthetic construct
5D8T|1|A+5D8T|1|B (5D8T)
  • RNA oligonucleotide containing (S)-C5'-M[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, G, H; model(s): 1
1.2 Å6(3) 5D8T|1|A+5D8T|1|B, 5DER|1|A+5DER|1|B, 5DER|1|C+5DER|1|D
336NR_4.0_70098.1
Exact match
synthetic construct
5DEA|1|A (5DEA)
  • sc1
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å35(3) 5DEA|1|A, 5DE8|1|A, 5DE5|1|A
337NR_4.0_02963.1
Exact match
synthetic construct
5DEA|1|C (5DEA)
  • sc1
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å35(3) 5DEA|1|C, 5DE8|1|C, 5DE5|1|C
338NR_4.0_84026.1
Exact match
synthetic construct
5DHB|1|C+5DHB|1|D (5DHB)
  • RNA (5'-R(*(LCC)P*(TLN)P*(LCG)P*UP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, G, H; model(s): 1
1.8 Å4(3) 5DHB|1|C+5DHB|1|D, 5DHB|1|A+5DHB|1|B, 5HBW|1|A+5HBW|1|B
339NR_4.0_54107.1
Exact match
Saccharomyces cerevisiae
5ED1|1|C+5ED1|1|B (5ED1)
  • RNA (5'-R(*GP*AP*CP*UP*GP*AP*AP*CP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, G, H; model(s): 1
2.8 Å23(3) 5ED1|1|C+5ED1|1|B, 5HP3|1|C+5HP3|1|B, 5HP2|1|C+5HP2|1|B
340NR_4.0_16758.1
Exact match
Mus musculus
5F5F|1|H (5F5F)
  • RNA (5'-R(P*UP*GP*AP*CP*UP*GP*CP*GP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.0 Å20(3) 5F5F|1|H, 5F5F|1|B, 5F5F|1|D
341NR_4.0_17122.2
Exact match
synthetic construct
5FLM|1|P (5FLM)
  • RNA, DNA-RNA ELONGATION SCAFFOLD
  • ELECTRON MICROSCOPY
  • Chain(s): P; model(s): 1
3.4 Å14(3) 5FLM|1|P, 5M5X|1|R, 5M3F|1|R
342NR_4.0_51660.2
Exact match
Escherichia coli
5GAD|1|1 (5GAD)
  • ESRP 4.5S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 1; model(s): 1
3.7 Å43(3) 5GAD|1|1, 5GAH|1|1, 5GAG|1|1
343NR_4.0_69813.2
Exact match
Escherichia coli
5IBB|1|3L (5IBB)
  • tRNAVal
  • X-RAY DIFFRACTION
  • Chain(s): 3L; model(s): 1
3.0 Å71(3) 5IBB|1|3L, 5IBB|1|1K, 5IBB|1|3K
344NR_4.0_23087.1
Exact match
synthetic construct
5K7C|1|A (5K7C)
  • RNA 47-MER
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å47(3) 5K7C|1|A, 5K7D|1|A, 5K7E|1|A
345NR_4.0_08470.1
Exact match
Saccharomyces cerevisiae
5MRC|1|A (5MRC)
  • 21S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.3 Å2709(3) 5MRC|1|A, 5MRE|1|A, 3J6B|1|A
346NR_4.0_92635.1
Exact match
synthetic construct
5SUP|1|F (5SUP)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.6 Å6(3) 5SUP|1|F, 5SUP|1|D, 5SUP|1|E
347NR_4.0_48402.4
Exact match
Homo sapiens
5T2C|1|B (5T2C)
  • 5S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
3.6 Å120(3) 5T2C|1|B, 5AJ0|1|A4, 5LKS|1|L7
348NR_4.0_60469.1
Exact match
Saccharomyces cerevisiae
5TF6|1|B (5TF6)
  • U6 snRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å71(3) 5TF6|1|B, 4N0T|1|B, 5TF6|1|D
349NR_4.0_56118.3
Exact match
Saccharomyces cerevisiae
5WSG|1|E (5WSG)
  • Saccharomyces cerevisiae S288c SNR6 snRN[...]
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
4.0 Å103(3) 5WSG|1|E, 5MPS|1|6, 5GMK|1|E+5GMK|1|L
350NR_4.0_89332.1
Exact match
Homo sapiens
1A9N|1|R (1A9N)
  • RNA (5'-R(*CP*CP*UP*GP*GP*UP*AP*UP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.4 Å24(2) 1A9N|1|R, 1A9N|1|Q
351NR_4.0_68428.1
Exact match
1D4R|1|C (1D4R)
  • 29-MER OF MODIFIED SRP RNA HELIX 6
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.0 Å28(2) 1D4R|1|C, 1D4R|1|B+1D4R|1|A
352NR_4.0_43622.1
Exact match
Homo sapiens
1E7K|1|D (1E7K)
  • RNA (5'-R(*GP*CP*CP*AP*AP*UP*GP*AP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.9 Å17(2) 1E7K|1|D, 1E7K|1|C
353NR_4.0_62068.1
Exact match
1EGK|1|C (1EGK)
  • RNA (5'-R(*AP*GP*GP*AP*GP*AP*GP*AP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.1 Å20(2) 1EGK|1|C, 1EGK|1|A
354NR_4.0_82534.1
Exact match
1F7V|1|B (1F7V)
  • TRNA(ARG)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å60(2) 1F7V|1|B, 1F7U|1|B
355NR_4.0_99953.1
Exact match
1FEU|1|F+1FEU|1|E (1FEU)
  • 21 NT FRAGMENT OF 5S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, G, H; model(s): 1
2.3 Å21(2) 1FEU|1|F+1FEU|1|E, 1FEU|1|C+1FEU|1|B
356NR_4.0_14518.1
Exact match
1FUF|1|A+1FUF|1|B (1FUF)
  • (5'-R(*GP*GP*UP*AP*UP*UP*UP*CP*GP*GP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, G, H; model(s): 1
1.7 Å13(2) 1FUF|1|A+1FUF|1|B, 1IK5|1|A+1IK5|1|B
357NR_4.0_26284.1
Exact match
Thermus thermophilus
1H4S|1|T (1H4S)
  • TRNAPRO(CGG)
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.9 Å65(2) 1H4S|1|T, 1H4Q|1|T
358NR_4.0_55907.2
Exact match
1HMH|1|E (1HMH)
  • HAMMERHEAD RIBOZYME-RNA STRAND
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.6 Å34(2) 1HMH|1|E, 1HMH|1|C
359NR_4.0_49782.1
Exact match
1I6U|1|C (1I6U)
  • 16S RRNA FRAGMENT
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.6 Å37(2) 1I6U|1|C, 1I6U|1|D
360NR_4.0_86520.1
Exact match
1ICG|1|A+1ICG|1|B (1ICG)
  • 5'-R(*GP*CP*UP*UP*CP*GP*GP*C)-D(P*(UFP))[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, G, H; model(s): 1
1.5 Å8(2) 1ICG|1|A+1ICG|1|B, 1ID9|1|A+1ID9|1|B
361NR_4.0_52282.1
Exact match
1J2B|1|C (1J2B)
  • tRNA(Val)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.3 Å77(2) 1J2B|1|C, 1J2B|1|D
362NR_4.0_41566.1
Exact match
1J8G|1|B (1J8G)
  • 5'-R(*UP*GP*GP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
0.6 Å6(2) 1J8G|1|B, 4RKV|1|B
363NR_4.0_16983.1
Exact match
1J9H|1|C+1J9H|1|D (1J9H)
  • 5'-R(*GP*UP*GP*UP*CP*GP*(CBR)P*AP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C, D, G, H; model(s): 1
1.4 Å8(2) 1J9H|1|C+1J9H|1|D, 1J9H|1|A+1J9H|1|B
364NR_4.0_19241.1
Exact match
1JZV|1|D+1JZV|1|C (1JZV)
  • 5'-R(*CP*AP*GP*UP*AP*CP*GP*(5IC)P*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C, D, G, H; model(s): 1
1.7 Å8(2) 1JZV|1|D+1JZV|1|C, 1JZV|1|B+1JZV|1|A
365NR_4.0_03986.1
Exact match
1KD5|1|A+1KD5|1|B (1KD5)
  • 5'-R(*GP*GP*UP*CP*AP*CP*AP*GP*CP*CP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, G, H; model(s): 1
1.6 Å11(2) 1KD5|1|A+1KD5|1|B, 1KD3|1|A+1KD3|1|B
366NR_4.0_54586.1
Exact match
1L3Z|1|B (1L3Z)
  • 5'-R(*GP*UP*AP*UP*AP*CP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å7(2) 1L3Z|1|B, 1L3Z|1|A
367NR_4.0_81068.1
Exact match
1M8X|1|C (1M8X)
  • 5'-R(P*UP*UP*GP*UP*AP*UP*AP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.2 Å8(2) 1M8X|1|C, 1M8W|1|C
368NR_4.0_48641.1
Exact match
1M8X|1|D (1M8X)
  • 5'-R(P*UP*GP*UP*AP*UP*AP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.2 Å7(2) 1M8X|1|D, 1M8W|1|D
369NR_4.0_81175.1
Exact match
1M8Y|1|D (1M8Y)
  • 5'-R(P*AP*UP*UP*GP*UP*AP*CP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.6 Å10(2) 1M8Y|1|D, 1M8Y|1|C
370NR_4.0_62367.1
Exact match
Escherichia coli
1MJI|1|C (1MJI)
  • 5S rRNA fragment
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.5 Å34(2) 1MJI|1|C, 1MJI|1|D
371NR_4.0_74849.1
Exact match
1MMS|1|D (1MMS)
  • 23S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.6 Å58(2) 1MMS|1|D, 1MMS|1|C
372NR_4.0_20339.1
Exact match
Bacillus subtilis
1NBS|1|B (1NBS)
  • RIBONUCLEASE P RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.2 Å150(2) 1NBS|1|B, 1NBS|1|A
373NR_4.0_85104.1
Exact match
1NJP|1|5 (1NJP)
  • tRNA acceptor stem mimic
  • X-RAY DIFFRACTION
  • Chain(s): 5; model(s): 1
3.5 Å24(2) 1NJP|1|5, 1NJM|1|5
374NR_4.0_74199.1
Exact match
1NTB|1|A+1NTB|1|B (1NTB)
  • 5'-R(*GP*GP*AP*UP*CP*GP*CP*AP*UP*UP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, G, H; model(s): 1
2.9 Å22(2) 1NTB|1|A+1NTB|1|B, 1NTA|1|A+1NTA|1|B
375NR_4.0_55924.2
Exact match
1OOA|1|D (1OOA)
  • RNA aptamer
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.5 Å29(2) 1OOA|1|D, 1OOA|1|C
376NR_4.0_47370.1
Exact match
1P6V|1|B (1P6V)
  • 45-MER
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.2 Å45(2) 1P6V|1|B, 1P6V|1|D
377NR_4.0_80055.1
Exact match
1RLG|1|D (1RLG)
  • 25-MER
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.7 Å22(2) 1RLG|1|D, 1RLG|1|C
378NR_4.0_81475.1
Exact match
1SDR|1|C+1SDR|1|D (1SDR)
  • RNA (5'-R(*UP*AP*AP*GP*GP*AP*GP*GP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, G, H; model(s): 1
2.6 Å12(2) 1SDR|1|C+1SDR|1|D, 1SDR|1|A+1SDR|1|B
379NR_4.0_19147.1
Exact match
1T0D|1|C+1T0D|1|D (1T0D)
  • 5'-R(*GP*GP*UP*GP*GP*UP*GP*(MTU)P*AP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, G, H; model(s): 1
2.2 Å16(2) 1T0D|1|C+1T0D|1|D, 1T0D|1|A+1T0D|1|B
380NR_4.0_65598.1
Exact match
1TFW|1|I+1TFW|1|F (1TFW)
  • 5'-R(*GP*CP*GP*GP*AP*UP*CP*CP*GP*CP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, G, H, I; model(s): 1
2.2 Å13(2) 1TFW|1|I+1TFW|1|F, 1TFW|1|H+1TFW|1|E
381NR_4.0_03202.1
Exact match
1TFY|1|I+1TFY|1|F (1TFY)
  • 5'-R(*GP*CP*GP*GP*AP*UP*AP*UP*CP*CP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, G, H, I; model(s): 1
3.2 Å14(2) 1TFY|1|I+1TFY|1|F, 1TFY|1|H+1TFY|1|E
382NR_4.0_13485.1
Exact match
1U1Y|1|R (1U1Y)
  • 5'-R(*CP*CP*GP*GP*(2PR)P*GP*GP*AP*UP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.9 Å16(2) 1U1Y|1|R, 1U1Y|1|S
383NR_4.0_23978.1
Exact match
1U63|1|D (1U63)
  • 49 NT FRAGMENT OF MRNA FOR L1
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.4 Å49(2) 1U63|1|D, 1U63|1|B
384NR_4.0_75381.1
Exact match
Xenopus laevis
1UN6|1|F (1UN6)
  • 5S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.1 Å61(2) 1UN6|1|F, 1UN6|1|E
385NR_4.0_22775.2
Exact match
1URN|1|Q (1URN)
  • RNA (5'-R(*AP*AP*UP*CP*CP*AP*UP*UP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
1.9 Å21(2) 1URN|1|Q, 1URN|1|R
386NR_4.0_19039.1
Exact match
1WPU|1|D (1WPU)
  • 5'-R(*UP*UP*GP*AP*GP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.5 Å7(2) 1WPU|1|D, 1WPU|1|C
387NR_4.0_46102.1
Exact match
1WZ2|1|D (1WZ2)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.2 Å88(2) 1WZ2|1|D, 1WZ2|1|C
388NR_4.0_99632.1
Exact match
Saccharomyces cerevisiae
1YFG|1|A (1YFG)
  • YEAST INITIATOR TRNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å64(2) 1YFG|1|A, 3J81|1|1
389NR_4.0_45851.1
Exact match
1YTU|1|E+1YTU|1|F (1YTU)
  • 5'-R(P*AP*GP*AP*CP*AP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, G, H; model(s): 1
2.5 Å6(2) 1YTU|1|E+1YTU|1|F, 1YTU|1|C+1YTU|1|D
390NR_4.0_65678.1
Exact match
1YVP|1|E+1YVP|1|F (1YVP)
  • Y RNA sequence, first strand
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, G, H; model(s): 1
2.2 Å9(2) 1YVP|1|E+1YVP|1|F, 1YVP|1|C+1YVP|1|D
391NR_4.0_74336.1
Exact match
1ZBH|1|F (1ZBH)
  • 5'-R(*CP*CP*GP*GP*CP*UP*CP*UP*UP*UP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.0 Å16(2) 1ZBH|1|F, 1ZBH|1|E
392NR_4.0_93523.1
Exact match
1ZBI|1|C (1ZBI)
  • 5'-R(*GP*AP*CP*AP*CP*CP*UP*GP*AP*UP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.9 Å12(2) 1ZBI|1|C, 1ZBL|1|C
393NR_4.0_53827.1
Exact match
1ZDJ|1|S (1ZDJ)
  • RNA (5'-R(*GP*GP*AP*UP*CP*AP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): S; model(s): 1
2.9 Å8(2) 1ZDJ|1|S, 1ZDJ|1|R
394NR_4.0_72030.1
Exact match
1ZH5|1|C+1ZH5|1|D (1ZH5)
  • 5'-R(*UP*GP*CP*UP*GP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C, D, G, H; model(s): 1
1.9 Å9(2) 1ZH5|1|C+1ZH5|1|D, 1YTY|1|C+1YTY|1|D
395NR_4.0_87784.1
Exact match
1ZX7|1|C+1ZX7|1|E+1ZX7|1|D+1ZX7|1|F (1ZX7)
  • 5'-R(*GP*UP*GP*GP*UP*GP*AP*AP*GP*UP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, H; model(s): 1
2.2 Å15(2) 1ZX7|1|C+1ZX7|1|E+1ZX7|1|D+1ZX7|1|F, 1ZX7|1|A+1ZX7|1|G+1ZX7|1|B+1ZX7|1|H
396NR_4.0_47105.1
Exact match
217D|1|A (217D)
  • DNA/RNA (5'-D(*IP*)-R(*CP*)-D(*IP*)-R(*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.7 Å2(2) 217D|1|A, 216D|1|A
397NR_4.0_49362.3
Exact match
280D|1|C+280D|1|D (280D)
  • RNA (5'-R(*GP*GP*CP*GP*CP*UP*UP*GP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, H; model(s): 1
2.4 Å12(2) 280D|1|C+280D|1|D, 280D|1|A+280D|1|B
398NR_4.0_33604.1
Exact match
2A04|1|A+2A04|1|C+2A04|1|B+2A04|1|D (2A04)
  • 5'-R(*GP*UP*GP*GP*UP*GP*AP*AP*GP*UP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, H; model(s): 1
3.0 Å15(2) 2A04|1|A+2A04|1|C+2A04|1|B+2A04|1|D, 1ZZ5|1|A+1ZZ5|1|C+1ZZ5|1|B+1ZZ5|1|D
399NR_4.0_52699.1
Exact match
Bos taurus
2AKE|1|B (2AKE)
  • transfer RNA-Trp
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.1 Å72(2) 2AKE|1|B, 2DR2|1|B
400NR_4.0_36231.1
Exact match
2ANR|1|B (2ANR)
  • 5'-R(*CP*(5BU)P*CP*GP*CP*GP*GP*AP*UP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å24(2) 2ANR|1|B, 2ANN|1|B
401NR_4.0_53890.1
Exact match
2AO5|1|C+2AO5|1|D (2AO5)
  • 5'-R(*GP*GP*CP*GP*(5BU)P*GP*CP*GP*CP*U)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, H; model(s): 1
2.1 Å9(2) 2AO5|1|C+2AO5|1|D, 2AO5|1|A+2AO5|1|B
402NR_4.0_28532.1
Exact match
2ATW|1|D (2ATW)
  • ribosomal RNA (5'- AGAACUCAAUAG -3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.3 Å12(2) 2ATW|1|D, 2ATW|1|B
403NR_4.0_93219.1
Exact match
2AZ2|1|C+2AZ2|1|D (2AZ2)
  • 5'-R(*GP*CP*AP*(5BU)P*GP*GP*AP*CP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, H; model(s): 1
2.6 Å15(2) 2AZ2|1|C+2AZ2|1|D, 2AZ0|1|C+2AZ0|1|D
404NR_4.0_98033.1
Exact match
2AZX|1|C (2AZX)
  • 72-MER
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å72(2) 2AZX|1|C, 2AZX|1|D
405NR_4.0_57734.1
Exact match
2BGG|1|R+2BGG|1|S (2BGG)
  • 5'-R(*UP*UP*CP*GP*AP*CP*GP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, D, H, R, S; model(s): 1
2.2 Å8(2) 2BGG|1|R+2BGG|1|S, 2BGG|1|P+2BGG|1|Q
406NR_4.0_03525.1
Exact match
Escherichia coli
2BH2|1|D (2BH2)
  • 23S RIBOSOMAL RNA 1932-1968
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.2 Å29(2) 2BH2|1|D, 2BH2|1|C
407NR_4.0_62940.1
Exact match
2D6F|1|F (2D6F)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.2 Å74(2) 2D6F|1|F, 2D6F|1|E
408NR_4.0_53841.1
Exact match
2E9T|1|E+2E9T|1|F (2E9T)
  • 5'-R(P*UP*AP*GP*GP*GP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, H; model(s): 1
2.6 Å8(2) 2E9T|1|E+2E9T|1|F, 2E9T|1|B+2E9T|1|C
409NR_4.0_16755.1
Exact match
2EC0|1|E+2EC0|1|F (2EC0)
  • 5'-R(P*AP*UP*GP*GP*GP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, H; model(s): 1
2.8 Å8(2) 2EC0|1|E+2EC0|1|F, 2EC0|1|B+2EC0|1|C
410NR_4.0_82951.1
Exact match
2F4S|1|A+2F4S|1|B (2F4S)
  • 5'-R(P*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
2.8 Å21(2) 2F4S|1|A+2F4S|1|B, 2O3X|1|A+2O3X|1|B
411NR_4.0_31791.1
Exact match
2FZ2|1|D (2FZ2)
  • 5'-R(*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.9 Å3(2) 2FZ2|1|D, 2XPJ|1|D
412NR_4.0_54661.1
Exact match
2GJW|1|I+2GJW|1|J+2GJW|1|L (2GJW)
  • 5'-R(*GP*CP*GP*AP*CP*CP*GP*AP*CP*CP*AP*([...]
  • X-RAY DIFFRACTION
  • Chain(s): D, H, I, J, L; model(s): 1
2.9 Å18(2) 2GJW|1|I+2GJW|1|J+2GJW|1|L, 2GJW|1|E+2GJW|1|F+2GJW|1|H
413NR_4.0_19413.1
Exact match
2I91|1|F+2I91|1|E (2I91)
  • 5'-R(*C*GP*GP*UP*AP*GP*GP*CP*UP*UP*UP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, H, L; model(s): 1
2.7 Å15(2) 2I91|1|F+2I91|1|E, 2I91|1|D+2I91|1|C
414NR_4.0_47156.1
Exact match
2IL9|1|M (2IL9)
  • Ribosomal Binding Domain of the IRES RNA
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
3.1 Å132(2) 2IL9|1|M, 2IL9|1|A
415NR_4.0_75028.1
Exact match
Enterobacteria phage MS2
2IZN|1|R (2IZN)
  • 5'-R(*AP*CP*AP*UP*CP*GP*CP*GP*AP*UP *UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.6 Å15(2) 2IZN|1|R, 2IZN|1|S
416NR_4.0_59755.1
Exact match
2JLW|1|D (2JLW)
  • 5'-R(*UP*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.6 Å7(2) 2JLW|1|D, 2JLW|1|C
417NR_4.0_19218.1
Exact match
2NVT|1|R (2NVT)
  • 5'-R(*AP*AP*GP*AP*CP*CP*AP*GP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.4 Å10(2) 2NVT|1|R, 1Y1W|1|P
418NR_4.0_75945.1
Exact match
2OE8|1|B+2OE8|1|A (2OE8)
  • RNA (5'-R(*CP*GP*GP*UP*AP*CP*UP*AP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H, L; model(s): 1
1.8 Å17(2) 2OE8|1|B+2OE8|1|A, 2OE6|1|B+2OE6|1|A
419NR_4.0_22747.1
Exact match
2OZB|1|C (2OZB)
  • RNA comprising the 5' Stem-Loop RNA of [...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.6 Å33(2) 2OZB|1|C, 2OZB|1|F
420NR_4.0_83079.1
Exact match
2P7E|1|A (2P7E)
  • 5' substrate strand, pentameric fragment
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.1 Å5(2) 2P7E|1|A, 2P7D|1|A
421NR_4.0_64649.1
Exact match
2PY9|1|F (2PY9)
  • 12-mer C-rich strand of human telomeric [...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.6 Å12(2) 2PY9|1|F, 2PY9|1|E
422NR_4.0_43749.1
Exact match
2Q1O|1|C+2Q1O|1|D (2Q1O)
  • RNA (5'-R(*CP*GP*CP*(NF2)P*AP*AP*UP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H, L; model(s): 1
1.1 Å11(2) 2Q1O|1|C+2Q1O|1|D, 2Q1O|1|A+2Q1O|1|B
423NR_4.0_17726.1
Exact match
2Q1R|1|A (2Q1R)
  • RNA (5'-R(*CP*GP*CP*GP*AP*AP*UP*UP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å12(2) 2Q1R|1|A, 157D|1|A+157D|1|B
424NR_4.0_40252.1
Exact match
2QUS|1|B (2QUS)
  • Hammerhead ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å68(2) 2QUS|1|B, 2QUS|1|A
425NR_4.0_36634.1
Exact match
2QUW|1|B (2QUW)
  • Hammerhead ribozyme, cleaved fragment
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å57(2) 2QUW|1|B, 2QUW|1|D
426NR_4.0_36129.1
Exact match
Escherichia coli
2VAL|1|B+2VAL|1|D (2VAL)
  • 5'-R(*GP*CP*GP*GP*GP*AP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, D, H, L; model(s): 1
2.0 Å7(2) 2VAL|1|B+2VAL|1|D, 2VAL|1|A+2VAL|1|C
427NR_4.0_16324.1
Exact match
Homo sapiens
2VOD|1|D (2VOD)
  • 5'-R(*AP*UP*AP*UP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.1 Å7(2) 2VOD|1|D, 2VOD|1|C
428NR_4.0_71707.1
Exact match
Homo sapiens
2VON|1|D (2VON)
  • 5'-R(*AP*UP*AP*AP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.1 Å7(2) 2VON|1|D, 2VON|1|C
429NR_4.0_25856.1
Exact match
Homo sapiens
2VOO|1|D (2VOO)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.8 Å3(2) 2VOO|1|D, 2VOO|1|C
430NR_4.0_09706.1
Exact match
Methanocaldococcus jannaschii
2VPL|1|B (2VPL)
  • FRAGMENT OF MRNA FOR L1-OPERON CONTAININ[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å48(2) 2VPL|1|B, 2VPL|1|D
431NR_4.0_60790.1
Exact match
Thermus thermophilus
2VQE|1|Y+2VQE|1|X (2VQE)
  • 5'-R(*GP*CP*AP*UP*GP*CP*UP*TM2P*AP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, H, L, X, Y; model(s): 1
2.5 Å6(2) 2VQE|1|Y+2VQE|1|X, 2VQF|1|Y+2VQF|1|X
432NR_4.0_47406.1
Exact match
Equine infectious anemia virus
2W2H|1|S (2W2H)
  • 5'-R(*GP*CP*UP*CP*AP*GP*AP*UP*CP*UP *GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): S; model(s): 1
3.3 Å22(2) 2W2H|1|S, 2W2H|1|R
433NR_4.0_97569.1
Exact match
Escherichia coli
2W89|1|C+2W89|1|D (2W89)
  • 5'-R(*GP*CP*AP*UP*CP*CP*GP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H, L; model(s): 1
2.0 Å7(2) 2W89|1|C+2W89|1|D, 2W89|1|A+2W89|1|B
434NR_4.0_28594.1
Exact match
2X1F|1|B (2X1F)
  • 5'-R(*GP*UP*UP*GP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.6 Å2(2) 2X1F|1|B, 2X1A|1|B
435NR_4.0_44600.1
Exact match
Mus musculus
2XS5|1|D (2XS5)
  • 5'-R(*UP*GP*UP*UP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.6 Å5(2) 2XS5|1|D, 2XS5|1|C
436NR_4.0_17264.1
Exact match
Thermus thermophilus
2XSL|1|C+2XSL|1|D (2XSL)
  • 5'-R(*GP*CP*GP*GP*GP*AP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H, L; model(s): 1
1.6 Å7(2) 2XSL|1|C+2XSL|1|D, 2XSL|1|A+2XSL|1|B
437NR_4.0_57933.1
Exact match
Deinococcus radiodurans
2XXA|1|G (2XXA)
  • 4.5S RNA
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
3.9 Å102(2) 2XXA|1|G, 2XXA|1|F
438NR_4.0_42835.2
Exact match
synthetic construct
2XZL|1|B (2XZL)
  • 5- R(*UP*UP*UP*UP*UP*UP*UP*UP*U) -3
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å9(2) 2XZL|1|B, 5EV1|1|B
439NR_4.0_72322.1
Exact match
2Y9H|1|F (2Y9H)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.5 Å18(2) 2Y9H|1|F, 2Y9H|1|B
440NR_4.0_24738.1
Exact match
2Y9H|1|H (2Y9H)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.5 Å18(2) 2Y9H|1|H, 2Y9H|1|D
441NR_4.0_46586.1
Exact match
2Y9H|1|L (2Y9H)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
2.5 Å18(2) 2Y9H|1|L, 2Y9H|1|J
442NR_4.0_15533.1
Exact match
2Y9H|1|N (2Y9H)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): N; model(s): 1
2.5 Å17(2) 2Y9H|1|N, 2Y9H|1|P
443NR_4.0_73930.1
Exact match
synthetic construct
2YJY|1|D (2YJY)
  • 5'-R(*AP*UP*UP*GP*CP*AP*UP*AP*UP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.6 Å10(2) 2YJY|1|D, 2YJY|1|C
444NR_4.0_76729.1
Exact match
2ZNI|1|D (2ZNI)
  • bacterial tRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.1 Å72(2) 2ZNI|1|D, 2ZNI|1|C
445NR_4.0_65284.1
Exact match
2ZUE|1|B (2ZUE)
  • tRNA-Arg
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å77(2) 2ZUE|1|B, 2ZUF|1|B
446NR_4.0_90969.1
Exact match
2ZZN|1|D (2ZZN)
  • RNA (71-MER)
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å71(2) 2ZZN|1|D, 2ZZN|1|C
447NR_4.0_34610.1
Exact match
Escherichia coli
364D|1|C+364D|1|B+364D|1|A (364D)
  • RNA (5'-R(*CP*CP*CP*CP*AP*UP*GP*CP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, H; model(s): 1
3.0 Å31(2) 364D|1|C+364D|1|B+364D|1|A, 357D|1|C+357D|1|B+357D|1|A
448NR_4.0_70871.1
Exact match
377D|1|C+377D|1|D (377D)
  • RNA-DNA (5'-R(*CP*GP*UP*AP*CP*DG)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, C, D, H; model(s): 1
1.8 Å5(2) 377D|1|C+377D|1|D, 377D|1|A+377D|1|B
449NR_4.0_34492.3
Exact match
398D|1|C (398D)
  • RNA (5'-R(*GP*CP*AP*GP*UP*GP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.9 Å8(2) 398D|1|C, 398D|1|A
450NR_4.0_65114.1
Exact match
3A2K|1|D (3A2K)
  • bacterial tRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.7 Å77(2) 3A2K|1|D, 3A2K|1|C
451NR_4.0_30596.1
Exact match
3A6P|1|J+3A6P|1|I (3A6P)
  • pre-microRNA
  • X-RAY DIFFRACTION
  • Chain(s): A, D, H, I, J; model(s): 1
2.9 Å24(2) 3A6P|1|J+3A6P|1|I, 3A6P|1|E+3A6P|1|D
452NR_4.0_23187.1
Exact match
3AGV|1|S (3AGV)
  • 5'-R(*GP*GP*AP*GP*GP*(UFT)P*GP*(CFZ)P*(U[...]
  • X-RAY DIFFRACTION
  • Chain(s): S; model(s): 1
2.2 Å10(2) 3AGV|1|S, 3AGV|1|U
453NR_4.0_56041.1
Exact match
Archaeoglobus fulgidus
3AMU|1|B (3AMU)
  • RNA (78-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.1 Å78(2) 3AMU|1|B, 3AMT|1|B
454NR_4.0_35987.1
Exact match
Thermus thermophilus
3B0U|1|B (3B0U)
  • RNA (5'-R(*GP*GP*(H2U)P*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å3(2) 3B0U|1|B, 3B0U|1|A
455NR_4.0_91544.1
Exact match
3BSX|1|D (3BSX)
  • 5'-R(*UP*UP*GP*UP*AP*AP*UP*AP*UP*UP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.3 Å9(2) 3BSX|1|D, 3BSX|1|C
456NR_4.0_51674.1
Exact match
3BT7|1|D (3BT7)
  • RNA (5'-D(P*GP*CP*UP*GP*UP*GP*(5MU)P*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å18(2) 3BT7|1|D, 3BT7|1|C
457NR_4.0_27661.1
Exact match
3BX2|1|D (3BX2)
  • HO endonuclease 3' UTR binding sequence
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.8 Å9(2) 3BX2|1|D, 3BX2|1|C
458NR_4.0_95803.1
Exact match
3BX3|1|D (3BX3)
  • COX17 RNA target sequence
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å8(2) 3BX3|1|D, 3BX3|1|C
459NR_4.0_22223.1
Exact match
3CGP|1|B+3CGP|1|A (3CGP)
  • RNA (5'-R(*CP*GP*CP*UP*AP*CP*UP*AP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.6 Å13(2) 3CGP|1|B+3CGP|1|A, 3CGQ|1|B+3CGQ|1|A
460NR_4.0_13929.1
Exact match
3CR1|1|A (3CR1)
  • RNA (5'-R(*UP*CP*CP*CP*(A2M)P*GP*UP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å13(2) 3CR1|1|A, 3CQS|1|A
461NR_4.0_88906.1
Exact match
3CZ3|1|G+3CZ3|1|H (3CZ3)
  • RNA (5'-R(P*CP*GP*UP*AP*CP*GP*CP*GP*GP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, G, H; model(s): 1
3.2 Å38(2) 3CZ3|1|G+3CZ3|1|H, 3CZ3|1|E+3CZ3|1|F
462NR_4.0_67685.1
Exact match
3D2S|1|G (3D2S)
  • 5'-R(*CP*GP*CP*UP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
1.7 Å6(2) 3D2S|1|G, 3D2S|1|E
463NR_4.0_35553.1
Exact match
3D2S|1|H (3D2S)
  • 5'-R(*CP*GP*CP*UP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
1.7 Å5(2) 3D2S|1|H, 3D2S|1|F
464NR_4.0_67964.1
Exact match
3ER8|1|E (3ER8)
  • RNA/DNA chimera 5'-D(CP*CP*)R(UP*UP*)D(C[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.2 Å2(2) 3ER8|1|E, 3ERC|1|I
465NR_4.0_12768.1
Exact match
3ER8|1|H (3ER8)
  • RNA/DNA chimera 5'-D(P*CP*)R(UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.2 Å2(2) 3ER8|1|H, 3ER8|1|G
466NR_4.0_07227.1
Exact match
3ERC|1|F (3ERC)
  • RNA/DNA chimera (5'-D(CP*)R(UP*UP*)D(CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.2 Å2(2) 3ERC|1|F, 3ERC|1|E
467NR_4.0_79282.1
Exact match
3FTM|1|D+3FTM|1|C (3FTM)
  • 5'-R(*CP*CP*AP*GP*UP*CP*GP*GP*AP*AP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, C, D, H; model(s): 1
2.7 Å12(2) 3FTM|1|D+3FTM|1|C, 3FTM|1|B+3FTM|1|A
468NR_4.0_25125.1
Exact match
3GM7|1|G+3GM7|1|H (3GM7)
  • 5'-R(*CP*UP*GP*CP*UP*GP*CP*UP*GP*CP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, G, H; model(s): 1
1.6 Å18(2) 3GM7|1|G+3GM7|1|H, 1ZEV|1|A+1ZEV|1|B
469NR_4.0_60450.1
Exact match
3GTJ|1|R (3GTJ)
  • RNA (5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.4 Å12(2) 3GTJ|1|R, 3GTM|1|M
470NR_4.0_12080.1
Exact match
3HGA|1|X (3HGA)
  • 5'-R(*UP*(US5)P*CP*GP*CP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
1.3 Å5(2) 3HGA|1|X, 1OSU|1|A
471NR_4.0_10218.1
Exact match
3HOU|1|6 (3HOU)
  • 5'-R(*UP*GP*CP*AP*UP*U*UP*CP*GP*AP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6; model(s): 1
3.2 Å11(2) 3HOU|1|6, 3HOU|1|3
472NR_4.0_34753.1
Exact match
3HOW|1|3 (3HOW)
  • 5'-R(*UP*GP*CP*AP*UP*UP*U*CP*AP*AP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): 3; model(s): 1
3.6 Å11(2) 3HOW|1|3, 3HOX|1|P
473NR_4.0_47541.1
Exact match
3HTX|1|E+3HTX|1|F (3HTX)
  • 5'-R(*GP*AP*UP*UP*UP*CP*UP*CP*UP*CP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, E, F, H; model(s): 1
3.1 Å22(2) 3HTX|1|E+3HTX|1|F, 3HTX|1|B+3HTX|1|C
474NR_4.0_17498.1
Exact match
3ICQ|1|E (3ICQ)
  • RNA (62-MER)
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.2 Å62(2) 3ICQ|1|E, 3ICQ|1|D
475NR_4.0_58564.1
Exact match
3IVK|1|M (3IVK)
  • class I ligase product
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
3.1 Å130(2) 3IVK|1|M, 3IVK|1|C
476NR_4.0_66984.1
Exact match
Bacillus subtilis
3IVN|1|B (3IVN)
  • A-riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å69(2) 3IVN|1|B, 3IVN|1|A
477NR_4.0_25458.1
Exact match
3IWN|1|A (3IWN)
  • C-di-GMP riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.2 Å93(2) 3IWN|1|A, 3IWN|1|B
478NR_4.0_95755.2
Exact match
Plasmodium falciparum
3J79|1|A+3J79|1|C (3J79)
  • 28S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A, C, D, H; model(s): 1
3.2 Å3191(2) 3J79|1|A+3J79|1|C, 5UMD|1|A+5UMD|1|C
479NR_4.0_61505.1
Exact match
Sus scrofa
3J7P|1|S2 (3J7P)
  • 18S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): S2; model(s): 1
3.5 Å1742(2) 3J7P|1|S2, 3J7R|1|S2
480NR_4.0_02817.1
Exact match
Homo sapiens
3J7Y|1|A (3J7Y)
  • 16S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.4 Å1473(2) 3J7Y|1|A, 3J9M|1|A
481NR_4.0_26348.1
Exact match
Homo sapiens
3J9M|1|B (3J9M)
  • mt-tRNAVal
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
3.5 Å56(2) 3J9M|1|B, 3J7Y|1|B
482NR_4.0_35965.1
Exact match
Oryctolagus cuniculus
3JAN|1|4 (3JAN)
  • SRP 7S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 4; model(s): 1
3.8 Å212(2) 3JAN|1|4, 3JAJ|1|4
483NR_4.0_19099.1
Exact match
3K0J|1|E (3K0J)
  • RNA (87-MER)
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.1 Å87(2) 3K0J|1|E, 3K0J|1|F
484NR_4.0_84036.1
Exact match
3K5Y|1|B (3K5Y)
  • 5'-R(*UP*GP*UP*GP*CP*CP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å9(2) 3K5Y|1|B, 3QGB|1|B
485NR_4.0_32874.1
Exact match
Sulfolobus solfataricus
3KTW|1|C (3KTW)
  • SRP RNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.2 Å96(2) 3KTW|1|C, 3KTW|1|D
486NR_4.0_34992.1
Exact match
3L25|1|C+3L25|1|F (3L25)
  • RNA (5'-R(*CP*GP*CP*AP*UP*GP*CP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, C, D, F, H; model(s): 1
2.0 Å8(2) 3L25|1|C+3L25|1|F, 3L26|1|C
487NR_4.0_46231.1
Exact match
Pyrococcus furiosus
3NMU|1|D+3NMU|1|I (3NMU)
  • RNA (34-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A, D, H, I; model(s): 1
2.7 Å34(2) 3NMU|1|D+3NMU|1|I, 3NMU|1|E+3NMU|1|K
488NR_4.0_50588.1
Exact match
Pyrococcus furiosus
3NVI|1|F (3NVI)
  • RNA (5'-R(*CP*UP*CP*UP*GP*AP*CP*CP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.7 Å24(2) 3NVI|1|F, 3NVI|1|E
489NR_4.0_15188.1
Exact match
3NVK|1|K+3NVK|1|G (3NVK)
  • RNA (5'-R(*GP*CP*CP*GP*UP*UP*GP*AP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, G, H, K; model(s): 1
3.2 Å24(2) 3NVK|1|K+3NVK|1|G, 3NVK|1|L+3NVK|1|S
490NR_4.0_61988.1
Exact match
3OG8|1|C+3OG8|1|D (3OG8)
  • RNA (5'-R(*GP*GP*CP*GP*CP*GP*CP*GP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, C, D, H; model(s): 1
2.4 Å14(2) 3OG8|1|C+3OG8|1|D, 3LRN|1|C+3LRN|1|D
491NR_4.0_97537.1
Exact match
3P4D|1|B (3P4D)
  • 5'-R(*(CFZ)P*CP*(CFZ)P*CP*(GF2)P*GP*(GF2[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å4(2) 3P4D|1|B, 3P4D|1|A
492NR_4.0_22853.1
Exact match
3PLA|1|N+3PLA|1|O (3PLA)
  • C/D guide RNA
  • X-RAY DIFFRACTION
  • Chain(s): A, D, H, N, O; model(s): 1
3.2 Å31(2) 3PLA|1|N+3PLA|1|O, 3PLA|1|G+3PLA|1|H+3PLA|1|I+3PLA|1|J
493NR_4.0_08738.1
Exact match
3Q0P|1|D (3Q0P)
  • 5'-R(UP*GP*UP*AP*UP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.6 Å8(2) 3Q0P|1|D, 3Q0P|1|C
494NR_4.0_98055.1
Exact match
3Q0S|1|B (3Q0S)
  • 5'-R(UP*GP*UP*AP*CP*AP*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å8(2) 3Q0S|1|B, 3Q0N|1|C
495NR_4.0_51472.1
Exact match
3Q1Q|1|B (3Q1Q)
  • RNase P RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.8 Å347(2) 3Q1Q|1|B, 2A2E|1|A
496NR_4.0_65073.1
Exact match
Clostridium acetobutylicum
3Q3Z|1|V (3Q3Z)
  • c-di-GMP-II riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): V; model(s): 1
2.5 Å74(2) 3Q3Z|1|V, 3Q3Z|1|A
497NR_4.0_10014.1
Exact match
3QGC|1|B (3QGC)
  • 5'-R(*UP*GP*UP*GP*CP*CP*UP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å9(2) 3QGC|1|B, 3QG9|1|B
498NR_4.0_34288.1
Exact match
3QJL|1|X (3QJL)
  • RNA (5'-R(*GP*UP*UP*AP*CP*AP*AP*UP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.7 Å12(2) 3QJL|1|X, 3QJL|1|R
499NR_4.0_40400.1
Exact match
3QSU|1|R (3QSU)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.2 Å4(2) 3QSU|1|R, 3QSU|1|P
500NR_4.0_95407.1
Exact match
3R1D|1|C+3R1D|1|D (3R1D)
  • RNA (5'-R(*GP*CP*(GRB)P*GP*CP*GP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, C, D, H; model(s): 1
1.5 Å16(2) 3R1D|1|C+3R1D|1|D, 3R1D|1|A+3R1D|1|B
501NR_4.0_86424.1
Exact match
Aquifex aeolicus
3R2C|1|S (3R2C)
  • 5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): S; model(s): 1
1.9 Å10(2) 3R2C|1|S, 3R2C|1|R
502NR_4.0_07663.1
Exact match
3RER|1|K (3RER)
  • 5'-R(*AP*UP*UP*UP*UP*UP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): K; model(s): 1
1.7 Å8(2) 3RER|1|K, 4HT9|1|E
503NR_4.0_57598.2
Exact match
Mus musculus
3RG5|1|B (3RG5)
  • tRNA(Sec)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å86(2) 3RG5|1|B, 3RG5|1|A
504NR_4.0_76909.1
Exact match
3RW6|1|H (3RW6)
  • constitutive transport element(CTE)of Ma[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.3 Å60(2) 3RW6|1|H, 3RW6|1|F
505NR_4.0_31327.1
Exact match
3S17|1|R (3S17)
  • RNA (5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*G)-3'[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.2 Å9(2) 3S17|1|R, 2E2J|1|R
506NR_4.0_14513.1
Exact match
Homo sapiens
3SIU|1|F (3SIU)
  • U4atac snRNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.6 Å28(2) 3SIU|1|F, 3SIU|1|C
507NR_4.0_08155.1
Exact match
Homo sapiens
3SIV|1|I+3SIV|1|L (3SIV)
  • U4atac snRNA
  • X-RAY DIFFRACTION
  • Chain(s): A, D, H, I, L; model(s): 1
3.3 Å32(2) 3SIV|1|I+3SIV|1|L, 3SIV|1|C+3SIV|1|F
508NR_4.0_53881.1
Exact match
3SNP|1|D (3SNP)
  • ferritin H IRE RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.8 Å30(2) 3SNP|1|D, 3SNP|1|C
509NR_4.0_51156.1
Exact match
3SQW|1|B (3SQW)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å8(2) 3SQW|1|B, 3SQX|1|B
510NR_4.0_47433.1
Exact match
Caldanaerobacter subterraneus
3V7E|1|C (3V7E)
  • SAM-I riboswitch aptamer with an enginee[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å126(2) 3V7E|1|C, 3V7E|1|D
511NR_4.0_45693.1
Exact match
3VJR|1|D (3VJR)
  • tRNA CCA-acceptor
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å36(2) 3VJR|1|D, 3VJR|1|B
512NR_4.0_69638.1
Exact match
Archaeoglobus fulgidus
3WQY|1|C (3WQY)
  • RNA (75-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.3 Å75(2) 3WQY|1|C, 3WQZ|1|C
513NR_4.0_46751.1
Exact match
419D|1|C+419D|1|D (419D)
  • DNA/RNA (5'-R(*GP*UP*AP*UP*AP*CP*A)-D(P*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, C, D, H; model(s): 1
2.2 Å7(2) 419D|1|C+419D|1|D, 419D|1|A+419D|1|B
514NR_4.0_68126.1
Exact match
420D|1|A+420D|1|B (420D)
  • RNA (5'-R(*GP*CP*AP*GP*AP*GP*UP*UP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.9 Å16(2) 420D|1|A+420D|1|B, 2H1M|1|A+2H1M|1|B
515NR_4.0_08327.1
Exact match
435D|1|C+435D|1|D (435D)
  • RNA (5'-R(*UP*AP*GP*CP*CP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, C, D, H; model(s): 1
1.4 Å7(2) 435D|1|C+435D|1|D, 435D|1|A+435D|1|B
516NR_4.0_92005.1
Exact match
synthetic construct
4A2X|1|N+4A2X|1|O (4A2X)
  • 5'-R(*GP*GP*GP*AP*GP*AP*AP*CP*AP*AP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, H, N, O; model(s): 1
4.0 Å14(2) 4A2X|1|N+4A2X|1|O, 4A2X|1|L+4A2X|1|M
517NR_4.0_28969.1
Exact match
synthetic construct
4A36|1|T+4A36|1|U (4A36)
  • 5'-R(*GP*CP*AP*UP*GP*CP*GP*AP*CP*CP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, H, T, U; model(s): 1
3.7 Å18(2) 4A36|1|T+4A36|1|U, 4A36|1|R+4A36|1|S
518NR_4.0_64994.1
Exact match
Saccharomyces cerevisiae
4A3B|1|P (4A3B)
  • TRANSCRIPT RNA 5'-R(*AP*GP*GP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.5 Å4(2) 4A3B|1|P, 4A3M|1|P
519NR_4.0_82856.2
Exact match
Saccharomyces cerevisiae
4A3D|1|P (4A3D)
  • TRANSCRIPT RNA 5'-R(*CP*CP*AP*GP*GP*AP)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.4 Å6(2) 4A3D|1|P, 4A3F|1|P
520NR_4.0_07798.1
Exact match
Saccharomyces cerevisiae
4A3E|1|P (4A3E)
  • TRANSCRIPT RNA 5'-R(*CP*AP*GP*GP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.4 Å4(2) 4A3E|1|P, 4A3C|1|P
521NR_4.0_23131.1
Exact match
Saccharomyces cerevisiae
4A3L|1|P (4A3L)
  • 5'-R(*AP*CP*CP*AP*GP*GP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.5 Å7(2) 4A3L|1|P, 4A3K|1|P
522NR_4.0_06402.1
Exact match
Pseudomonas aeruginosa
4AL7|1|B (4AL7)
  • 5'-R(*CP*UP*GP*CP*CP*GP*UP*AP*UP*AP*GP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å15(2) 4AL7|1|B, 4AL5|1|B
523NR_4.0_11428.1
Exact match
Pseudomonas phage PRR1
4ANG|1|R (4ANG)
  • 5'-R(*CP*CP*AP*UP*AP*AP*GP*GP*AP*GP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.5 Å26(2) 4ANG|1|R, 4ANG|1|S
524NR_4.0_92231.1
Exact match
synthetic construct
4BY7|1|P (4BY7)
  • 5'-R(*UP*UP*CP*GP*AP*CP*CP*AP*GP*GP*AP)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.2 Å10(2) 4BY7|1|P, 4BY1|1|P
525NR_4.0_23939.1
Exact match
Kneallhazia solenopsae
4C4W|1|H (4C4W)
  • TSKT-23
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.0 Å35(2) 4C4W|1|H, 4C4W|1|D
526NR_4.0_88374.1
Exact match
Thermus thermophilus
4C9D|1|C (4C9D)
  • R3 REPEAT RNA CLEAVAGE PRODUCT
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.0 Å12(2) 4C9D|1|C, 4C9D|1|D
527NR_4.0_67355.1
Exact match
Haloarcula marismortui
4CS1|1|A (4CS1)
  • 5'-(*GP*GP*CP*GP*AP*AP*GP*AP*AP*CP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å19(2) 4CS1|1|A, 4C40|1|A
528NR_4.0_68928.1
Exact match
Bombyx mori
4D25|1|D (4D25)
  • 5'-R(*UP*GP*AP*CP*AP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.9 Å6(2) 4D25|1|D, 4D26|1|D
529NR_4.0_48272.1
Exact match
4DZS|1|D (4DZS)
  • 5'-R(*UP*GP*UP*AP*UP*CP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.1 Å9(2) 4DZS|1|D, 4DZS|1|C
530NR_4.0_06694.1
Exact match
4ED5|1|D (4ED5)
  • 5'-R(*A*UP*UP*UP*UP*UP*AP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.0 Å10(2) 4ED5|1|D, 4ED5|1|C
531NR_4.0_58977.1
Exact match
synthetic construct
4EYA|1|k+4EYA|1|l (4EYA)
  • RNA (5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, H, k, l; model(s): 1
3.2 Å12(2) 4EYA|1|k+4EYA|1|l, 4EYA|1|i+4EYA|1|j
532NR_4.0_48927.1
Exact match
synthetic construct
4EYA|1|m+4EYA|1|n (4EYA)
  • RNA (5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, H, m, n; model(s): 1
3.2 Å12(2) 4EYA|1|m+4EYA|1|n, 4EYA|1|a+4EYA|1|b
533NR_4.0_87225.1
Exact match
synthetic construct
4EYA|1|o+4EYA|1|p (4EYA)
  • RNA (5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, H, o, p; model(s): 1
3.2 Å12(2) 4EYA|1|o+4EYA|1|p, 4EYA|1|c+4EYA|1|d
534NR_4.0_15820.1
Exact match
synthetic construct
4EYA|1|q+4EYA|1|r (4EYA)
  • RNA (5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, H, q, r; model(s): 1
3.2 Å12(2) 4EYA|1|q+4EYA|1|r, 4EYA|1|e+4EYA|1|f
535NR_4.0_13759.1
Exact match
synthetic construct
4EYA|1|s+4EYA|1|t (4EYA)
  • RNA (5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, H, s, t; model(s): 1
3.2 Å12(2) 4EYA|1|s+4EYA|1|t, 4EYA|1|g+4EYA|1|h
536NR_4.0_68289.1
Exact match
4F02|1|E (4F02)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.0 Å9(2) 4F02|1|E, 4F02|1|B
537NR_4.0_29401.1
Exact match
Vanderwaltozyma polyspora
4F1N|1|F (4F1N)
  • RNA 5'-R(P*UP*AP*AP*AP*AP*AP*AP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.2 Å9(2) 4F1N|1|F, 4F1N|1|E
538NR_4.0_01779.1
Exact match
marine metagenome
4FRG|1|B (4FRG)
  • cobalamin riboswitch aptamer domain
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å84(2) 4FRG|1|B, 4FRG|1|X
539NR_4.0_95082.1
Exact match
marine metagenome
4FRN|1|B (4FRN)
  • Cobalamin riboswitch aptamer domain
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.4 Å102(2) 4FRN|1|B, 4FRN|1|A
540NR_4.0_99371.1
Exact match
Spodoptera frugiperda
4FTS|1|R (4FTS)
  • Random cellular RNAs
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.2 Å15(2) 4FTS|1|R, 4FTE|1|R
541NR_4.0_99451.1
Exact match
4FWT|1|G+4FWT|1|T (4FWT)
  • RNA (5'-R(*C*CP*CP*UP*AP*CP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, D, G, H, T; model(s): 1
3.2 Å7(2) 4FWT|1|G+4FWT|1|T, 3VNU|1|G+3VNU|1|T
542NR_4.0_49582.1
Exact match
4FXD|1|F (4FXD)
  • RNA (5'-R(*AP*GP*GP*CP*GP*GP*GP*CP*AP*G)[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.0 Å8(2) 4FXD|1|F, 4FXD|1|E
543NR_4.0_73579.1
Exact match
4FYD|1|F (4FYD)
  • DNA/RNA (5'-R(*CP*GP*GP*CP*GP*GP*GP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.1 Å10(2) 4FYD|1|F, 4FYD|1|E
544NR_4.0_79184.1
Exact match
4GCW|1|B (4GCW)
  • TRNA(THR)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å53(2) 4GCW|1|B, 2FK6|1|R
545NR_4.0_00536.1
Exact match
4GHL|1|F (4GHL)
  • short palindromic RNA AGACAGCAUAUGCUGUCU
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.0 Å18(2) 4GHL|1|F, 4GHL|1|E
546NR_4.0_51944.1
Exact match
4GL2|1|E+4GL2|1|F (4GL2)
  • RNA (5'-R(*AP*UP*CP*CP*GP*CP*GP*GP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, E, F, H; model(s): 1
3.6 Å12(2) 4GL2|1|E+4GL2|1|F, 4GL2|1|C+4GL2|1|D
547NR_4.0_08724.1
Exact match
4H5O|1|L (4H5O)
  • 35-mer poly(U) RNA
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
3.9 Å35(2) 4H5O|1|L, 4H5O|1|K
548NR_4.0_00747.1
Exact match
4H5P|1|F (4H5P)
  • 28-mer poly(U) RNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.2 Å14(2) 4H5P|1|F, 4H5P|1|E
549NR_4.0_12719.1
Exact match
4IFD|1|R (4IFD)
  • RNA (45-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.8 Å30(2) 4IFD|1|R, 5C0X|1|R
550NR_4.0_31263.1
Exact match
4ILL|1|C (4ILL)
  • RNA (5'-R(*GP*CP*UP*AP*AP*UP*CP*UP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.5 Å17(2) 4ILL|1|C, 4ILL|1|R
551NR_4.0_93859.1
Exact match
4J39|1|B (4J39)
  • 5'-R(P*CP*AP*GP*CP*AP*GP*CP*AP*GP*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.7 Å21(2) 4J39|1|B, 4J5V|1|B
552NR_4.0_40086.1
Exact match
4JGN|1|E (4JGN)
  • 5'-R(P*UP*UP*GP*CP*UP*GP*CP*UP*GP*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.9 Å20(2) 4JGN|1|E, 4JK0|1|B
553NR_4.0_26186.1
Exact match
4JRC|1|B (4JRC)
  • Distal Stem I region of the glyQS T box [...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å56(2) 4JRC|1|B, 4JRC|1|A
554NR_4.0_76613.1
Exact match
4JRD|1|B (4JRD)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.0 Å11(2) 4JRD|1|B, 4JRD|1|A
555NR_4.0_40895.1
Exact match
4JVY|1|F (4JVY)
  • RNA (5'-R(P*CP*UP*AP*AP*CP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.9 Å8(2) 4JVY|1|F, 4JVY|1|D
556NR_4.0_28348.1
Exact match
synthetic construct
4JXZ|1|B (4JXZ)
  • RNA (71-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å71(2) 4JXZ|1|B, 4JYZ|1|B
557NR_4.0_96460.1
Exact match
4JZU|1|C (4JZU)
  • RNA (5'-R(*(GCP)P*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.7 Å1(2) 4JZU|1|C, 4JZV|1|C
558NR_4.0_33790.1
Exact match
4K4U|1|F+4K4U|1|G+4K4U|1|H (4K4U)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, F, G, H; model(s): 1
2.9 Å19(2) 4K4U|1|F+4K4U|1|G+4K4U|1|H, 4K4U|1|B+4K4U|1|C+4K4U|1|D
559NR_4.0_31084.1
Exact match
4K4V|1|F (4K4V)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.6 Å13(2) 4K4V|1|F, 4K4V|1|B
560NR_4.0_73146.1
Exact match
Thermus thermophilus
4KHP|1|X (4KHP)
  • Fragment of messenger RNA
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.1 Å6(2) 4KHP|1|X, 1HNX|1|X
561NR_4.0_72481.1
Exact match
4KJI|1|D (4KJI)
  • RsmZ-2
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.2 Å16(2) 4KJI|1|D, 4KJI|1|C
562NR_4.0_57443.1
Exact match
4KR7|1|M (4KR7)
  • RNA (39-MER)
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
3.4 Å39(2) 4KR7|1|M, 4KR9|1|M
563NR_4.0_87561.1
Exact match
4KR7|1|X (4KR7)
  • RNA (39-MER)
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.4 Å39(2) 4KR7|1|X, 4KR9|1|X
564NR_4.0_41922.1
Exact match
4KTG|1|E (4KTG)
  • 5'-R(P*GP*CP*GP*GP*CP*GP*GP*CP*GP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.9 Å21(2) 4KTG|1|E, 4KTG|1|B
565NR_4.0_12869.1
Exact match
4L81|1|A (4L81)
  • SAM-I/IV variant riboswitch aptamer doma[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å96(2) 4L81|1|A, 4OQU|1|A
566NR_4.0_73445.1
Exact match
Vibrio vulnificus
4LX6|1|A (4LX6)
  • Mutated adenine riboswitch aptamer
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.2 Å71(2) 4LX6|1|A, 4LX5|1|A
567NR_4.0_55785.1
Exact match
4M59|1|C (4M59)
  • psaJ RNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.5 Å14(2) 4M59|1|C, 4OE1|1|C
568NR_4.0_27182.1
Exact match
4M59|1|D (4M59)
  • psaJ RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.5 Å18(2) 4M59|1|D, 4OE1|1|D
569NR_4.0_17764.1
Exact match
4M7A|1|P (4M7A)
  • U6 snRNA
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.8 Å5(2) 4M7A|1|P, 4M7A|1|O
570NR_4.0_42085.1
Exact match
4M7D|1|P (4M7D)
  • U6 snRNA
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.6 Å4(2) 4M7D|1|P, 4M7D|1|O
571NR_4.0_19112.1
Exact match
4MGN|1|A (4MGN)
  • glyQS T box riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.2 Å85(2) 4MGN|1|A, 4MGN|1|C
572NR_4.0_98303.1
Exact match
4N48|1|G (4N48)
  • capped RNA
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.7 Å4(2) 4N48|1|G, 4N48|1|D
573NR_4.0_47933.1
Exact match
4NGD|1|B (4NGD)
  • 5'-R(P*GP*CP*GP*AP*AP*UP*UP*CP*GP*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å12(2) 4NGD|1|B, 4NGB|1|B
574NR_4.0_06683.1
Exact match
4NGF|1|G+4NGF|1|H (4NGF)
  • 5'-R(P*UP*CP*GP*AP*AP*GP*GP*UP*CP*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, G, H; model(s): 1
3.1 Å17(2) 4NGF|1|G+4NGF|1|H, 4NGF|1|E+4NGF|1|F
575NR_4.0_11458.2
Exact match
Oryzias latipes
4O26|1|E (4O26)
  • Telomerase TR
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.0 Å47(2) 4O26|1|E, 4O26|1|F
576NR_4.0_56235.1
Exact match
4O41|1|C+4O41|1|D (4O41)
  • AMIDE LINKED RNA
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H; model(s): 1
1.2 Å10(2) 4O41|1|C+4O41|1|D, 4O41|1|B+4O41|1|A
577NR_4.0_41964.1
Exact match
4O8J|1|E (4O8J)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.0 Å6(2) 4O8J|1|E, 4O8J|1|D
578NR_4.0_91413.1
Exact match
4OL8|1|G (4OL8)
  • 5'-R(*CP*UP*GP*AP*GP*AP*GP*AP*GP*AP*GP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
3.1 Å17(2) 4OL8|1|G, 4OL8|1|C
579NR_4.0_47021.1
Exact match
Homo sapiens
4OLA|1|B (4OLA)
  • 5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å10(2) 4OLA|1|B, 4OLB|1|B
580NR_4.0_43274.1
Exact match
Senecavirus A
4P97|1|C+4P97|1|D (4P97)
  • RNA (5'-R(*CP*GP*UP*CP*UP*AP*CP*CP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H; model(s): 1
1.9 Å16(2) 4P97|1|C+4P97|1|D, 4P97|1|A+4P97|1|B
581NR_4.0_57460.1
Exact match
Didymium iridis
4P9R|1|A (4P9R)
  • RNA (189-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å191(2) 4P9R|1|A, 4P95|1|A
582NR_4.0_52610.1
Exact match
synthetic construct
4PCJ|1|A (4PCJ)
  • trCUG-3('5)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.9 Å34(2) 4PCJ|1|A, 4FNJ|1|A
583NR_4.0_13685.1
Exact match
unidentified
4PMW|1|D (4PMW)
  • U-U-U-U-U-U-U-U-U-U-U-U-U-U
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å14(2) 4PMW|1|D, 4PMW|1|C
584NR_4.0_73328.1
Exact match
4PWD|1|T (4PWD)
  • 5'-R(*AP*UP*GP*GP*UP*CP*GP*GP*CP*GP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
3.0 Å21(2) 4PWD|1|T, 4PWD|1|E
585NR_4.0_67179.1
Exact match
4Q0B|1|T (4Q0B)
  • 5'-R(*AP*UP*GP*GP*UP*CP*GP*GP*CP*GP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
3.3 Å9(2) 4Q0B|1|T, 4Q0B|1|E
586NR_4.0_89275.1
Exact match
4Q0B|1|t (4Q0B)
  • 5'-R(P*AP*CP*AP*GP*GP*GP*AP*CP*UP*GP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): t; model(s): 1
3.3 Å10(2) 4Q0B|1|t, 4Q0B|1|e
587NR_4.0_61892.1
Exact match
4QIL|1|D (4QIL)
  • 5'-R(*CP*UP*CP*CP*CP*UP*UP*CP*UP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.9 Å16(2) 4QIL|1|D, 4QIL|1|C
588NR_4.0_66230.1
Exact match
4QK8|1|A (4QK8)
  • C-di-AMP riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å120(2) 4QK8|1|A, 4QKA|1|A
589NR_4.0_53735.1
Exact match
Caldanaerobacter subterraneus
4QLM|1|A (4QLM)
  • RNA (108-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å108(2) 4QLM|1|A, 4QLN|1|A
590NR_4.0_75344.1
Exact match
4QM6|1|D (4QM6)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.5 Å7(2) 4QM6|1|D, 4QM6|1|C
591NR_4.0_29353.1
Exact match
4QQB|1|P (4QQB)
  • msl2 mRNA
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.8 Å17(2) 4QQB|1|P, 4QQB|1|C
592NR_4.0_33922.1
Exact match
4R4V|1|A (4R4V)
  • VS ribozyme RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å185(2) 4R4V|1|A, 4R4P|1|A
593NR_4.0_77810.1
Exact match
4S2X|1|B (4S2X)
  • RNA (5'-R(*(APC)*GP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.5 Å2(2) 4S2X|1|B, 4S2Y|1|B
594NR_4.0_80828.1
Exact match
synthetic construct
4TS0|1|Y+4TS0|1|X (4TS0)
  • Spinach RNA aptamer, bimolecular constru[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, H, X, Y; model(s): 1
2.8 Å46(2) 4TS0|1|Y+4TS0|1|X, 4TS2|1|Y+4TS2|1|X
595NR_4.0_63520.1
Exact match
synthetic construct
4TU0|1|G (4TU0)
  • 2'-5' OLIGOADENYLATE TRIMER
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.3 Å2(2) 4TU0|1|G, 4TU0|1|F
596NR_4.0_72820.1
Exact match
Limbella pachyloma
4TUE|1|QV (4TUE)
  • P-site tRNA-fMet
  • X-RAY DIFFRACTION
  • Chain(s): QV; model(s): 1
3.5 Å77(2) 4TUE|1|QV, 4TUE|1|XV
597NR_4.0_39792.1
Exact match
Escherichia coli
4U7U|1|X (4U7U)
  • crRNA
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.0 Å61(2) 4U7U|1|X, 4U7U|1|L
598NR_4.0_56633.2
Exact match
Escherichia coli
4UY8|1|V (4UY8)
  • RNA
  • ELECTRON MICROSCOPY
  • Chain(s): V; model(s): 1
3.8 Å76(2) 4UY8|1|V, 3JBU|1|v
599NR_4.0_06715.2
Exact match
Sus scrofa
4V19|1|A (4V19)
  • MITORIBOSOMAL 16S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.4 Å1515(2) 4V19|1|A, 5AJ4|1|BA
600NR_4.0_34999.1
Exact match
Thermus thermophilus
4V4J|1|2 (4V4J)
  • E-site tRNA
  • X-RAY DIFFRACTION
  • Chain(s): 2; model(s): 1
3.8 Å75(2) 4V4J|1|2, 4V4I|1|0
601NR_4.0_54761.1
Exact match
Thermus thermophilus
4V5G|1|AY (4V5G)
  • A-SITE TRNA THR
  • X-RAY DIFFRACTION
  • Chain(s): AY; model(s): 1
3.6 Å69(2) 4V5G|1|AY, 4V5G|1|CY
602NR_4.0_79672.1
Exact match
Pectobacterium parmentieri
4V7M|1|AY (4V7M)
  • tRNA-Gln
  • X-RAY DIFFRACTION
  • Chain(s): AY; model(s): 1
3.5 Å75(2) 4V7M|1|AY, 4V7M|1|CY
603NR_4.0_71771.1
Exact match
Thermus thermophilus
4V83|1|CV (4V83)
  • domain 3 of PSIC IGR IRES RNA
  • X-RAY DIFFRACTION
  • Chain(s): CV; model(s): 1
3.5 Å35(2) 4V83|1|CV, 4V83|1|AV
604NR_4.0_51196.1
Exact match
Thermus thermophilus
4V84|1|CV (4V84)
  • RNA (34-MER)
  • X-RAY DIFFRACTION
  • Chain(s): CV; model(s): 1
3.4 Å34(2) 4V84|1|CV, 4V84|1|AV
605NR_4.0_86129.1
Exact match
synthetic construct
4V85|1|AV (4V85)
  • messenger RNA
  • X-RAY DIFFRACTION
  • Chain(s): AV; model(s): 1
3.2 Å6(2) 4V85|1|AV, 4V89|1|AV
606NR_4.0_40314.1
Exact match
Escherichia coli
4V9I|1|CY (4V9I)
  • A-SITE tRNA
  • X-RAY DIFFRACTION
  • Chain(s): CY; model(s): 1
3.3 Å75(2) 4V9I|1|CY, 4V9I|1|AY
607NR_4.0_00626.1
Exact match
Bacillus subtilis
4W92|1|C (4W92)
  • C-di-AMP ribsoswitch
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.2 Å96(2) 4W92|1|C, 4W90|1|C
608NR_4.0_16754.1
Exact match
Homo sapiens
4WKR|1|D (4WKR)
  • 7SK GGHP4 (300-332)
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.2 Å5(2) 4WKR|1|D, 4WKR|1|C
609NR_4.0_55925.1
Exact match
Escherichia coli
4WSM|1|3L (4WSM)
  • tRNA-Leu
  • X-RAY DIFFRACTION
  • Chain(s): 3L; model(s): 1
3.3 Å75(2) 4WSM|1|3L, 4WSM|1|3K
610NR_4.0_97864.1
Exact match
synthetic construct
4WTD|1|T+4WTD|1|P (4WTD)
  • RNA PRIMER TEMPLATE AUAAAUUU
  • X-RAY DIFFRACTION
  • Chain(s): D, H, P, T; model(s): 1
2.7 Å8(2) 4WTD|1|T+4WTD|1|P, 5UJ2|1|T+5UJ2|1|P
611NR_4.0_13730.1
Exact match
Escherichia coli
4X9E|1|H (4X9E)
  • RNA (5'-R(P*CP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.1 Å3(2) 4X9E|1|H, 4X9E|1|G
612NR_4.0_69484.1
Exact match
Plautia stali intestine virus
4XEJ|1|BIRE (4XEJ)
  • IRES RNA
  • X-RAY DIFFRACTION
  • Chain(s): BIRE; model(s): 1
3.8 Å32(2) 4XEJ|1|BIRE, 4XEJ|1|AIRE
613NR_4.0_90795.3
Exact match
synthetic construct
4XLN|1|T (4XLN)
  • RNA (5'-D(P*UP*CP*GP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
4.0 Å4(2) 4XLN|1|T, 4XLN|1|Q
614NR_4.0_48352.1
Exact match
Actinomyces odontolyticus
4XWF|1|A (4XWF)
  • pfl RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.8 Å64(2) 4XWF|1|A, 4XW7|1|A
615NR_4.0_83641.1
Exact match
Escherichia coli
4Y1M|1|B (4Y1M)
  • E. coli yybP-ykoY riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å107(2) 4Y1M|1|B, 4Y1M|1|A
616NR_4.0_97050.1
Exact match
synthetic construct
4Y7N|1|R (4Y7N)
  • RNA (5'-D(*AP*UP*GP*GP*AP*GP*AP*GP*G)-3'[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.3 Å9(2) 4Y7N|1|R, 4Y52|1|R
617NR_4.0_39569.1
Exact match
Saccharomyces cerevisiae
4YYE|1|D (4YYE)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.3 Å74(2) 4YYE|1|D, 4YYE|1|C
618NR_4.0_98573.1
Exact match
synthetic construct
4Z0C|1|C (4Z0C)
  • DNA (5'-R(P*AP*CP*GP*GP*AP*AP*AP*GP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.3 Å13(2) 4Z0C|1|C, 4Z0C|1|B
619NR_4.0_80882.1
Exact match
Homo sapiens
4Z31|1|F (4Z31)
  • RNA (5'-R(*A)-D(P*UP*GP*UP*UP*CP*UP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.5 Å15(2) 4Z31|1|F, 4Z31|1|E
620NR_4.0_27625.1
Exact match
synthetic construct
4ZC7|1|C+4ZC7|1|D (4ZC7)
  • RNA duplex
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H; model(s): 1
3.0 Å21(2) 4ZC7|1|C+4ZC7|1|D, 4ZC7|1|A+4ZC7|1|B
621NR_4.0_45659.1
Exact match
synthetic construct
4ZNP|1|A (4ZNP)
  • pfI Riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å73(2) 4ZNP|1|A, 4ZNP|1|B
622NR_4.0_86148.1
Exact match
Escherichia coli
5A0T|1|F (5A0T)
  • 5'-R(*CP*GP*CP*CP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.3 Å6(2) 5A0T|1|F, 5A0T|1|E
623NR_4.0_60836.1
Exact match
Streptomyces coelicolor
5A0V|1|F (5A0V)
  • 5'-R(*CP*GP*CP*CP*UP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.8 Å6(2) 5A0V|1|F, 5A0V|1|E
624NR_4.0_03097.3
Exact match
Hepatitis C virus
5A2Q|1|3 (5A2Q)
  • HCV IRES
  • ELECTRON MICROSCOPY
  • Chain(s): 3; model(s): 1
3.9 Å257(2) 5A2Q|1|3, 5FLX|1|z
625NR_4.0_09775.1
Exact match
Agrobacterium tumefaciens
5AH5|1|C (5AH5)
  • TRNA-LEU TAA ISOACCEPTOR
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.1 Å80(2) 5AH5|1|C, 5AH5|1|D
626NR_4.0_71445.1
Exact match
Yersinia pseudotuberculosis
5AJ0|1|Bv (5AJ0)
  • tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): Bv; model(s): 1
3.5 Å76(2) 5AJ0|1|Bv, 5AJ0|1|Bw
627NR_4.0_19551.1
Exact match
Sus scrofa
5AJ3|1|A (5AJ3)
  • MITORIBOSOMAL 12S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.6 Å960(2) 5AJ3|1|A, 5AJ4|1|AA
628NR_4.0_52445.1
Exact match
California encephalitis orthobunyavirus
5AMR|1|B+5AMR|1|C (5AMR)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, H; model(s): 1
2.6 Å16(2) 5AMR|1|B+5AMR|1|C, 5AMQ|1|B+5AMQ|1|c
629NR_4.0_31135.1
Exact match
synthetic construct
5AOR|1|D (5AOR)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.1 Å10(2) 5AOR|1|D, 5AOR|1|C
630NR_4.0_59099.1
Exact match
synthetic construct
5AOX|1|C (5AOX)
  • ALU JO CONSENSUS RNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.0 Å86(2) 5AOX|1|C, 5AOX|1|F
631NR_4.0_43992.1
Exact match
synthetic construct
5AWH|1|E (5AWH)
  • RNA (5'-D(P*UP*UP*AP*CP*AP*AP*CP*CP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.0 Å18(2) 5AWH|1|E, 5AWH|1|C
632NR_4.0_74260.1
Exact match
Homo sapiens
5BTM|1|A (5BTM)
  • RNA (55-mer)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å43(2) 5BTM|1|A, 5BTM|1|B
633NR_4.0_76901.1
Exact match
synthetic construct
5BTP|1|A (5BTP)
  • RNA (62-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å62(2) 5BTP|1|A, 5BTP|1|B
634NR_4.0_74556.1
Exact match
synthetic construct
5BZV|1|B (5BZV)
  • RNA (5'-R(*UP*GP*UP*AP*CP*UP*AP*UP*A)-3'[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å9(2) 5BZV|1|B, 5BYM|1|C
635NR_4.0_56975.1
Exact match
synthetic construct
5CKK|1|D (5CKK)
  • RNA (5'-R(P*GP*CP*AP*CP*UP*AP*GP*AP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.8 Å15(2) 5CKK|1|D, 5CKI|1|D
636NR_4.0_02070.1
Exact match
Senecavirus A
5CNR|1|E+5CNR|1|F (5CNR)
  • RNA (5'-R(*GP*UP*CP*UP*AP*CP*CP*CP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, H; model(s): 1
2.6 Å16(2) 5CNR|1|E+5CNR|1|F, 5CNR|1|A+5CNR|1|B
637NR_4.0_96162.1
Exact match
Staphylococcus aureus
5CZZ|1|B (5CZZ)
  • RNA (73-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å73(2) 5CZZ|1|B, 5AXW|1|B
638NR_4.0_79481.1
Exact match
Trypanosoma brucei
5DA6|1|A (5DA6)
  • RNA (32-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å36(2) 5DA6|1|A, 4RBQ|1|A
639NR_4.0_67474.1
Exact match
Pyrococcus horikoshii
5DCV|1|D (5DCV)
  • RNA (47-MER)
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.4 Å46(2) 5DCV|1|D, 5DCV|1|B
640NR_4.0_16095.1
Exact match
Thermus thermophilus
5E17|1|I (5E17)
  • RNA (5'-R(*CP*CP*CP*UP*CP*GP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
3.2 Å7(2) 5E17|1|I, 5E18|1|I
641NR_4.0_32332.1
Exact match
Thermus thermophilus
5E81|1|3L (5E81)
  • tRNA-Lys
  • X-RAY DIFFRACTION
  • Chain(s): 3L; model(s): 1
3.0 Å72(2) 5E81|1|3L, 5E81|1|3K
642NR_4.0_45605.1
Exact match
Homo sapiens
5ED2|1|F+5ED2|1|E (5ED2)
  • RNA (5'-R(P*CP*AP*GP*AP*GP*CP*CP*CP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, H; model(s): 1
3.0 Å23(2) 5ED2|1|F+5ED2|1|E, 5ED2|1|C+5ED2|1|B
643NR_4.0_00179.1
Exact match
synthetic construct
5EIM|1|D (5EIM)
  • RNA (5'-R(*AP*UP*UP*AP*AP*AP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.5 Å8(2) 5EIM|1|D, 5EIM|1|C
644NR_4.0_09020.1
Exact match
synthetic construct
5ELT|1|F (5ELT)
  • RNA (5'-R(P*UP*AP*AP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.1 Å4(2) 5ELT|1|F, 5ELT|1|E
645NR_4.0_98669.1
Exact match
synthetic construct
5EV3|1|B (5EV3)
  • DNA/RNA (5'-R(P*UP*U)-D(P*U)-R(P*UP*U)-D[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.5 Å4(2) 5EV3|1|B, 5EV2|1|B
646NR_4.0_30433.1
Exact match
Homo sapiens
5EW4|1|B+5EW4|1|A (5EW4)
  • RNA (5'-R(*CP*CP*CP*CP*GP*GP*CP*CP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.5 Å21(2) 5EW4|1|B+5EW4|1|A, 5EW7|1|B+5EW7|1|A
647NR_4.0_86832.1
Exact match
Haloarcula marismortui
5FJ0|1|C (5FJ0)
  • HMKT-7
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.2 Å19(2) 5FJ0|1|C, 5FJ0|1|A+5FJ0|1|B
648NR_4.0_70895.1
Exact match
Haloarcula marismortui
5FJ4|1|H (5FJ4)
  • HMKT-7
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.0 Å35(2) 5FJ4|1|H, 5FJ4|1|D
649NR_4.0_78714.1
Exact match
Influenza B virus
5FMZ|1|V (5FMZ)
  • 5'-R(*AP*GP*UP*AP*GP*UP*AP*AP*CP*AP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): V; model(s): 1
3.4 Å12(2) 5FMZ|1|V, 5FMZ|1|H
650NR_4.0_07902.2
Exact match
Saccharomyces cerevisiae
5GAN|1|V+5GAN|1|W (5GAN)
  • Saccharomyces cerevisiae strain UOA_M2 c[...]
  • ELECTRON MICROSCOPY
  • Chain(s): D, H, V, W; model(s): 1
3.7 Å124(2) 5GAN|1|V+5GAN|1|W, 3JCM|1|E
651NR_4.0_86169.1
Exact match
synthetic construct
5HAB|1|D (5HAB)
  • RNA (5'-R(P*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.3 Å5(2) 5HAB|1|D, 5HAB|1|C
652NR_4.0_23118.1
Exact match
synthetic construct
5HBY|1|A (5HBY)
  • RNA (5'-R(*(LCC)P*(LCC)P*(LCC)P*(LCG)P*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.2 Å9(2) 5HBY|1|A, 5V0K|1|A
653NR_4.0_91027.1
Exact match
Mycobacterium tuberculosis
5HK0|1|F (5HK0)
  • RNA (5'-R(*AP*GP*UP*C)-D(P*U)-R(P*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.3 Å1(2) 5HK0|1|F, 5HK0|1|E
654NR_4.0_65615.1
Exact match
Escherichia coli
5HR6|1|C (5HR6)
  • tRNA Glu
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å68(2) 5HR6|1|C, 5HR6|1|D
655NR_4.0_42502.1
Exact match
Escherichia coli
5HR7|1|D (5HR7)
  • tRNA Glu
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å70(2) 5HR7|1|D, 5HR7|1|C
656NR_4.0_56203.1
Exact match
synthetic construct
5I4A|1|D (5I4A)
  • RNA (5'-R(*UP*AP*UP*AP*CP*AP*AP*CP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.0 Å13(2) 5I4A|1|D, 5I4A|1|B
657NR_4.0_67371.1
Exact match
Kluyveromyces lactis
5IT7|1|7 (5IT7)
  • 5S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 7; model(s): 1
3.6 Å121(2) 5IT7|1|7, 4V91|1|3
658NR_4.0_19209.1
Exact match
unidentified
5JAJ|1|X+5JAJ|1|Y (5JAJ)
  • RNA (5'-R(P*GP*GP*UP*AP*CP*GP*UP*AP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, H, X, Y; model(s): 1
1.5 Å13(2) 5JAJ|1|X+5JAJ|1|Y, 5JB2|1|X+5JB2|1|Y
659NR_4.0_80570.5
Exact match
synthetic construct
5JJU|1|C (5JJU)
  • RNA (5'-R(P*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.3 Å2(2) 5JJU|1|C, 4EJT|1|G
660NR_4.0_53587.1
Exact match
Escherichia coli
5JU8|1|AX (5JU8)
  • P-site tRNA Aspartate
  • ELECTRON MICROSCOPY
  • Chain(s): AX; model(s): 1
3.6 Å67(2) 5JU8|1|AX, 5JTE|1|AX
661NR_4.0_06870.1
Exact match
Escherichia coli
5JU8|1|AY (5JU8)
  • E-site tRNA Valine
  • ELECTRON MICROSCOPY
  • Chain(s): AY; model(s): 1
3.6 Å65(2) 5JU8|1|AY, 5JTE|1|AY
662NR_4.0_71651.1
Exact match
Saccharomyces cerevisiae
5K78|1|Y (5K78)
  • branch 1 of branched RNA 5'-UACUAA(2'-GU[...]
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.6 Å4(2) 5K78|1|Y, 5K78|1|X
663NR_4.0_33619.1
Exact match
Saccharomyces cerevisiae
5K78|1|y (5K78)
  • branch 2 of branched RNA 5'-UACUAA(2'-GU[...]
  • X-RAY DIFFRACTION
  • Chain(s): y; model(s): 1
2.6 Å5(2) 5K78|1|y, 5K78|1|x
664NR_4.0_23226.1
Exact match
metagenome
5KTJ|1|C (5KTJ)
  • Pistol (50-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.0 Å49(2) 5KTJ|1|C, 5KTJ|1|A
665NR_4.0_10362.1
Exact match
Enterobacteria phage lambda
5LM7|1|G (5LM7)
  • RNA (29-MER)
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
3.4 Å27(2) 5LM7|1|G, 5LM7|1|R
666NR_4.0_45609.1
Exact match
Saccharomyces cerevisiae
5MC6|1|m (5MC6)
  • A-site tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): m; model(s): 1
3.8 Å76(2) 5MC6|1|m, 5GAK|1|A
667NR_4.0_32990.1
Exact match
Saccharomyces cerevisiae
5MC6|1|n (5MC6)
  • P-site tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): n; model(s): 1
3.8 Å77(2) 5MC6|1|n, 5GAK|1|B
668NR_4.0_96354.1
Exact match
Spinacia oleracea
5MMM|1|a (5MMM)
  • 16S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): a; model(s): 1
3.4 Å1484(2) 5MMM|1|a, 5MMJ|1|a
669NR_4.0_67193.1
Exact match
Saccharomyces cerevisiae
5MRC|1|aa (5MRC)
  • 15S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): aa; model(s): 1
3.3 Å1501(2) 5MRC|1|aa, 5MRE|1|aa
670NR_4.0_25652.1
Exact match
Saccharomyces cerevisiae
5MRC|1|bb (5MRC)
  • tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): bb; model(s): 1
3.3 Å76(2) 5MRC|1|bb, 5MRE|1|bb
671NR_4.0_72335.1
Exact match
5MSF|1|R (5MSF)
  • 5'-R(*CP*CP*GP*GP*AP*GP*GP*AP*UP*CP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.8 Å18(2) 5MSF|1|R, 5MSF|1|S
672NR_4.0_36683.1
Exact match
Leishmania donovani
5T2A|1|A+5T2A|1|C (5T2A)
  • LSU-alpha
  • ELECTRON MICROSCOPY
  • Chain(s): A, C, D, H; model(s): 1
2.9 Å1603(2) 5T2A|1|A+5T2A|1|C, 3JCS|1|1+3JCS|1|7
673NR_4.0_69984.1
Exact match
Leishmania donovani
5T2A|1|D (5T2A)
  • 5S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
2.9 Å119(2) 5T2A|1|D, 3JCS|1|8
674NR_4.0_01258.1
Exact match
Leishmania donovani
5T2A|1|G (5T2A)
  • srRNA2
  • ELECTRON MICROSCOPY
  • Chain(s): G; model(s): 1
2.9 Å183(2) 5T2A|1|G, 3JCS|1|4
675NR_4.0_17605.2
Exact match
Plasmodium falciparum
5UMD|1|B (5UMD)
  • 5S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
3.2 Å118(2) 5UMD|1|B, 3J79|1|B
676NR_4.0_14902.1
Exact match
synthetic construct
5UX0|1|E (5UX0)
  • RNA (5'-R(*G*GP*UP*AP*CP*AP*AP*CP*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.2 Å18(2) 5UX0|1|E, 5UX0|1|B
677NR_4.0_60079.1
Exact match
Campylobacter jejuni
5X2G|1|B (5X2G)
  • sgRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å93(2) 5X2G|1|B, 5X2H|1|B
678NR_4.0_60411.1
Exact match
7MSF|1|R (7MSF)
  • 5'-R(*UP*CP*GP*CP*CP*AP*AP*CP*AP*GP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.8 Å14(2) 7MSF|1|R, 7MSF|1|S
679NR_4.0_76648.1
Exact match
1AV6|1|B (1AV6)
  • RNA (5'-R(*GP*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å6(1) 1AV6|1|B
680NR_4.0_34221.1
Exact match
Escherichia coli
1B23|1|R (1B23)
  • CYSTEINYL TRNA
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.6 Å66(1) 1B23|1|R
681NR_4.0_61964.1
Exact match
1B7F|1|P (1B7F)
  • RNA (5'-R(P*GP*UP*UP*GP*UP*UP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.6 Å12(1) 1B7F|1|P
682NR_4.0_09952.1
Exact match
1B7F|1|Q (1B7F)
  • RNA (5'-R(P*GP*UP*UP*GP*UP*UP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
2.6 Å12(1) 1B7F|1|Q
683NR_4.0_11198.1
Exact match
1BMV|1|M (1BMV)
  • RNA (5'-R(*GP*GP*UP*CP*AP*AP*AP*AP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
3.0 Å11(1) 1BMV|1|M
684NR_4.0_10796.1
Exact match
1BR3|1|A (1BR3)
  • RNA (5'-R(*GP*GP*AP*CP*AP*GP*AP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å13(1) 1BR3|1|A
685NR_4.0_55702.1
Exact match
1C9S|1|W (1C9S)
  • SINGLE STRANDED RNA (55-MER)
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
1.9 Å55(1) 1C9S|1|W
686NR_4.0_53157.1
Exact match
1CSL|1|B+1CSL|1|A (1CSL)
  • 5'-R(*UP*CP*UP*GP*AP*CP*GP*GP*UP*AP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.6 Å15(1) 1CSL|1|B+1CSL|1|A
687NR_4.0_85902.1
Exact match
1CVJ|1|M (1CVJ)
  • 5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
2.6 Å9(1) 1CVJ|1|M
688NR_4.0_87059.1
Exact match
1CVJ|1|Q (1CVJ)
  • 5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
2.6 Å9(1) 1CVJ|1|Q
689NR_4.0_05106.1
Exact match
1CWP|1|D (1CWP)
  • RNA (5'-R(*AP*UP*AP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.2 Å4(1) 1CWP|1|D
690NR_4.0_15685.1
Exact match
1CWP|1|F (1CWP)
  • RNA (5'-R(*AP*UP*AP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.2 Å4(1) 1CWP|1|F
691NR_4.0_03657.1
Exact match
1DDL|1|D (1DDL)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.7 Å7(1) 1DDL|1|D
692NR_4.0_14136.1
Exact match
1DFU|1|M+1DFU|1|N (1DFU)
  • 5S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): D, H, M, N; model(s): 1
1.8 Å19(1) 1DFU|1|M+1DFU|1|N
693NR_4.0_14653.1
Exact match
1DQF|1|B+1DQF|1|A (1DQF)
  • RNA (5'-R(*CP*AP*GP*GP*GP*UP*CP*GP*GP*C)[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
2.2 Å10(1) 1DQF|1|B+1DQF|1|A
694NR_4.0_57060.1
Exact match
1DQH|1|B+1DQH|1|A (1DQH)
  • RNA (5'-R(*CP*AP*GP*GP*GP*UP*CP*GP*GP*C)[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.7 Å10(1) 1DQH|1|B+1DQH|1|A
695NR_4.0_99432.1
Exact match
1DUH|1|A (1DUH)
  • 4.5S RNA DOMAIN IV
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å44(1) 1DUH|1|A
696NR_4.0_76196.1
Exact match
Homo sapiens
1E8O|1|E (1E8O)
  • 7SL RNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.2 Å49(1) 1E8O|1|E
697NR_4.0_19932.1
Exact match
Homo sapiens
1E8S|1|C (1E8S)
  • 7SL RNA, 88-MER
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
4.0 Å86(1) 1E8S|1|C
698NR_4.0_94113.1
Exact match
1EC6|1|C (1EC6)
  • 20-MER RNA HAIRPIN
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.4 Å20(1) 1EC6|1|C
699NR_4.0_53294.1
Exact match
1EC6|1|D (1EC6)
  • 20-MER RNA HAIRPIN
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å20(1) 1EC6|1|D
700NR_4.0_73942.1
Exact match
1EFO|1|B (1EFO)
  • RNA (5'-R(*GP*AP*AP*GP*AP*GP*AP*GP*AP*G)[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å10(1) 1EFO|1|B
701NR_4.0_74421.1
Exact match
1F1T|1|A (1F1T)
  • MALACHITE GREEN APTAMER RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å33(1) 1F1T|1|A
702NR_4.0_16825.1
Exact match
1F27|1|A (1F27)
  • RNA (5'-R(*AP*CP*CP*GP*UP*CP*AP*GP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.3 Å19(1) 1F27|1|A
703NR_4.0_08337.1
Exact match
Pariacoto virus
1F8V|1|R (1F8V)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.0 Å25(1) 1F8V|1|R
704NR_4.0_90775.1
Exact match
Bos taurus
1FIR|1|A (1FIR)
  • HIV-1 REVERSE TRANSCRIPTION PRIMER TRNA([...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.3 Å62(1) 1FIR|1|A
705NR_4.0_92759.1
Exact match
1FIX|1|A (1FIX)
  • RNA (5'-R(*UP*UP*CP*GP*GP*GP*CP*GP*CP*C)[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å10(1) 1FIX|1|A
706NR_4.0_58357.1
Exact match
Thermus thermophilus
1FJG|1|X (1FJG)
  • FRAGMENT OF MESSENGER RNA
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.0 Å6(1) 1FJG|1|X
707NR_4.0_50004.1
Exact match
1FXL|1|B (1FXL)
  • 5'-R(P*UP*UP*UP*UP*AP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å9(1) 1FXL|1|B
708NR_4.0_13125.1
Exact match
1G1X|1|D+1G1X|1|E (1G1X)
  • 16S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): D, E, H; model(s): 1
2.6 Å40(1) 1G1X|1|D+1G1X|1|E
709NR_4.0_40657.1
Exact match
1G1X|1|J+1G1X|1|I (1G1X)
  • 16S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): D, H, I, J; model(s): 1
2.6 Å44(1) 1G1X|1|J+1G1X|1|I
710NR_4.0_88266.1
Exact match
1G2E|1|B (1G2E)
  • 5'-R(P*UP*AP*UP*UP*UP*AP*UP*UP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å10(1) 1G2E|1|B
711NR_4.0_36794.1
Exact match
1G2J|1|A (1G2J)
  • 5'-R(*CP*CP*CP*(PYY)P*GP*GP*GP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å7(1) 1G2J|1|A
712NR_4.0_84424.1
Exact match
1GTN|1|W (1GTN)
  • (GAGCC)11G 56-NUCLEOTIDE RNA
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
2.5 Å44(1) 1GTN|1|W
713NR_4.0_13221.1
Exact match
Thermus thermophilus
1H3E|1|B (1H3E)
  • WILD-TYPE TRNATYR(GUA)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å80(1) 1H3E|1|B
714NR_4.0_82681.1
Exact match
1HMH|1|A (1HMH)
  • HAMMERHEAD RIBOZYME-RNA STRAND
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.6 Å34(1) 1HMH|1|A
715NR_4.0_23180.1
Exact match
1HYS|1|E (1HYS)
  • 5'-R(*UP*CP*AP*GP*CP*CP*AP*CP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.0 Å23(1) 1HYS|1|E
716NR_4.0_77921.1
Exact match
1I6H|1|R (1I6H)
  • 5'-R(P*GP*AP*CP*CP*AP*GP*GP*CP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.3 Å9(1) 1I6H|1|R
717NR_4.0_16044.1
Exact match
1I9X|1|A+1I9X|1|B (1I9X)
  • 5'-R(*UP*AP*CP*UP*AP*AP*CP*GP*UP*AP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
2.2 Å13(1) 1I9X|1|A+1I9X|1|B
718NR_4.0_70420.1
Exact match
1J1U|1|B (1J1U)
  • tRNA(Tyr)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å74(1) 1J1U|1|B
719NR_4.0_26846.1
Exact match
1JBR|1|C+1JBR|1|F (1JBR)
  • 5'-R(*GP*CP*GP*CP*UP*CP*CP*UP*CP*AP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, H; model(s): 1
2.2 Å17(1) 1JBR|1|C+1JBR|1|F
720NR_4.0_26264.1
Exact match
1JID|1|B (1JID)
  • HELIX 6 OF HUMAN SRP RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å26(1) 1JID|1|B
721NR_4.0_64635.1
Exact match
1KD4|1|A+1KD4|1|B (1KD4)
  • 5'-R(*GP*GP*UP*CP*AP*CP*AP*GP*CP*CP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.9 Å11(1) 1KD4|1|A+1KD4|1|B
722NR_4.0_38877.1
Exact match
1KFO|1|A (1KFO)
  • 5'-R(*GP*AP*AP*UP*GP*CP*CP*UP*GP*CP*GP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.6 Å18(1) 1KFO|1|A
723NR_4.0_15417.1
Exact match
1KH6|1|A (1KH6)
  • JIIIabc
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å42(1) 1KH6|1|A
724NR_4.0_18162.1
Exact match
1KQ2|1|R (1KQ2)
  • 5'-R(*AP*UP*UP*UP*UP*UP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.7 Å7(1) 1KQ2|1|R
725NR_4.0_26998.1
Exact match
1KXK|1|A (1KXK)
  • ai5g group II Self-splicing intron
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å70(1) 1KXK|1|A
726NR_4.0_32544.1
Exact match
1LNT|1|A+1LNT|1|B (1LNT)
  • 5'-R(*GP*CP*GP*UP*CP*AP*GP*GP*UP*CP*(CBV[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.7 Å11(1) 1LNT|1|A+1LNT|1|B
727NR_4.0_40126.1
Exact match
1M8W|1|E (1M8W)
  • 5'-R(P*UP*UP*GP*UP*CP*CP*AP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.2 Å8(1) 1M8W|1|E
728NR_4.0_93459.1
Exact match
1M8W|1|F (1M8W)
  • 5'-R(P*UP*GP*UP*CP*CP*AP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.2 Å7(1) 1M8W|1|F
729NR_4.0_39003.1
Exact match
1MHK|1|L+1MHK|1|S (1MHK)
  • RNA 14-mer BCh12
  • X-RAY DIFFRACTION
  • Chain(s): D, H, L, S; model(s): 1
2.5 Å14(1) 1MHK|1|L+1MHK|1|S
730NR_4.0_99181.1
Exact match
1MSW|1|R (1MSW)
  • RNA message
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.1 Å10(1) 1MSW|1|R
731NR_4.0_46884.1
Exact match
1MZP|1|B (1MZP)
  • fragment of 23S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å55(1) 1MZP|1|B
732NR_4.0_92778.1
Exact match
1N1H|1|B (1N1H)
  • 5'-R(*AP*UP*UP*AP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å4(1) 1N1H|1|B
733NR_4.0_13358.1
Exact match
Thermus thermophilus
1N32|1|Y+1N32|1|Z (1N32)
  • ANTICODON STEM-LOOP OF LEU-2 TRANSFER RN[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, H, Y, Z; model(s): 1
3.0 Å14(1) 1N32|1|Y+1N32|1|Z
734NR_4.0_65818.1
Exact match
Thermus thermophilus
1N33|1|Y+1N33|1|Z (1N33)
  • ANTICODON STEM-LOOP OF SER TRANSFER RNA
  • X-RAY DIFFRACTION
  • Chain(s): D, H, Y, Z; model(s): 1
3.4 Å10(1) 1N33|1|Y+1N33|1|Z
735NR_4.0_57770.1
Exact match
1N35|1|C+1N35|1|B (1N35)
  • 5'-R(*AP*UP*UP*AP*GP*CP*CP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, H; model(s): 1
2.5 Å8(1) 1N35|1|C+1N35|1|B
736NR_4.0_11290.1
Exact match
1N38|1|C+1N38|1|B (1N38)
  • 5'-R(*AP*UP*UP*AP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, H; model(s): 1
2.8 Å5(1) 1N38|1|C+1N38|1|B
737NR_4.0_10469.1
Exact match
1P79|1|A (1P79)
  • 5'-R(*UP*GP*UP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å5(1) 1P79|1|A
738NR_4.0_28964.1
Exact match
1PGL|1|3 (1PGL)
  • 5'-R(*AP*GP*UP*CP*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): 3; model(s): 1
2.8 Å6(1) 1PGL|1|3
739NR_4.0_30844.1
Exact match
1QC0|1|B+1QC0|1|A (1QC0)
  • 5'-R(GP*CP*AP*CP*CP*GP*CP*UP*AP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.6 Å10(1) 1QC0|1|B+1QC0|1|A
740NR_4.0_51076.1
Exact match
1QC0|1|C+1QC0|1|D (1QC0)
  • 5'-R(*GP*CP*AP*CP*CP*GP*UP*UP*GP*GP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H; model(s): 1
1.6 Å19(1) 1QC0|1|C+1QC0|1|D
741NR_4.0_23784.1
Exact match
1QCU|1|A+1QCU|1|B (1QCU)
  • 5'-R(P*GP*GP*GP*GP*GP*GP*GP*GP*GP*GP*G)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.2 Å11(1) 1QCU|1|A+1QCU|1|B
742NR_4.0_20366.1
Exact match
1QCU|1|C+1QCU|1|D (1QCU)
  • 5'-R(P*CP*CP*CP*CP*CP*CP*CP*CP*CP*CP*C)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H; model(s): 1
1.2 Å11(1) 1QCU|1|C+1QCU|1|D
743NR_4.0_85174.1
Exact match
Escherichia coli
1QF6|1|B (1QF6)
  • THREONINE TRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å69(1) 1QF6|1|B
744NR_4.0_27378.1
Exact match
1QLN|1|R (1QLN)
  • RNA (5- R(PPP*GP*GP*G)-3)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.4 Å2(1) 1QLN|1|R
745NR_4.0_03445.1
Exact match
1QVF|1|3 (1QVF)
  • Deacylated tRNA minihelix
  • X-RAY DIFFRACTION
  • Chain(s): 3; model(s): 1
3.1 Å12(1) 1QVF|1|3
746NR_4.0_22464.1
Exact match
1R3E|1|C (1R3E)
  • 5'-R(*CP*UP*GP*UP*GP*UP*(FHU)P*CP*GP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.1 Å16(1) 1R3E|1|C
747NR_4.0_43901.1
Exact match
1R3E|1|D+1R3E|1|E (1R3E)
  • 5'-R(*CP*UP*GP*UP*GP*UP*UP*CP*GP*AP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, E, H; model(s): 1
2.1 Å17(1) 1R3E|1|D+1R3E|1|E
748NR_4.0_01598.1
Exact match
1R9F|1|B (1R9F)
  • 5'-R(*CP*GP*UP*AP*CP*GP*CP*GP*GP*AP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å20(1) 1R9F|1|B
749NR_4.0_42973.1
Exact match
1R9F|1|C (1R9F)
  • 5'-R(*UP*CP*GP*AP*AP*GP*UP*AP*UP*UP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.9 Å20(1) 1R9F|1|C
750NR_4.0_51826.1
Exact match
1RNA|1|A+1RNA|1|B (1RNA)
  • RNA (5'-R(*UP*UP*AP*UP*AP*UP*AP*UP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
2.3 Å14(1) 1RNA|1|A+1RNA|1|B
751NR_4.0_95110.1
Exact match
1RPU|1|C+1RPU|1|D (1RPU)
  • 5'-R(P*CP*GP*UP*AP*CP*GP*CP*GP*UP*CP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H; model(s): 1
2.5 Å42(1) 1RPU|1|C+1RPU|1|D
752NR_4.0_06780.1
Exact match
1S03|1|A (1S03)
  • 47-MER
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å47(1) 1S03|1|A
753NR_4.0_07004.1
Exact match
1S03|1|B (1S03)
  • 47-MER
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å47(1) 1S03|1|B
754NR_4.0_85719.1
Exact match
1S76|1|R (1S76)
  • RNA (5'-R(P*AP*CP*AP*CP*GP*GP*CP*GP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.9 Å9(1) 1S76|1|R
755NR_4.0_98913.1
Exact match
1S77|1|R (1S77)
  • RNA (5'-R(*AP*CP*AP*CP*GP*GP*CP*GP*AP*(3[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.7 Å9(1) 1S77|1|R
756NR_4.0_03470.1
Exact match
Thermus thermophilus
1SER|1|T (1SER)
  • TRNASER
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.9 Å62(1) 1SER|1|T
757NR_4.0_16373.1
Exact match
1SI2|1|B (1SI2)
  • 5'-R(*CP*GP*UP*GP*AP*CP*U)-D(P*CP*T)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å7(1) 1SI2|1|B
758NR_4.0_56046.1
Exact match
1SI3|1|B (1SI3)
  • 5'-R(*CP*GP*UP*GP*AP*CP*UP*CP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å9(1) 1SI3|1|B
759NR_4.0_72697.1
Exact match
1T0E|1|A+1T0E|1|C (1T0E)
  • 5'-R(*GP*GP*UP*GP*GP*UP*GP*AP*AP*GP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, C, D, H; model(s): 1
1.7 Å21(1) 1T0E|1|A+1T0E|1|C
760NR_4.0_47291.1
Exact match
1T0K|1|D+1T0K|1|C (1T0K)
  • 5'-R(*G*GP*AP*CP*GP*CP*AP*GP*AP*GP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H; model(s): 1
3.2 Å15(1) 1T0K|1|D+1T0K|1|C
761NR_4.0_12093.1
Exact match
1TFW|1|G+1TFW|1|J (1TFW)
  • 5'-R(*GP*CP*GP*GP*AP*UP*CP*CP*GP*CP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, G, H, J; model(s): 1
2.2 Å13(1) 1TFW|1|G+1TFW|1|J
762NR_4.0_84898.1
Exact match
1TFY|1|G+1TFY|1|J (1TFY)
  • 5'-R(*CP*GP*GP*AP*UP*CP*CP*GP*CP*AP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, G, H, J; model(s): 1
3.2 Å11(1) 1TFY|1|G+1TFY|1|J
763NR_4.0_83386.1
Exact match
Escherichia coli
1U0B|1|A (1U0B)
  • Cysteinyl-tRNA synthetase
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å74(1) 1U0B|1|A
764NR_4.0_72627.1
Exact match
1U9S|1|A (1U9S)
  • RIBONUCLEASE P
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å155(1) 1U9S|1|A
765NR_4.0_67852.1
Exact match
1URN|1|P (1URN)
  • RNA (5'-R(*AP*AP*UP*CP*CP*AP*UP*UP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
1.9 Å20(1) 1URN|1|P
766NR_4.0_96260.1
Exact match
1UTD|1|1 (1UTD)
  • 5'-R(*GP*UP*UP*UP*GP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): 1; model(s): 1
2.1 Å3(1) 1UTD|1|1
767NR_4.0_35535.1
Exact match
1VQ6|1|4 (1VQ6)
  • 5'-R(*CP*(5AA)*(HFA))-3'
  • X-RAY DIFFRACTION
  • Chain(s): 4; model(s): 1
2.7 Å1(1) 1VQ6|1|4
768NR_4.0_28222.1
Exact match
1VQL|1|4 (1VQL)
  • 5'-R(*CP*CP*(PPU)*(TSE)*(DA)*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): 4; model(s): 1
2.3 Å4(1) 1VQL|1|4
769NR_4.0_56657.1
Exact match
1VQM|1|4 (1VQM)
  • 5'-R(*CP*CP*(PPU)P*(PO2)P*(DA)P*C*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): 4; model(s): 1
2.3 Å4(1) 1VQM|1|4
770NR_4.0_63152.1
Exact match
1VQN|1|4 (1VQN)
  • 5'-R(*CP*CP*(PPU)*(LOF))-3'
  • X-RAY DIFFRACTION
  • Chain(s): 4; model(s): 1
2.4 Å2(1) 1VQN|1|4
771NR_4.0_41538.1
Exact match
1WNE|1|B+1WNE|1|C (1WNE)
  • 5'-R(*CP*AP*UP*GP*GP*GP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, H; model(s): 1
3.0 Å8(1) 1WNE|1|B+1WNE|1|C
772NR_4.0_08212.1
Exact match
1XJR|1|A (1XJR)
  • s2m RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å46(1) 1XJR|1|A
773NR_4.0_82938.1
Exact match
1XNQ|1|X+1XNQ|1|W (1XNQ)
  • Anticodon tRNA
  • X-RAY DIFFRACTION
  • Chain(s): D, H, W, X; model(s): 1
3.1 Å10(1) 1XNQ|1|X+1XNQ|1|W
774NR_4.0_56744.1
Exact match
1XNR|1|X+1XNR|1|W (1XNR)
  • Anticodon tRNA
  • X-RAY DIFFRACTION
  • Chain(s): D, H, W, X; model(s): 1
3.1 Å10(1) 1XNR|1|X+1XNR|1|W
775NR_4.0_30667.1
Exact match
1XOK|1|A (1XOK)
  • alfalfa mosaic virus RNA 3' UTR
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å27(1) 1XOK|1|A
776NR_4.0_88088.1
Exact match
Staphylococcus phage Twort
1Y0Q|1|A (1Y0Q)
  • Group I ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.6 Å229(1) 1Y0Q|1|A
777NR_4.0_48365.1
Exact match
1Y1Y|1|P (1Y1Y)
  • 5'-R(P*AP*GP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
4.0 Å4(1) 1Y1Y|1|P
778NR_4.0_69516.1
Exact match
Vibrio vulnificus
1Y26|1|X (1Y26)
  • Vibrio vulnificus A-riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.1 Å71(1) 1Y26|1|X
779NR_4.0_70496.1
Exact match
Bacillus subtilis
1Y27|1|X (1Y27)
  • Bacillus subtilis xpt
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.4 Å68(1) 1Y27|1|X
780NR_4.0_08150.1
Exact match
1YVP|1|G (1YVP)
  • Y RNA sequence, first strand
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.2 Å5(1) 1YVP|1|G
781NR_4.0_10769.1
Exact match
1YVP|1|H (1YVP)
  • Y RNA sequence, first strand
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.2 Å7(1) 1YVP|1|H
782NR_4.0_29659.1
Exact match
1YZ9|1|C+1YZ9|1|D+1YZ9|1|E+1YZ9|1|F (1YZ9)
  • 5'-R(*CP*GP*AP*AP*CP*UP*UP*CP*GP*CP*G)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, H; model(s): 1
2.1 Å11(1) 1YZ9|1|C+1YZ9|1|D+1YZ9|1|E+1YZ9|1|F
783NR_4.0_38795.1
Exact match
1YZD|1|A+1YZD|1|B (1YZD)
  • RNA 5'-R(*GP*CP*AP*GP*AP*(A5M)P*UP*UP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, H; model(s): 1
2.4 Å15(1) 1YZD|1|A+1YZD|1|B
784NR_4.0_89129.1
Exact match
1Z7F|1|B+1Z7F|1|C (1Z7F)
  • 5'-R(*GP*CP*AP*GP*AP*CP*UP*UP*AP*AP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, H; model(s): 1
2.1 Å16(1) 1Z7F|1|B+1Z7F|1|C
785NR_4.0_55496.1
Exact match
205D|1|A+205D|1|B (205D)
  • RNA (5'-R(*GP*GP*AP*CP*UP*UP*UP*GP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, H; model(s): 1
2.6 Å12(1) 205D|1|A+205D|1|B
786NR_4.0_04676.1
Exact match
246D|1|A+246D|1|B (246D)
  • DNA/RNA (5'-R(*GP*UP*AP*UP*AP*UP*AP*)-D([...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, H; model(s): 1
2.2 Å7(1) 246D|1|A+246D|1|B
787NR_4.0_19715.1
Exact match
255D|1|A (255D)
  • RNA (5'-R(*GP*GP*AP*CP*UP*UP*CP*GP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å12(1) 255D|1|A
788NR_4.0_36371.1
Exact match
283D|1|A (283D)
  • RNA (5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å12(1) 283D|1|A
789NR_4.0_08420.1
Exact match
2A43|1|A (2A43)
  • RNA Pseudoknot
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.3 Å26(1) 2A43|1|A
790NR_4.0_03631.1
Exact match
2A64|1|A (2A64)
  • ribonuclease P RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.3 Å298(1) 2A64|1|A
791NR_4.0_95023.1
Exact match
Escherichia coli
2A8V|1|D (2A8V)
  • 5'-R(P*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å3(1) 2A8V|1|D
792NR_4.0_73018.1
Exact match
2A8V|1|E (2A8V)
  • 5'-R(P*CP*CP*CP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.4 Å6(1) 2A8V|1|E
793NR_4.0_37298.1
Exact match
2ASB|1|B (2ASB)
  • ribosomal RNA (5'- GAACUCAAUAG -3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.5 Å11(1) 2ASB|1|B
794NR_4.0_21689.1
Exact match
2B3J|1|G (2B3J)
  • anticodon stem-loop of t-RNA-Arg2 (nucle[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.0 Å7(1) 2B3J|1|G
795NR_4.0_49799.1
Exact match
2B63|1|R (2B63)
  • 31-MER
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.8 Å27(1) 2B63|1|R
796NR_4.0_54448.1
Exact match
2BBV|1|N (2BBV)
  • RNA (5'-R(*UP*CP*UP*UP*AP*UP*AP*UP*CP*U)[...]
  • X-RAY DIFFRACTION
  • Chain(s): N; model(s): 1
2.8 Å10(1) 2BBV|1|N
797NR_4.0_00896.1
Exact match
2BX2|1|R (2BX2)
  • RNA (5'-R(*UP*UP*UP*AP*CP*AP*GP*UP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.9 Å14(1) 2BX2|1|R
798NR_4.0_37879.1
Exact match
synthetic construct
2C0B|1|R (2C0B)
  • 5'-R(*UP*UP*UP*AP*CP*AP*GP*UP*AP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.2 Å10(1) 2C0B|1|R
799NR_4.0_29005.1
Exact match
Escherichia coli
2C4R|1|R (2C4R)
  • SSRNA MOLECULE: 5'-R(*AP*CP*AP*GP*UP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.6 Å10(1) 2C4R|1|R
800NR_4.0_83181.1
Exact match
2DLC|1|Y (2DLC)
  • T-RNA (76-MER)
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.4 Å64(1) 2DLC|1|Y
801NR_4.0_10954.1
Exact match
2E9R|1|A+2E9R|1|B (2E9R)
  • 5'-R(*CP*AP*UP*GP*GP*GP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, H; model(s): 1
2.8 Å9(1) 2E9R|1|A+2E9R|1|B
802NR_4.0_62003.1
Exact match
2E9Z|1|B+2E9Z|1|C (2E9Z)
  • 5'-R(*CP*AP*UP*GP*GP*GP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, H; model(s): 1
3.0 Å9(1) 2E9Z|1|B+2E9Z|1|C
803NR_4.0_78107.1
Exact match
Thermus thermophilus
2F4V|1|Z (2F4V)
  • 5'-R(P*UP*UP*CP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
3.8 Å4(1) 2F4V|1|Z
804NR_4.0_32676.1
Exact match
2F8K|1|B (2F8K)
  • 5'-R(*UP*AP*AP*UP*CP*UP*UP*UP*GP*AP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å16(1) 2F8K|1|B
805NR_4.0_59799.1
Exact match
2F8S|1|C+2F8S|1|D (2F8S)
  • 5'-R(P*AP*GP*AP*CP*AP*GP*CP*AP*UP*AP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, H; model(s): 1
3.0 Å22(1) 2F8S|1|C+2F8S|1|D
806NR_4.0_89224.1
Exact match
2F8T|1|C+2F8T|1|D (2F8T)
  • 26-MER
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, H; model(s): 1
3.1 Å26(1) 2F8T|1|C+2F8T|1|D
807NR_4.0_26733.1
Exact match
2G4B|1|B (2G4B)
  • 5'-R(P*UP*UP*UP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å7(1) 2G4B|1|B
808NR_4.0_79446.1
Exact match
2G91|1|A+2G91|1|B (2G91)
  • 5'-R(*GP*GP*UP*GP*CP*GP*CP*(CBR)P*C-3'
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, H; model(s): 1
1.5 Å8(1) 2G91|1|A+2G91|1|B
809NR_4.0_39119.1
Exact match
2G92|1|A+2G92|1|B (2G92)
  • 5'-R(*CP*GP*CP*(NF2)P*AP*AP*UP*UP*AP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, H; model(s): 1
1.6 Å11(1) 2G92|1|A+2G92|1|B
810NR_4.0_81464.1
Exact match
2GJE|1|R (2GJE)
  • guide RNA 40-mer
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.4 Å13(1) 2GJE|1|R
811NR_4.0_78802.1
Exact match
2GJE|1|S (2GJE)
  • RNA tetramer
  • X-RAY DIFFRACTION
  • Chain(s): S; model(s): 1
3.4 Å5(1) 2GJE|1|S
812NR_4.0_32399.1
Exact match
2GTT|1|W (2GTT)
  • RNA (99-MER)
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
3.5 Å99(1) 2GTT|1|W
813NR_4.0_80684.1
Exact match
2GTT|1|X (2GTT)
  • RNA (99-MER)
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.5 Å99(1) 2GTT|1|X
814NR_4.0_53424.1
Exact match
2GUN|1|B (2GUN)
  • 5'-R(*GP*AP*AP*GP*AP*AP*GP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å10(1) 2GUN|1|B
815NR_4.0_76177.1
Exact match
2GXB|1|E+2GXB|1|F (2GXB)
  • 5'-R(P*(DU)P*CP*GP*CP*GP*CP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, H; model(s): 1
2.3 Å6(1) 2GXB|1|E+2GXB|1|F
816NR_4.0_03515.1
Exact match
2HT1|1|M (2HT1)
  • 5'-R(*UP*CP*UP*CP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
3.5 Å5(1) 2HT1|1|M
817NR_4.0_99751.1
Exact match
2HVY|1|E (2HVY)
  • H/ACA RNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.3 Å61(1) 2HVY|1|E
818NR_4.0_96380.1
Exact match
2IX1|1|B (2IX1)
  • 5'-D(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP *AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å13(1) 2IX1|1|B
819NR_4.0_37861.1
Exact match
2JA6|1|P (2JA6)
  • 5'-R(*UP*UP*CP*GP*AP*CP*CP*AP*GP*GP*AP)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
4.0 Å10(1) 2JA6|1|P
820NR_4.0_06823.1
Exact match
synthetic construct
2JA8|1|P (2JA8)
  • 5'-R(*UP*UP*CP*GP*AP*CP*CP*AP*GP*AP*UP)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.8 Å10(1) 2JA8|1|P
821NR_4.0_77683.1
Exact match
2JEA|1|C (2JEA)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.3 Å7(1) 2JEA|1|C
822NR_4.0_33835.1
Exact match
Escherichia coli
2JLT|1|A (2JLT)
  • R06
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å17(1) 2JLT|1|A
823NR_4.0_80987.1
Exact match
2NUE|1|C (2NUE)
  • 46-MER
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å46(1) 2NUE|1|C
824NR_4.0_26402.1
Exact match
2NUG|1|E+2NUG|1|F+2NUG|1|C+2NUG|1|D (2NUG)
  • 5'-R(P*AP*GP*UP*GP*GP*CP*CP*UP*UP*GP*C)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, H; model(s): 1
1.7 Å13(1) 2NUG|1|E+2NUG|1|F+2NUG|1|C+2NUG|1|D
825NR_4.0_48589.1
Exact match
2O3V|1|A+2O3V|1|B (2O3V)
  • RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, H; model(s): 1
2.8 Å22(1) 2O3V|1|A+2O3V|1|B
826NR_4.0_73746.1
Exact match
2OE5|1|B+2OE5|1|A (2OE5)
  • RNA (5'-R(*GP*GP*UP*AP*CP*UP*AP*AP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, H; model(s): 1
1.5 Å17(1) 2OE5|1|B+2OE5|1|A
827NR_4.0_60142.1
Exact match
2OIU|1|P (2OIU)
  • L1 Ribozyme RNA Ligase
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.6 Å71(1) 2OIU|1|P
828NR_4.0_36247.1
Exact match
2OIU|1|Q (2OIU)
  • L1 Ribozyme RNA Ligase
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
2.6 Å71(1) 2OIU|1|Q
829NR_4.0_68957.1
Exact match
2PJP|1|B (2PJP)
  • SECIS RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å23(1) 2PJP|1|B
830NR_4.0_32733.1
Exact match
2PO1|1|C (2PO1)
  • 10-mer poly(A)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.9 Å7(1) 2PO1|1|C
831NR_4.0_23233.1
Exact match
2Q66|1|X (2Q66)
  • 5'-R(P*AP*AP*AP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
1.8 Å5(1) 2Q66|1|X
832NR_4.0_73487.1
Exact match
2QK9|1|B (2QK9)
  • 5'-R(*AP*GP*UP*GP*CP*GP*AP*CP*AP*CP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å18(1) 2QK9|1|B
833NR_4.0_99291.1
Exact match
2QKB|1|C (2QKB)
  • 5'-R(*GP*GP*AP*GP*UP*GP*CP*GP*AP*CP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.4 Å19(1) 2QKB|1|C
834NR_4.0_46239.1
Exact match
2R7S|1|X (2R7S)
  • RNA (5'-R(*UP*GP*UP*GP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.2 Å6(1) 2R7S|1|X
835NR_4.0_46386.1
Exact match
2R7T|1|X (2R7T)
  • RNA (5'-R(*UP*GP*UP*GP*AP*AP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.0 Å7(1) 2R7T|1|X
836NR_4.0_37940.1
Exact match
2R7U|1|X (2R7U)
  • RNA (5'-R(*AP*A*AP*AP*GP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.1 Å5(1) 2R7U|1|X
837NR_4.0_70523.1
Exact match
2R7V|1|X (2R7V)
  • RNA (5'-R(*G*GP*CP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.8 Å5(1) 2R7V|1|X
838NR_4.0_52785.1
Exact match
2R7Z|1|P (2R7Z)
  • 5'-R(*UP*UP*UP*GP*AP*GP*GP*AP*GP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.8 Å10(1) 2R7Z|1|P
839NR_4.0_50660.1
Exact match
2R92|1|T+2R92|1|P (2R92)
  • RNA (5'-R(*CP*UP*UP*GP*AP*CP*GP*CP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H, P, T; model(s): 1
3.8 Å10(1) 2R92|1|T+2R92|1|P
840NR_4.0_83556.1
Exact match
2R93|1|R (2R93)
  • RNA (5'-R(*UP*GP*AP*UP*UP*CP*UP*CP*UP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
4.0 Å14(1) 2R93|1|R
841NR_4.0_48282.1
Exact match
2RFK|1|E+2RFK|1|D+2RFK|1|F (2RFK)
  • guide RNA 2
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, H; model(s): 1
2.9 Å26(1) 2RFK|1|E+2RFK|1|D+2RFK|1|F
842NR_4.0_71302.1
Exact match
2UXB|1|Y+2UXB|1|X (2UXB)
  • ANTICODON STEM-LOOP OF TRANSFER RNA WITH[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, F, H, X, Y; model(s): 1
3.1 Å7(1) 2UXB|1|Y+2UXB|1|X
843NR_4.0_07184.1
Exact match
synthetic construct
2UXC|1|X+2UXC|1|Y (2UXC)
  • A-SITE MESSENGER RNA FRAGMENT CGGG
  • X-RAY DIFFRACTION
  • Chain(s): D, F, H, X, Y; model(s): 1
2.9 Å9(1) 2UXC|1|X+2UXC|1|Y
844NR_4.0_12173.1
Exact match
2UXD|1|Y+2UXD|1|X (2UXD)
  • A-SITE MESSENGER RNA FRAGMENT CGGG
  • X-RAY DIFFRACTION
  • Chain(s): D, F, H, X, Y; model(s): 1
3.2 Å8(1) 2UXD|1|Y+2UXD|1|X
845NR_4.0_29312.1
Exact match
Escherichia coli
2V6W|1|A+2V6W|1|B (2V6W)
  • 5'-R(*GP*GP*AP*GP*AP*GP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
1.8 Å7(1) 2V6W|1|A+2V6W|1|B
846NR_4.0_65010.1
Exact match
Homo sapiens
2V7R|1|A+2V7R|1|B (2V7R)
  • HUMAN TRNAGLY MICROHELIX
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
1.2 Å7(1) 2V7R|1|A+2V7R|1|B
847NR_4.0_30422.1
Exact match
Saccharomyces cerevisiae
2VNU|1|B (2VNU)
  • 5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å10(1) 2VNU|1|B
848NR_4.0_49650.1
Exact match
Homo sapiens
2VOP|1|B (2VOP)
  • 5'-R(*AP*UP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å5(1) 2VOP|1|B
849NR_4.0_99944.1
Exact match
Escherichia coli
2VRT|1|G (2VRT)
  • 5'-R(*UP*UP*GP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
3.5 Å3(1) 2VRT|1|G
850NR_4.0_03143.1
Exact match
Escherichia coli
2VRT|1|H (2VRT)
  • 5'-R(*UP*UP*GP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.5 Å3(1) 2VRT|1|H
851NR_4.0_01515.1
Exact match
2VUM|1|P (2VUM)
  • 5'-R(*AP*AP*AP*GP*AP*CP*CP*AP*GP*GP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.4 Å10(1) 2VUM|1|P
852NR_4.0_06107.1
Exact match
Homo sapiens
2VUQ|1|A+2VUQ|1|B (2VUQ)
  • 5'-R(*GP*CP*AP*UP*UP*GP*GP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
1.2 Å7(1) 2VUQ|1|A+2VUQ|1|B
853NR_4.0_62870.1
Exact match
synthetic construct
2XB2|1|E (2XB2)
  • RNA POLY-U-RIBONUCLEOTIDE
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.4 Å8(1) 2XB2|1|E
854NR_4.0_43421.1
Exact match
synthetic construct
2XB2|1|R (2XB2)
  • RNA POLY-U-RIBONUCLEOTIDE
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.4 Å7(1) 2XB2|1|R
855NR_4.0_45692.1
Exact match
2XBM|1|E+2XBM|1|F (2XBM)
  • 5'-(*G3AP*GP*AP*AP*CP*CP*UP*GP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, H; model(s): 1
2.9 Å8(1) 2XBM|1|E+2XBM|1|F
856NR_4.0_27904.1
Exact match
2XD0|1|W (2XD0)
  • TOXI
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
3.0 Å35(1) 2XD0|1|W
857NR_4.0_11258.1
Exact match
2XGJ|1|C (2XGJ)
  • RNA (5'-(*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å5(1) 2XGJ|1|C
858NR_4.0_74135.1
Exact match
2XGJ|1|D (2XGJ)
  • RNA (5'-(*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.9 Å5(1) 2XGJ|1|D
859NR_4.0_24558.1
Exact match
Saccharomyces cerevisiae
2XNR|1|C (2XNR)
  • 5'-R(*UP*UP*CP*UP*UP*AP*UP*UP*CP*UP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.6 Å5(1) 2XNR|1|C
860NR_4.0_00973.1
Exact match
Mus musculus
2XS2|1|B (2XS2)
  • 5'-R(*UP*UP*GP*UP*UP*CP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.4 Å7(1) 2XS2|1|B
861NR_4.0_12819.1
Exact match
Mus musculus
2XS7|1|B (2XS7)
  • 5'-R(*UP*UP*GP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.5 Å5(1) 2XS7|1|B
862NR_4.0_75793.1
Exact match
synthetic construct
2XZO|1|D (2XZO)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å7(1) 2XZO|1|D
863NR_4.0_87252.1
Exact match
2Y8W|1|B (2Y8W)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å19(1) 2Y8W|1|B
864NR_4.0_78183.1
Exact match
2Y8Y|1|B (2Y8Y)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.4 Å18(1) 2Y8Y|1|B
865NR_4.0_42560.1
Exact match
2ZI0|1|C+2ZI0|1|D (2ZI0)
  • RNA (5'-D(P*AP*GP*AP*CP*AP*GP*CP*AP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, H; model(s): 1
2.8 Å20(1) 2ZI0|1|C+2ZI0|1|D
866NR_4.0_94226.1
Exact match
2ZKO|1|C+2ZKO|1|D (2ZKO)
  • RNA (5'-R(P*AP*GP*AP*CP*AP*GP*CP*AP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, H; model(s): 1
1.7 Å21(1) 2ZKO|1|C+2ZKO|1|D
867NR_4.0_78506.1
Exact match
2ZY6|1|A (2ZY6)
  • phenylalanyl transfer RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.8 Å38(1) 2ZY6|1|A
868NR_4.0_98075.1
Exact match
2ZZM|1|B (2ZZM)
  • RNA (84-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å84(1) 2ZZM|1|B
869NR_4.0_57636.1
Exact match
315D|1|A+315D|1|B (315D)
  • DNA/RNA (5'-R(*GP*UP*AP*UP*GP*UP*AP*)-D([...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
1.4 Å7(1) 315D|1|A+315D|1|B
870NR_4.0_98880.1
Exact match
332D|1|A+332D|1|B (332D)
  • DNA/RNA (5'-R(*GP*UP*GP*UP*GP*UP*AP*)-D([...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
1.6 Å7(1) 332D|1|A+332D|1|B
871NR_4.0_12322.1
Exact match
333D|1|A (333D)
  • RNA (5'-R(*CP*GP*CP*AP*IP*GP*CP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.5 Å7(1) 333D|1|A
872NR_4.0_99060.1
Exact match
353D|1|A+353D|1|B (353D)
  • RNA (5'-R(*AP*UP*CP*CP*CP*CP*CP*GP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
2.4 Å12(1) 353D|1|A+353D|1|B
873NR_4.0_63943.1
Exact match
Escherichia coli
354D|1|A+354D|1|B (354D)
  • RNA (5'-R(*CP*CP*GP*AP*UP*GP*GP*UP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
1.5 Å12(1) 354D|1|A+354D|1|B
874NR_4.0_73526.1
Exact match
361D|1|A (361D)
  • RNA (5'-R(*CP*UP*GP*GP*GP*CP*GP*GP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å20(1) 361D|1|A
875NR_4.0_70550.1
Exact match
361D|1|B (361D)
  • RNA (5'-R(*CP*UP*GP*GP*GP*CP*GP*GP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å20(1) 361D|1|B
876NR_4.0_96653.1
Exact match
387D|1|A (387D)
  • RNA Pseudoknot
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å26(1) 387D|1|A
877NR_4.0_45442.1
Exact match
397D|1|A+397D|1|B (397D)
  • RNA (5'-R(*GP*GP*CP*CP*AP*GP*AP*UP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
1.3 Å15(1) 397D|1|A+397D|1|B
878NR_4.0_93513.1
Exact match
3ADI|1|D+3ADI|1|E (3ADI)
  • RNA (5'-R(P*CP*UP*CP*GP*AP*UP*AP*AP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, H; model(s): 1
3.2 Å10(1) 3ADI|1|D+3ADI|1|E
879NR_4.0_39323.1
Exact match
3ADL|1|B+3ADL|1|C (3ADL)
  • RNA (5'-R(P*CP*GP*CP*GP*CP*GP*CP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, H; model(s): 1
2.2 Å10(1) 3ADL|1|B+3ADL|1|C
880NR_4.0_65768.1
Exact match
3AEV|1|C (3AEV)
  • RNA (5'-R(*GP*GP*AP*UP*CP*AP*CP*CP*UP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å11(1) 3AEV|1|C
881NR_4.0_75304.1
Exact match
3AHU|1|X (3AHU)
  • 5'-R(*AP*GP*AP*GP*AP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.2 Å6(1) 3AHU|1|X
882NR_4.0_13919.1
Exact match
3AM1|1|B (3AM1)
  • ASL-truncated tRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å81(1) 3AM1|1|B
883NR_4.0_75747.1
Exact match
3AVT|1|T (3AVT)
  • RNA (5'-R(*AP*UP*CP*GP*CP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.6 Å4(1) 3AVT|1|T
884NR_4.0_29245.1
Exact match
3AVU|1|T+3AVU|1|G (3AVU)
  • RNA (5'-R(*AP*UP*CP*GP*UP*GP*GP*AP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, F, G, H, T; model(s): 1
2.9 Å9(1) 3AVU|1|T+3AVU|1|G
885NR_4.0_26115.1
Exact match
3AVV|1|T+3AVV|1|G (3AVV)
  • RNA (5'-R(*AP*AP*CP*GP*AP*UP*GP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, F, G, H, T; model(s): 1
3.1 Å11(1) 3AVV|1|T+3AVV|1|G
886NR_4.0_55371.1
Exact match
3AVW|1|T+3AVW|1|G (3AVW)
  • RNA (5'-R(*AP*UP*CP*GP*UP*GP*GP*AP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, F, G, H, T; model(s): 1
2.6 Å12(1) 3AVW|1|T+3AVW|1|G
887NR_4.0_51980.1
Exact match
3AVX|1|T+3AVX|1|G (3AVX)
  • RNA (5'-R(*AP*AP*CP*GP*AP*UP*GP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, F, G, H, T; model(s): 1
2.4 Å13(1) 3AVX|1|T+3AVX|1|G
888NR_4.0_09827.1
Exact match
3AVY|1|T+3AVY|1|G (3AVY)
  • RNA (5'-R(*AP*AP*CP*GP*AP*UP*UP*UP*UP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, F, G, H, T; model(s): 1
2.6 Å14(1) 3AVY|1|T+3AVY|1|G
889NR_4.0_21191.1
Exact match
3BNT|1|A (3BNT)
  • A site of human mitochondrial ribosome
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å21(1) 3BNT|1|A
890NR_4.0_09764.1
Exact match
3BOY|1|D (3BOY)
  • 5'-R(*UP*UP*UP*AP*GP*UP*UP*UP*UP*UP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.7 Å22(1) 3BOY|1|D
891NR_4.0_76670.1
Exact match
3BSB|1|C (3BSB)
  • 5'-R(*UP*UP*UP*AP*AP*UP*GP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å9(1) 3BSB|1|C
892NR_4.0_17852.1
Exact match
3CGR|1|B+3CGR|1|A (3CGR)
  • RNA (5'-R(*CP*GP*CP*AP*CP*UP*AP*AP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
2.1 Å13(1) 3CGR|1|B+3CGR|1|A
893NR_4.0_46216.1
Exact match
3CGS|1|B+3CGS|1|A (3CGS)
  • RNA (5'-R(*CP*GP*CP*UP*AP*CP*UP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
1.7 Å13(1) 3CGS|1|B+3CGS|1|A
894NR_4.0_17773.1
Exact match
3CIY|1|C+3CIY|1|D (3CIY)
  • 46-MER
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, H; model(s): 1
3.4 Å46(1) 3CIY|1|C+3CIY|1|D
895NR_4.0_96160.1
Exact match
3CJZ|1|A+3CJZ|1|B (3CJZ)
  • RNA (5'-R(*GP*GP*AP*CP*GP*(M2G)P*AP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
1.8 Å12(1) 3CJZ|1|A+3CJZ|1|B
896NR_4.0_98916.1
Exact match
3CZW|1|X (3CZW)
  • RNA (5'-R(*G*UP*GP*GP*UP*CP*UP*GP*AP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
1.4 Å15(1) 3CZW|1|X
897NR_4.0_33763.1
Exact match
3D0M|1|X (3D0M)
  • RNA (5'-R(*GP*UP*GP*GP*UP*CP*UP*GP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.0 Å16(1) 3D0M|1|X
898NR_4.0_76733.1
Exact match
3DD2|1|B (3DD2)
  • RNA (26-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å15(1) 3DD2|1|B
899NR_4.0_82016.1
Exact match
3DHS|1|A (3DHS)
  • RNase P RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.6 Å215(1) 3DHS|1|A
900NR_4.0_39268.1
Exact match
synthetic construct
3E2E|1|R (3E2E)
  • RNA (5'-R(*GP*GP*GP*AP*GP*UP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.0 Å7(1) 3E2E|1|R
901NR_4.0_30439.1
Exact match
3EGZ|1|B (3EGZ)
  • Tetracycline aptamer and artificial ribo[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å65(1) 3EGZ|1|B
902NR_4.0_62752.1
Exact match
3EQT|1|C+3EQT|1|D (3EQT)
  • 5'-R(*GP*CP*GP*CP*GP*CP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, H; model(s): 1
2.0 Å8(1) 3EQT|1|C+3EQT|1|D
903NR_4.0_61097.1
Exact match
3ER8|1|F (3ER8)
  • RNA/DNA chimera 5'-R(P*UP*UP*)D(C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.2 Å2(1) 3ER8|1|F
904NR_4.0_40973.1
Exact match
3ERC|1|G (3ERC)
  • RNA/DNA chimera (5'-D(CP*)R(UP*UP*)-D(C)[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
3.2 Å2(1) 3ERC|1|G
905NR_4.0_80904.1
Exact match
3FHT|1|C (3FHT)
  • RNA (5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.2 Å6(1) 3FHT|1|C
906NR_4.0_15144.1
Exact match
3FHT|1|D (3FHT)
  • RNA (5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.2 Å6(1) 3FHT|1|D
907NR_4.0_55153.1
Exact match
3FS0|1|B+3FS0|1|A (3FS0)
  • 5'-R(*CP*CP*AP*GP*UP*CP*GP*GP*AP*AP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
2.3 Å11(1) 3FS0|1|B+3FS0|1|A
908NR_4.0_55295.1
Exact match
3FTE|1|C+3FTE|1|D (3FTE)
  • 5'-R(P*AP*AP*CP*CP*GP*UP*AP*GP*GP*GP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, H; model(s): 1
3.0 Å22(1) 3FTE|1|C+3FTE|1|D
909NR_4.0_25813.1
Exact match
3FTF|1|C+3FTF|1|D (3FTF)
  • 5'-R(P*AP*AP*CP*CP*GP*UP*AP*GP*GP*GP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, H; model(s): 1
2.8 Å22(1) 3FTF|1|C+3FTF|1|D
910NR_4.0_69076.1
Exact match
3G0H|1|E (3G0H)
  • 5'-R(P*UP*UP*UP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.7 Å7(1) 3G0H|1|E
911NR_4.0_49451.1
Exact match
3G9Y|1|C (3G9Y)
  • RNA (5'-R(*AP*GP*GP*UP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.4 Å8(1) 3G9Y|1|C
912NR_4.0_82961.1
Exact match
3GIB|1|H (3GIB)
  • 5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.4 Å9(1) 3GIB|1|H
913NR_4.0_24791.1
Exact match
3GS5|1|A (3GS5)
  • RNA (25-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å27(1) 3GS5|1|A
914NR_4.0_24663.1
Exact match
3GS5|1|C (3GS5)
  • RNA (36-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å36(1) 3GS5|1|C
915NR_4.0_93052.1
Exact match
3GTG|1|R (3GTG)
  • RNA (5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.8 Å12(1) 3GTG|1|R
916NR_4.0_70269.1
Exact match
3GTK|1|R (3GTK)
  • DNA/RNA (5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.8 Å13(1) 3GTK|1|R
917NR_4.0_74183.1
Exact match
3GTL|1|R (3GTL)
  • RNA (5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.4 Å12(1) 3GTL|1|R
918NR_4.0_48000.1
Exact match
3GTO|1|R (3GTO)
  • RNA (5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
4.0 Å12(1) 3GTO|1|R
919NR_4.0_28179.1
Exact match
3GTP|1|R (3GTP)
  • RNA (5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.9 Å13(1) 3GTP|1|R
920NR_4.0_69936.1
Exact match
3GTQ|1|R (3GTQ)
  • RNA (5'-R(P*AP*UP*CP*GP*AP*GP*AP*GP*GP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.8 Å11(1) 3GTQ|1|R
921NR_4.0_80567.1
Exact match
3GVN|1|A+3GVN|1|B (3GVN)
  • 5'-R(*GP*GP*UP*GP*AP*GP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
1.2 Å7(1) 3GVN|1|A+3GVN|1|B
922NR_4.0_86975.1
Exact match
3H3V|1|P (3H3V)
  • 5'-D(*CP*AP*GP*CP*TP*AP*CP*TP*TP*GP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
4.0 Å8(1) 3H3V|1|P
923NR_4.0_34126.1
Exact match
3HAX|1|E (3HAX)
  • H/ACA RNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.1 Å60(1) 3HAX|1|E
924NR_4.0_44916.1
Exact match
3HJF|1|Y (3HJF)
  • 5'-R(*CP*AP*AP*CP*CP*UP*AP*CP*UP*AP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
3.1 Å15(1) 3HJF|1|Y
925NR_4.0_79502.1
Exact match
3HJY|1|D+3HJY|1|C+3HJY|1|E (3HJY)
  • RNA (25-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, H; model(s): 1
3.7 Å25(1) 3HJY|1|D+3HJY|1|C+3HJY|1|E
926NR_4.0_57417.1
Exact match
3HO1|1|Y (3HO1)
  • 5'-R(P*CP*CP*UP*AP*CP*UP*AP*CP*CP*UP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.6 Å12(1) 3HO1|1|Y
927NR_4.0_33750.1
Exact match
3HOV|1|P (3HOV)
  • 5'-R(*UP*GP*CP*AP*UP*UP*UP*CP*GP*AP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.5 Å10(1) 3HOV|1|P
928NR_4.0_40852.1
Exact match
3HOY|1|P (3HOY)
  • 5'-R(*UP*AP*UP*AP*UP*GP*CP*A*UP*AP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.4 Å10(1) 3HOY|1|P
929NR_4.0_63409.1
Exact match
3HOZ|1|P (3HOZ)
  • 5'-R(*UP*GP*CP*AP*UP*UP*U*CP*AP*AP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.7 Å11(1) 3HOZ|1|P
930NR_4.0_23301.1
Exact match
3HSB|1|X (3HSB)
  • RNA (5'-R(*AP*GP*AP*GP*AP*GP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.2 Å7(1) 3HSB|1|X
931NR_4.0_38973.1
Exact match
3I4M|1|P (3I4M)
  • RNA (5'-R(*UP*GP*CP*AP*UP*C*UP*UP*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.7 Å10(1) 3I4M|1|P
932NR_4.0_83504.1
Exact match
3I4N|1|P (3I4N)
  • RNA (5'-R(*UP*GP*CP*AP*UP*C*UP*UP*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.9 Å10(1) 3I4N|1|P
933NR_4.0_01806.1
Exact match
3IAB|1|R (3IAB)
  • P3 domain of the RNA component of RNase [...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.7 Å46(1) 3IAB|1|R
934NR_4.0_07832.1
Exact match
3IBK|1|A (3IBK)
  • RNA (5'-R(*(5BU)P*AP*GP*GP*GP*UP*UP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.2 Å11(1) 3IBK|1|A
935NR_4.0_70081.1
Exact match
3IBK|1|B (3IBK)
  • RNA (5'-R(*(5BU)P*AP*GP*GP*GP*UP*UP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å11(1) 3IBK|1|B
936NR_4.0_78175.1
Exact match
3ICE|1|G (3ICE)
  • 5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.8 Å6(1) 3ICE|1|G
937NR_4.0_65401.1
Exact match
3IEV|1|D (3IEV)
  • 5'-R(P*AP*UP*CP*AP*CP*CP*UP*CP*CP*UP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.9 Å12(1) 3IEV|1|D
938NR_4.0_40208.1
Exact match
Tobacco mosaic virus
3J06|1|R (3J06)
  • 5'-R(P*AP*UP*G)-3'
  • ELECTRON MICROSCOPY
  • Chain(s): R; model(s): 1
3.3 Å3(1) 3J06|1|R
939NR_4.0_16888.1
Exact match
Saccharomyces cerevisiae
3J6B|1|e (3J6B)
  • E-site tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): e; model(s): 1
3.2 Å20(1) 3J6B|1|e
940NR_4.0_30486.1
Exact match
Plasmodium falciparum
3J7A|1|7 (3J7A)
  • tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 7; model(s): 1
3.2 Å74(1) 3J7A|1|7
941NR_4.0_33067.1
Exact match
Plasmodium falciparum
3J7A|1|A (3J7A)
  • 18S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.2 Å1608(1) 3J7A|1|A
942NR_4.0_73958.1
Exact match
Sus scrofa
3J7R|1|S5 (3J7R)
  • A/P tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): S5; model(s): 1
3.9 Å74(1) 3J7R|1|S5
943NR_4.0_39469.1
Exact match
Sus scrofa
3J7R|1|S6 (3J7R)
  • P/E tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): S6; model(s): 1
3.9 Å76(1) 3J7R|1|S6
944NR_4.0_03720.1
Exact match
Sus scrofa
3J92|1|2 (3J92)
  • tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
3.6 Å74(1) 3J92|1|2
945NR_4.0_31938.1
Exact match
Homo sapiens
3J9M|1|AA (3J9M)
  • 12S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): AA; model(s): 1
3.5 Å923(1) 3J9M|1|AA
946NR_4.0_71142.1
Exact match
Bacillus subtilis
3J9W|1|AA (3J9W)
  • 16S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): AA; model(s): 1
3.9 Å1544(1) 3J9W|1|AA
947NR_4.0_52833.1
Exact match
Bacillus subtilis
3J9W|1|AX (3J9W)
  • tRNA-Asp
  • ELECTRON MICROSCOPY
  • Chain(s): AX; model(s): 1
3.9 Å77(1) 3J9W|1|AX
948NR_4.0_41610.2
Exact match
Bacillus subtilis
3J9W|1|BA (3J9W)
  • 23S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): BA; model(s): 1
3.9 Å2923(1) 3J9W|1|BA
949NR_4.0_49897.1
Exact match
Bacillus subtilis
3J9W|1|BB (3J9W)
  • 5S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): BB; model(s): 1
3.9 Å112(1) 3J9W|1|BB
950NR_4.0_37313.1
Exact match
Cypovirus 1
3JB7|1|t+3JB7|1|m (3JB7)
  • RNA (5'-R(P*GP*GP*GP*GP*GP*G)-3')
  • ELECTRON MICROSCOPY
  • Chain(s): D, E, H, m, t; model(s): 1
4.0 Å6(1) 3JB7|1|t+3JB7|1|m
951NR_4.0_87230.1
Exact match
Schizosaccharomyces pombe
3JB9|1|C (3JB9)
  • U5 snRNA
  • ELECTRON MICROSCOPY
  • Chain(s): C; model(s): 1
3.6 Å105(1) 3JB9|1|C
952NR_4.0_76442.1
Exact match
Schizosaccharomyces pombe
3JB9|1|N+3JB9|1|P (3JB9)
  • U6 snRNA
  • ELECTRON MICROSCOPY
  • Chain(s): D, E, H, N, P; model(s): 1
3.6 Å90(1) 3JB9|1|N+3JB9|1|P
953NR_4.0_09916.1
Exact match
synthetic construct
3JBU|1|X (3JBU)
  • mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): X; model(s): 1
3.6 Å11(1) 3JBU|1|X
954NR_4.0_97214.1
Exact match
synthetic construct
3JBV|1|W (3JBV)
  • RNA (75-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): W; model(s): 1
3.3 Å75(1) 3JBV|1|W
955NR_4.0_81791.1
Exact match
Leishmania donovani
3JCS|1|2 (3JCS)
  • 26S delta ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
2.8 Å1093(1) 3JCS|1|2
956NR_4.0_40535.1
Exact match
Leishmania donovani
3JCS|1|3 (3JCS)
  • 26S gamma ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 3; model(s): 1
2.8 Å184(1) 3JCS|1|3
957NR_4.0_35448.1
Exact match
Leishmania donovani
3JCS|1|5 (3JCS)
  • 26S epsilon ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 5; model(s): 1
2.8 Å80(1) 3JCS|1|5
958NR_4.0_03414.1
Exact match
Leishmania donovani
3JCS|1|6 (3JCS)
  • 26S zeta ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 6; model(s): 1
2.8 Å61(1) 3JCS|1|6
959NR_4.0_45853.1
Exact match
Saccharomyces cerevisiae
3JCT|1|6 (3JCT)
  • ITS2-1 miscRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 6; model(s): 1
3.1 Å65(1) 3JCT|1|6
960NR_4.0_76204.1
Exact match
3K5Q|1|B (3K5Q)
  • 5'-R(P*UP*GP*UP*AP*CP*UP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å9(1) 3K5Q|1|B
961NR_4.0_26816.1
Exact match
3K5Z|1|B (3K5Z)
  • 5'-R(*UP*GP*UP*AP*CP*CP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å9(1) 3K5Z|1|B
962NR_4.0_14980.1
Exact match
3K61|1|B (3K61)
  • 5'-R(*UP*GP*UP*AP*AP*AP*AP*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å9(1) 3K61|1|B
963NR_4.0_85762.1
Exact match
3K62|1|B (3K62)
  • 5'-R(*UP*GP*UP*GP*UP*UP*AP*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å9(1) 3K62|1|B
964NR_4.0_52626.1
Exact match
3K64|1|B (3K64)
  • 5'-R(*UP*GP*UP*GP*UP*CP*AP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å9(1) 3K64|1|B
965NR_4.0_35816.1
Exact match
3KMQ|1|B+3KMQ|1|C (3KMQ)
  • RNA (5'-R(P*GP*GP*GP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, H; model(s): 1
2.1 Å5(1) 3KMQ|1|B+3KMQ|1|C
966NR_4.0_40545.1
Exact match
3KNC|1|B (3KNC)
  • 5'-R(*CP*GP*CP*UP*AP*CP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å8(1) 3KNC|1|B
967NR_4.0_60357.1
Exact match
3KOA|1|B+3KOA|1|C (3KOA)
  • RNA (5'-R(P*AP*UP*GP*GP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, H; model(s): 1
2.4 Å6(1) 3KOA|1|B+3KOA|1|C
968NR_4.0_01810.1
Exact match
3KS8|1|E+3KS8|1|F (3KS8)
  • 5'-R(*AP*GP*AP*AP*GP*GP*AP*GP*GP*GP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, H; model(s): 1
2.4 Å18(1) 3KS8|1|E+3KS8|1|F
969NR_4.0_63265.1
Exact match
Bacillus subtilis
3LA5|1|A (3LA5)
  • Adenosine RIboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.7 Å71(1) 3LA5|1|A
970NR_4.0_35088.1
Exact match
3LOA|1|B+3LOA|1|A (3LOA)
  • 5'-R(*GP*GP*GP*(5BU)P*GP*GP*UP*GP*AP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, H; model(s): 1
2.3 Å22(1) 3LOA|1|B+3LOA|1|A
971NR_4.0_86182.1
Exact match
Spodoptera frugiperda
3LOB|1|R (3LOB)
  • RNA (5'-R(*UP*UP*U*AP*UP*CP*UP*(P))-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.6 Å7(1) 3LOB|1|R
972NR_4.0_44340.1
Exact match
3LRR|1|C+3LRR|1|D (3LRR)
  • RNA (5'-R(*(ATP)P*UP*AP*UP*AP*UP*AP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, H; model(s): 1
2.2 Å11(1) 3LRR|1|C+3LRR|1|D
973NR_4.0_80872.1
Exact match
3M3Y|1|R (3M3Y)
  • RNA (5'-R(*AP*UP*GP*GP*AP*GP*AP*GP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.2 Å11(1) 3M3Y|1|R
974NR_4.0_63879.1
Exact match
3M4O|1|R (3M4O)
  • RNA (5'-R(*AP*UP*GP*GP*AP*GP*AP*GP*GP*A)[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.6 Å10(1) 3M4O|1|R
975NR_4.0_13395.1
Exact match
3MDG|1|C (3MDG)
  • RNA (5'-R(*UP*UP*GP*UP*AP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.2 Å6(1) 3MDG|1|C
976NR_4.0_33509.1
Exact match
3MDI|1|C (3MDI)
  • RNA (5'-R(*UP*GP*UP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.1 Å6(1) 3MDI|1|C
977NR_4.0_86272.1
Exact match
3MEI|1|A+3MEI|1|B (3MEI)
  • RNA (5'-R(*CP*CP*GP*CP*CP*GP*CP*GP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, H; model(s): 1
2.0 Å22(1) 3MEI|1|A+3MEI|1|B
978NR_4.0_33458.1
Exact match
Homo sapiens
3MIJ|1|A (3MIJ)
  • RNA (5'-R(*UP*AP*GP*GP*GP*UP*UP*AP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.6 Å12(1) 3MIJ|1|A
979NR_4.0_38078.1
Exact match
3MJ0|1|B (3MJ0)
  • RNA (5'-R(*CP*GP*UP*UP*AP*CP*GP*CP*(OMU)[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å8(1) 3MJ0|1|B
980NR_4.0_88566.1
Exact match
Escherichia coli
3MOJ|1|A (3MOJ)
  • RNA (69-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å69(1) 3MOJ|1|A
981NR_4.0_96977.1
Exact match
3MQK|1|D+3MQK|1|E (3MQK)
  • RNA (5'-R(P*GP*UP*UP*CP*GP*AP*UP*CP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, E, H; model(s): 1
2.8 Å13(1) 3MQK|1|D+3MQK|1|E
982NR_4.0_42221.1
Exact match
3NCU|1|C+3NCU|1|D (3NCU)
  • 5'-R(*(GDP)P*AP*CP*GP*CP*UP*AP*GP*CP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, H; model(s): 1
2.6 Å11(1) 3NCU|1|C+3NCU|1|D
983NR_4.0_29649.1
Exact match
3ND3|1|A (3ND3)
  • 5'-R(*AP*GP*AP*GP*AP*AP*GP*AP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.4 Å16(1) 3ND3|1|A
984NR_4.0_82939.1
Exact match
3ND4|1|A (3ND4)
  • 5'-R(*AP*GP*AP*GP*AP*AP*GP*AP*UP*CP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.5 Å16(1) 3ND4|1|A
985NR_4.0_55424.1
Exact match
Homo sapiens
3NKB|1|B (3NKB)
  • The hepatitis delta virus ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å64(1) 3NKB|1|B
986NR_4.0_97629.1
Exact match
3NL0|1|B+3NL0|1|C (3NL0)
  • 5'-R(P*UP*GP*GP*GP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, H; model(s): 1
2.6 Å7(1) 3NL0|1|B+3NL0|1|C
987NR_4.0_72277.1
Exact match
3NMA|1|B+3NMA|1|C (3NMA)
  • 5'-R(*GP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, H; model(s): 1
2.6 Å3(1) 3NMA|1|B+3NMA|1|C
988NR_4.0_69142.1
Exact match
Homo sapiens
3NMR|1|B (3NMR)
  • RNA (5'-R(*GP*UP*UP*GP*UP*UP*UP*UP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å6(1) 3NMR|1|B
989NR_4.0_42633.1
Exact match
Homo sapiens
3NNA|1|B (3NNA)
  • RNA (5'-R(*GP*UP*UP*GP*UP*UP*UP*UP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å5(1) 3NNA|1|B
990NR_4.0_50067.1
Exact match
Homo sapiens
3NNC|1|B (3NNC)
  • RNA (5'-R(*UP*GP*UP*GP*UP*GP*UP*UP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å7(1) 3NNC|1|B
991NR_4.0_51631.1
Exact match
Homo sapiens
3NNH|1|E (3NNH)
  • RNA (5'-R(*GP*UP*UP*GP*UP*UP*UP*UP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.8 Å11(1) 3NNH|1|E
992NR_4.0_49747.1
Exact match
Homo sapiens
3NNH|1|F (3NNH)
  • RNA (5'-R(*GP*UP*UP*GP*UP*UP*UP*UP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.8 Å11(1) 3NNH|1|F
993NR_4.0_36867.1
Exact match
Fusobacterium nucleatum
3P49|1|A (3P49)
  • GLYCINE RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.6 Å169(1) 3P49|1|A
994NR_4.0_06254.1
Exact match
3P4C|1|A (3P4C)
  • 5'-R(*(CFZ)P*GP*(AF2)P*AP*(UFT)P*UP*(CFZ[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.2 Å6(1) 3P4C|1|A
995NR_4.0_56893.1
Exact match
3P59|1|E+3P59|1|A+3P59|1|C+3P59|1|G+3P59|1|B+3P59|1|D+3P59|1|F+3P59|1|H (3P59)
  • RNA (5'-R(*CP*CP*GP*GP*AP*GP*GP*AP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, E, F, G, H; model(s): 1
2.2 Å14(1) 3P59|1|E+3P59|1|A+3P59|1|C+3P59|1|G+3P59|1|B+3P59|1|D+3P59|1|F+3P59|1|H
996NR_4.0_15037.1
Exact match
3PF4|1|R (3PF4)
  • hexaribonucleotide (rGUCUUUA)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
1.4 Å8(1) 3PF4|1|R
997NR_4.0_16650.1
Exact match
3PKM|1|G (3PKM)
  • 5'-R(*AP*UP*UP*AP*CP*AP*AP*UP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
3.1 Å9(1) 3PKM|1|G
998NR_4.0_22156.1
Exact match
3PKM|1|R (3PKM)
  • 5'-R(P*UP*UP*AP*CP*AP*AP*UP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.1 Å9(1) 3PKM|1|R
999NR_4.0_16585.1
Exact match
3PO2|1|P (3PO2)
  • RNA product strand
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.3 Å15(1) 3PO2|1|P
1000NR_4.0_06721.1
Exact match
3PO3|1|P (3PO3)
  • RNA product strand
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.3 Å5(1) 3PO3|1|P
1001NR_4.0_85950.1
Exact match
3PTX|1|R (3PTX)
  • RNA (45-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.0 Å45(1) 3PTX|1|R
1002NR_4.0_25547.1
Exact match
3PU0|1|R (3PU0)
  • RNA (45-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.1 Å45(1) 3PU0|1|R
1003NR_4.0_29179.1
Exact match
3PU1|1|R (3PU1)
  • RNA (45-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.1 Å45(1) 3PU1|1|R
1004NR_4.0_10913.1
Exact match
3Q0L|1|C (3Q0L)
  • 5'-R(UP*GP*UP*AP*AP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.5 Å8(1) 3Q0L|1|C
1005NR_4.0_43560.1
Exact match
3Q0L|1|D (3Q0L)
  • 5'-R(UP*GP*UP*AP*AP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.5 Å8(1) 3Q0L|1|D
1006NR_4.0_97666.1
Exact match
3Q0Q|1|B (3Q0Q)
  • 5'-R(UP*GP*UP*AP*AP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å8(1) 3Q0Q|1|B
1007NR_4.0_17316.1
Exact match
3Q1Q|1|C (3Q1Q)
  • TRNA (PHE)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.8 Å86(1) 3Q1Q|1|C
1008NR_4.0_27264.1
Exact match
3Q2T|1|E (3Q2T)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.1 Å5(1) 3Q2T|1|E
1009NR_4.0_03885.1
Exact match
3Q2T|1|F (3Q2T)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.1 Å5(1) 3Q2T|1|F
1010NR_4.0_56560.1
Exact match
3QJJ|1|Q (3QJJ)
  • RNA (5'-R(*GP*UP*UP*GP*AP*AP*AP*UP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
2.8 Å12(1) 3QJJ|1|Q
1011NR_4.0_34353.1
Exact match
3QJJ|1|R (3QJJ)
  • RNA (5'-R(*GP*UP*UP*GP*AP*AP*AP*UP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.8 Å12(1) 3QJJ|1|R
1012NR_4.0_61711.1
Exact match
3QJP|1|R (3QJP)
  • RNA (5'-R(P*UP*AP*GP*UP*UP*UP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.3 Å8(1) 3QJP|1|R
1013NR_4.0_68652.1
Exact match
3QRP|1|B+3QRP|1|C (3QRP)
  • RNA (5'-R(*GP*UP*CP*CP*CP*CP*AP*CP*(PGP)[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H; model(s): 1
2.4 Å8(1) 3QRP|1|B+3QRP|1|C
1014NR_4.0_11957.1
Exact match
3QRQ|1|B (3QRQ)
  • RNA (5'-R(*GP*UP*CP*CP*CP*CP*AP*CP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.2 Å18(1) 3QRQ|1|B
1015NR_4.0_23218.1
Exact match
3QRR|1|B (3QRR)
  • RNA (5'-R(*GP*UP*CP*CP*CP*CP*AP*CP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.1 Å17(1) 3QRR|1|B
1016NR_4.0_80680.1
Exact match
3R1D|1|E (3R1D)
  • RNA (5'-R(*GP*CP*(GRB)P*GP*CP*GP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.5 Å15(1) 3R1D|1|E
1017NR_4.0_63209.1
Exact match
3R1E|1|A+3R1E|1|B (3R1E)
  • RNA (5'-R(*GP*CP*(GRB)P*GP*CP*GP*GP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
1.0 Å10(1) 3R1E|1|A+3R1E|1|B
1018NR_4.0_12608.1
Exact match
Aquifex aeolicus
3R2D|1|R+3R2D|1|S (3R2D)
  • 5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, R, S; model(s): 1
2.2 Å12(1) 3R2D|1|R+3R2D|1|S
1019NR_4.0_14758.1
Exact match
3R4F|1|A (3R4F)
  • pRNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.5 Å66(1) 3R4F|1|A
1020NR_4.0_38781.1
Exact match
3R9W|1|B (3R9W)
  • RNA301
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.1 Å34(1) 3R9W|1|B
1021NR_4.0_95874.1
Exact match
3R9X|1|C (3R9X)
  • RNA301
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å35(1) 3R9X|1|C
1022NR_4.0_71379.1
Exact match
3RC8|1|E (3RC8)
  • RNA fragment
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.9 Å6(1) 3RC8|1|E
1023NR_4.0_79804.1
Exact match
3RTJ|1|D (3RTJ)
  • RNA (5'-R(*AP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å2(1) 3RTJ|1|D
1024NR_4.0_35883.1
Exact match
3RZO|1|R (3RZO)
  • RNA (5'-R(*GP*AP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.0 Å4(1) 3RZO|1|R
1025NR_4.0_84359.1
Exact match
3S14|1|R (3S14)
  • RNA (5'-R(*GP*AP*GP*AP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.9 Å6(1) 3S14|1|R
1026NR_4.0_78065.1
Exact match
3S15|1|R (3S15)
  • RNA (5'-R(*CP*GP*AP*GP*AP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.3 Å7(1) 3S15|1|R
1027NR_4.0_18318.1
Exact match
3S16|1|R (3S16)
  • RNA (5'-R(*UP*CP*GP*AP*GP*AP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.2 Å8(1) 3S16|1|R
1028NR_4.0_04359.1
Exact match
3S1M|1|R (3S1M)
  • RNA (5'-R(*AP*GP*AP*CP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.1 Å5(1) 3S1M|1|R
1029NR_4.0_96728.1
Exact match
3S1N|1|R (3S1N)
  • RNA (5'-R(*AP*GP*AP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.1 Å5(1) 3S1N|1|R
1030NR_4.0_16634.1
Exact match
3S2D|1|R (3S2D)
  • RNA (5'-R(*AP*GP*GP*(5BU)P*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.2 Å4(1) 3S2D|1|R
1031NR_4.0_88937.1
Exact match
3S2H|1|R (3S2H)
  • RNA (5'-R(*AP*GP*AP*GP*GP*(2IA))-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.3 Å5(1) 3S2H|1|R
1032NR_4.0_62516.1
Exact match
3SJ2|1|A+3SJ2|1|B (3SJ2)
  • RNA (5'-R(*UP*UP*GP*GP*GP*CP*CP*GP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
1.4 Å19(1) 3SJ2|1|A+3SJ2|1|B
1033NR_4.0_75875.1
Exact match
3SN2|1|B (3SN2)
  • transferrin receptor iron regulatory ele[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å29(1) 3SN2|1|B
1034NR_4.0_17495.1
Exact match
3SSF|1|A (3SSF)
  • 5'-R(*UP*AP*AP*AP*AP*GP*AP*AP*AP*AP*GP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.6 Å21(1) 3SSF|1|A
1035NR_4.0_86744.1
Exact match
3SZX|1|A+3SZX|1|B (3SZX)
  • RNA (5'-R(P*UP*UP*GP*GP*GP*CP*CP*UP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.2 Å19(1) 3SZX|1|A+3SZX|1|B
1036NR_4.0_01981.1
Exact match
3T3O|1|B (3T3O)
  • O2'methyl-RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å1(1) 3T3O|1|B
1037NR_4.0_40189.1
Exact match
Hepatitis C virus
3T4B|1|A (3T4B)
  • HCV IRES pseudoknot domain plus crystall[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.6 Å83(1) 3T4B|1|A
1038NR_4.0_92104.1
Exact match
Escherichia coli
3T5Q|1|C (3T5Q)
  • RNA (5'-R(P*UP*UP*AP*UP*CP*UP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.0 Å8(1) 3T5Q|1|C
1039NR_4.0_18291.1
Exact match
Escherichia coli
3T5Q|1|D (3T5Q)
  • RNA (5'-R(P*UP*AP*UP*CP*UP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å7(1) 3T5Q|1|D
1040NR_4.0_78848.1
Exact match
Escherichia coli
3T5Q|1|F (3T5Q)
  • RNA (5'-R(P*UP*UP*AP*UP*CP*UP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.0 Å8(1) 3T5Q|1|F
1041NR_4.0_79660.1
Exact match
Escherichia coli
3T5Q|1|J (3T5Q)
  • RNA (5'-R(P*UP*UP*AP*UP*CP*UP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): J; model(s): 1
3.0 Å8(1) 3T5Q|1|J
1042NR_4.0_52761.1
Exact match
3TD0|1|B+3TD0|1|A (3TD0)
  • RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
1.6 Å22(1) 3TD0|1|B+3TD0|1|A
1043NR_4.0_21945.1
Exact match
3TS2|1|U (3TS2)
  • RNA (5'-R(*GP*GP*GP*GP*UP*CP*UP*AP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): U; model(s): 1
2.0 Å23(1) 3TS2|1|U
1044NR_4.0_32675.1
Exact match
3TS2|1|V (3TS2)
  • RNA (5'-R(*GP*GP*GP*GP*UP*CP*UP*AP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): V; model(s): 1
2.0 Å23(1) 3TS2|1|V
1045NR_4.0_83775.1
Exact match
Hepatitis C virus
3TZR|1|A+3TZR|1|B (3TZR)
  • 5'-R(*CP*GP*AP*GP*GP*AP*AP*CP*UP*AP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.2 Å20(1) 3TZR|1|A+3TZR|1|B
1046NR_4.0_04840.1
Exact match
3UZT|1|B (3UZT)
  • C13.18 RNA Aptamer
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.5 Å7(1) 3UZT|1|B
1047NR_4.0_28506.1
Exact match
Caenorhabditis elegans
3V6Y|1|B (3V6Y)
  • RNA (5'-R(*UP*AP*CP*UP*GP*UP*GP*CP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å11(1) 3V6Y|1|B
1048NR_4.0_97196.1
Exact match
Caenorhabditis elegans
3V71|1|B (3V71)
  • RNA (5'-R(*CP*UP*CP*UP*GP*UP*AP*UP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å7(1) 3V71|1|B
1049NR_4.0_33378.1
Exact match
Caenorhabditis elegans
3V74|1|B (3V74)
  • RNA (5'-R(*UP*CP*AP*UP*GP*UP*GP*CP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å11(1) 3V74|1|B
1050NR_4.0_65712.1
Exact match
3VNV|1|T+3VNV|1|G (3VNV)
  • RNA (5'-R(*GP*GP*GP*UP*AP*GP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, T; model(s): 1
2.6 Å8(1) 3VNV|1|T+3VNV|1|G
1051NR_4.0_44691.1
Exact match
Aquifex aeolicus
3W3S|1|B (3W3S)
  • selenocysteine tRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.1 Å98(1) 3W3S|1|B
1052NR_4.0_81333.1
Exact match
3WBM|1|X+3WBM|1|Y (3WBM)
  • RNA (25-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, X, Y; model(s): 1
2.0 Å25(1) 3WBM|1|X+3WBM|1|Y
1053NR_4.0_84179.1
Exact match
3WZI|1|C (3WZI)
  • ssRNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å4(1) 3WZI|1|C
1054NR_4.0_68262.1
Exact match
Pyrococcus furiosus
3X1L|1|I (3X1L)
  • RNA (32-MER)
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
2.1 Å32(1) 3X1L|1|I
1055NR_4.0_12677.1
Exact match
402D|1|A+402D|1|B (402D)
  • RNA(5'-R(*CP*GP*CP*CP*AP*GP*CP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.3 Å8(1) 402D|1|A+402D|1|B
1056NR_4.0_94840.1
Exact match
404D|1|A (404D)
  • 5'-R(*GP*AP*AP*GP*AP*GP*AP*AP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.5 Å10(1) 404D|1|A
1057NR_4.0_58318.1
Exact match
406D|1|A+406D|1|E (406D)
  • RNA (5'-R(*CP*AP*CP*CP*GP*GP*AP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, E, F, G, H; model(s): 1
1.8 Å16(1) 406D|1|A+406D|1|E
1058NR_4.0_90819.1
Exact match
413D|1|A (413D)
  • RNA (5'-R(*UP*GP*AP*GP*CP*UP*UP*CP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.8 Å14(1) 413D|1|A
1059NR_4.0_37827.1
Exact match
418D|1|A+418D|1|B (418D)
  • RNA (5'-R(*GP*UP*GP*CP*AP*CP*AP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.4 Å7(1) 418D|1|A+418D|1|B
1060NR_4.0_12183.1
Exact match
421D|1|B (421D)
  • RNA (5'-R(*GP*AP*AP*GP*AP*AP*GP*AP*A)-3'[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å9(1) 421D|1|B
1061NR_4.0_06457.1
Exact match
422D|1|A+422D|1|B (422D)
  • 5'-R(*GP*AP*UP*CP*AP*CP*UP*UP*CP*GP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.6 Å12(1) 422D|1|A+422D|1|B
1062NR_4.0_99184.1
Exact match
433D|1|A+433D|1|B (433D)
  • 5'-R(*GP*GP*UP*AP*UP*UP*GP*CP*GP*GP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.1 Å14(1) 433D|1|A+433D|1|B
1063NR_4.0_19513.1
Exact match
438D|1|A+438D|1|B (438D)
  • RNA (5'-R(*GP*GP*GP*CP*GP*CP*UP*CP*C)-3'[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.5 Å9(1) 438D|1|A+438D|1|B
1064NR_4.0_27697.1
Exact match
439D|1|A+439D|1|B (439D)
  • RNA (5'-R(*CP*UP*GP*GP*GP*CP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
1.6 Å8(1) 439D|1|A+439D|1|B
1065NR_4.0_02834.1
Exact match
472D|1|A+472D|1|B (472D)
  • RNA (5'-R(*GP*UP*GP*UP*UP*UP*AP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
1.9 Å8(1) 472D|1|A+472D|1|B
1066NR_4.0_32449.1
Exact match
485D|1|A+485D|1|B (485D)
  • RNA/DNA(5'-R(*CP*GP*UP*GP*AP*UP*CP*GP)-D[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
1.0 Å7(1) 485D|1|A+485D|1|B
1067NR_4.0_28840.1
Exact match
Saccharomyces cerevisiae
4A93|1|P (4A93)
  • 5'-R(*UP*UP*CP*GP*AP*CP*CP*AP*GP*GP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.4 Å9(1) 4A93|1|P
1068NR_4.0_04638.1
Exact match
Caldanaerobacter subterraneus
4AOB|1|A (4AOB)
  • SAM-I RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å94(1) 4AOB|1|A
1069NR_4.0_46564.1
Exact match
Bacillus thuringiensis
4ATO|1|G (4ATO)
  • TOXI
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.2 Å33(1) 4ATO|1|G
1070NR_4.0_43251.1
Exact match
4AY2|1|C (4AY2)
  • 5'-R-PPP(GP*GP*CP*GP*CP*GP*GP*CP*UP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å19(1) 4AY2|1|C
1071NR_4.0_08596.1
Exact match
4B3G|1|G (4B3G)
  • RNA (5'-(AP*AP*AP*AP*AP*AP*AP*AP*AP)-3')
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.9 Å9(1) 4B3G|1|G
1072NR_4.0_14977.1
Exact match
4B3G|1|H (4B3G)
  • RNA (5'-(AP*AP*AP*AP*AP*AP*AP*AP*AP)-3')
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.9 Å8(1) 4B3G|1|H
1073NR_4.0_08464.1
Exact match
synthetic construct
4B3O|1|R (4B3O)
  • 5'-R(*AP*UP*GP*AP*3DRP*GP*GP*CP*CP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.3 Å23(1) 4B3O|1|R
1074NR_4.0_94845.1
Exact match
Sulfolobus solfataricus
4BA2|1|R (4BA2)
  • 5'-R(*AP*AP*AP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.5 Å4(1) 4BA2|1|R
1075NR_4.0_20180.1
Exact match
Saccharomyces cerevisiae
4BBS|1|P (4BBS)
  • 5'-R(*AP*UP*AP*UP*CP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.6 Å6(1) 4BBS|1|P
1076NR_4.0_80476.1
Exact match
synthetic construct
4BOC|1|R (4BOC)
  • 5'-R(*AP*GP*UP*CP*UP*GP*CP*GP*GP*CP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.7 Å9(1) 4BOC|1|R
1077NR_4.0_46866.1
Exact match
synthetic construct
4BWM|1|G (4BWM)
  • 5'-R(*AP*AP*AP*GP*GP*GP*CP*GP*CP*CP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
1.8 Å14(1) 4BWM|1|G
1078NR_4.0_77692.1
Exact match
synthetic construct
4BXX|1|P (4BXX)
  • 5'-D(*CP*CP*CP*CP*CP*CP*CP*CP*CP*CP*CP)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.3 Å11(1) 4BXX|1|P
1079NR_4.0_00810.1
Exact match
Escherichia coli
4C7O|1|E (4C7O)
  • SRP RNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.6 Å48(1) 4C7O|1|E
1080NR_4.0_31288.1
Exact match
4C8Y|1|C (4C8Y)
  • R1 REPEAT RNA SUBSTRATE MIMIC
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.8 Å13(1) 4C8Y|1|C
1081NR_4.0_91365.1
Exact match
Thermus thermophilus
4C8Z|1|C (4C8Z)
  • R1 REPEAT RNA CLEAVAGE PRODUCT
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.5 Å14(1) 4C8Z|1|C
1082NR_4.0_07497.1
Exact match
Thermus thermophilus
4DR6|1|W+4DR6|1|V (4DR6)
  • 5'-R(P*UP*UP*GP*AP*GP*GP*(PSU)P*GP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, V, W; model(s): 1
3.3 Å8(1) 4DR6|1|W+4DR6|1|V
1083NR_4.0_76824.1
Exact match
Thermus thermophilus
4DR7|1|W (4DR7)
  • 5'-R(*GP*CP*CP*UP*GP*GP*AP*AP*AP*GP*(PSU[...]
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
3.8 Å10(1) 4DR7|1|W
1084NR_4.0_22605.1
Exact match
4DWA|1|D (4DWA)
  • RNA (5'-R(*CP*UP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å3(1) 4DWA|1|D
1085NR_4.0_13174.1
Exact match
Homo sapiens
4E58|1|D+4E58|1|C+4E58|1|E (4E58)
  • RNA duplex containing CCG repeats
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
2.0 Å7(1) 4E58|1|D+4E58|1|C+4E58|1|E
1086NR_4.0_55926.1
Exact match
Homo sapiens
4E59|1|A+4E59|1|B (4E59)
  • RNA duplex containing CCG repeats
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
1.5 Å8(1) 4E59|1|A+4E59|1|B
1087NR_4.0_70790.1
Exact match
4E5C|1|A+4E5C|1|B (4E5C)
  • 5'-R(P*GP*GP*CP*GP*GP*CP*GP*GP*CP*GP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
1.7 Å19(1) 4E5C|1|A+4E5C|1|B
1088NR_4.0_53426.1
Exact match
4E6B|1|A+4E6B|1|B (4E6B)
  • 5'-R(P*CP*GP*GP*CP*GP*GP*CP*GP*GP*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
1.5 Å4(1) 4E6B|1|A+4E6B|1|B
1089NR_4.0_33685.1
Exact match
4E6B|1|E+4E6B|1|F (4E6B)
  • 5'-R(P*CP*GP*GP*CP*GP*GP*CP*GP*GP*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H; model(s): 1
1.5 Å4(1) 4E6B|1|E+4E6B|1|F
1090NR_4.0_52691.1
Exact match
4E78|1|P+4E78|1|T (4E78)
  • 5'-R(*U*AP*CP*CP*GP*(GDO))-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H, P, T; model(s): 1
2.9 Å4(1) 4E78|1|P+4E78|1|T
1091NR_4.0_11350.1
Exact match
4E7A|1|P+4E7A|1|T (4E7A)
  • 5'-R(*CP*AP*UP*GP*GP*C)-D(P*(DOC))-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H, P, T; model(s): 1
3.0 Å4(1) 4E7A|1|P+4E7A|1|T
1092NR_4.0_25893.1
Exact match
Tetrahymena thermophila
4ERD|1|C+4ERD|1|D (4ERD)
  • 5'-R(P*GP*GP*UP*CP*GP*AP*CP*AP*UP*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
2.6 Å22(1) 4ERD|1|C+4ERD|1|D
1093NR_4.0_88847.1
Exact match
Homo sapiens
4F3T|1|R (4F3T)
  • RNA (5'-R(P*UP*AP*AP*AP*GP*UP*GP*CP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.3 Å14(1) 4F3T|1|R
1094NR_4.0_39301.1
Exact match
Spodoptera frugiperda
4FSJ|1|R (4FSJ)
  • Random cellular RNA fragments
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.5 Å14(1) 4FSJ|1|R
1095NR_4.0_62747.1
Exact match
Flock house virus
4FTB|1|R (4FTB)
  • Flock House virus genomic RNA
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.7 Å15(1) 4FTB|1|R
1096NR_4.0_05128.1
Exact match
synthetic construct
4FVU|1|B+4FVU|1|C (4FVU)
  • RNA (5'-R(*GP*GP*AP*GP*GP*GP*AP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
2.9 Å8(1) 4FVU|1|B+4FVU|1|C
1097NR_4.0_74729.1
Exact match
synthetic construct
4G0A|1|E (4G0A)
  • RNA (5'-R(P*GP*GP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.1 Å3(1) 4G0A|1|E
1098NR_4.0_24630.1
Exact match
synthetic construct
4G0A|1|F (4G0A)
  • RNA (5'-R(P*GP*GP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.1 Å3(1) 4G0A|1|F
1099NR_4.0_32785.1
Exact match
synthetic construct
4G0A|1|G (4G0A)
  • RNA (5'-R(P*GP*GP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.1 Å3(1) 4G0A|1|G
1100NR_4.0_47227.1
Exact match
synthetic construct
4G0A|1|H (4G0A)
  • RNA (5'-R(P*GP*GP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.1 Å3(1) 4G0A|1|H
1101NR_4.0_02089.1
Exact match
4G9Z|1|E+4G9Z|1|F (4G9Z)
  • RNA (5'-R(P*GP*CP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H; model(s): 1
2.0 Å4(1) 4G9Z|1|E+4G9Z|1|F
1102NR_4.0_06970.1
Exact match
4GG4|1|H (4GG4)
  • RNA (5'-R(*AP*GP*AP*GP*AP*GP*AP*UP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.5 Å16(1) 4GG4|1|H
1103NR_4.0_79459.1
Exact match
synthetic construct
4GKJ|1|X+4GKJ|1|W (4GKJ)
  • tRNA ASL human mitochondrial Met
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H, W, X; model(s): 1
3.3 Å8(1) 4GKJ|1|X+4GKJ|1|W
1104NR_4.0_73684.1
Exact match
synthetic construct
4GKK|1|X+4GKK|1|W (4GKK)
  • tRNA ASL human mitochondrial Met
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H, W, X; model(s): 1
3.2 Å5(1) 4GKK|1|X+4GKK|1|W
1105NR_4.0_26802.1
Exact match
marine metagenome
4GMA|1|Z (4GMA)
  • Adenosylcobalamin riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
3.9 Å192(1) 4GMA|1|Z
1106NR_4.0_36514.1
Exact match
4GXY|1|A (4GXY)
  • Adenosylcobalamin riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å161(1) 4GXY|1|A
1107NR_4.0_77339.1
Exact match
synthetic construct
4GZY|1|R (4GZY)
  • RNA transcript
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.5 Å9(1) 4GZY|1|R
1108NR_4.0_51034.1
Exact match
4HKQ|1|E (4HKQ)
  • RNA (5'-R(*AP*AP*CP*AP*GP*AP*GP*UP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.0 Å16(1) 4HKQ|1|E
1109NR_4.0_03341.1
Exact match
4HOR|1|X (4HOR)
  • RNA (5'-R(*(CTP)P*CP*CP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
1.9 Å5(1) 4HOR|1|X
1110NR_4.0_65232.1
Exact match
4HOS|1|X (4HOS)
  • RNA (5'-R(*(UTP)P*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.0 Å3(1) 4HOS|1|X
1111NR_4.0_43542.1
Exact match
4HOT|1|X (4HOT)
  • RNA (5'-R(*(ATP)P*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.5 Å3(1) 4HOT|1|X
1112NR_4.0_12137.1
Exact match
4I67|1|B (4I67)
  • 5'-R(P*GP*GP*GP*(RPC))-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å3(1) 4I67|1|B
1113NR_4.0_30288.1
Exact match
4IG8|1|B+4IG8|1|C (4IG8)
  • RNA (5'-R(*GP*GP*CP*UP*UP*UP*UP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
2.7 Å18(1) 4IG8|1|B+4IG8|1|C
1114NR_4.0_30547.1
Exact match
4II9|1|C (4II9)
  • RNA (5'-R(P*CP*CP*(A9Z))-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.7 Å2(1) 4II9|1|C
1115NR_4.0_80150.1
Exact match
4IJS|1|E (4IJS)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.2 Å10(1) 4IJS|1|E
1116NR_4.0_16745.1
Exact match
4IJS|1|F (4IJS)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.2 Å9(1) 4IJS|1|F
1117NR_4.0_08946.1
Exact match
4IJS|1|G (4IJS)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
3.2 Å9(1) 4IJS|1|G
1118NR_4.0_73600.1
Exact match
4IJS|1|H (4IJS)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.2 Å9(1) 4IJS|1|H
1119NR_4.0_94888.1
Exact match
synthetic construct
4J7L|1|B (4J7L)
  • RNA (5'-R(P*UP*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å5(1) 4J7L|1|B
1120NR_4.0_02412.1
Exact match
synthetic construct
4J7M|1|B (4J7M)
  • RNA (5'-R(P*UP*(U37)P*(U37)P*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.7 Å3(1) 4J7M|1|B
1121NR_4.0_60906.1
Exact match
synthetic construct
4JAB|1|A+4JAB|1|B (4JAB)
  • RNA (5'-R(*GP*UP*GP*UP*AP*UP*AP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
2.2 Å8(1) 4JAB|1|A+4JAB|1|B
1122NR_4.0_27306.1
Exact match
Lactobacillus rhamnosus
4JF2|1|A (4JF2)
  • PreQ1-II Riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å76(1) 4JF2|1|A
1123NR_4.0_54538.1
Exact match
4JIY|1|A (4JIY)
  • 5'-(CGUACG)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.9 Å6(1) 4JIY|1|A
1124NR_4.0_17580.1
Exact match
4JRT|1|A+4JRT|1|B (4JRT)
  • RNA (5'-R(P*GP*GP*GP*UP*GP*GP*UP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
2.6 Å12(1) 4JRT|1|A+4JRT|1|B
1125NR_4.0_69202.1
Exact match
synthetic construct
4JV5|1|X (4JV5)
  • mRNA
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.2 Å4(1) 4JV5|1|X
1126NR_4.0_61139.1
Exact match
synthetic construct
4JV5|1|Y (4JV5)
  • ASL-tRNA
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
3.2 Å9(1) 4JV5|1|Y
1127NR_4.0_11173.1
Exact match
4JVH|1|D (4JVH)
  • RNA (5'-R(*UP*UP*CP*AP*CP*UP*AP*AP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.5 Å8(1) 4JVH|1|D
1128NR_4.0_60842.1
Exact match
synthetic construct
4JYA|1|X (4JYA)
  • mRNA
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.1 Å4(1) 4JYA|1|X
1129NR_4.0_51071.1
Exact match
synthetic construct
4JYA|1|Y (4JYA)
  • ASL-tRNA
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
3.1 Å10(1) 4JYA|1|Y
1130NR_4.0_22639.1
Exact match
Thermus thermophilus
4K0K|1|Y+4K0K|1|X (4K0K)
  • RNA-ASL
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H, X, Y; model(s): 1
3.4 Å9(1) 4K0K|1|Y+4K0K|1|X
1131NR_4.0_26582.1
Exact match
4K27|1|U (4K27)
  • Myotonic Dystrophy Type 2 RNA
  • X-RAY DIFFRACTION
  • Chain(s): U; model(s): 1
2.4 Å55(1) 4K27|1|U
1132NR_4.0_77275.1
Exact match
4K31|1|B+4K31|1|C (4K31)
  • RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*UP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
1.4 Å22(1) 4K31|1|B+4K31|1|C
1133NR_4.0_78931.1
Exact match
4KNQ|1|B (4KNQ)
  • 5'-R(P*CP*CP*GP*CP*CP*GP*CP*CP*GP*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å20(1) 4KNQ|1|B
1134NR_4.0_55642.1
Exact match
4KQ0|1|B+4KQ0|1|E (4KQ0)
  • 5'-R(P*GP*GP*CP*GP*GP*CP*GP*GP*CP*GP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H; model(s): 1
2.1 Å19(1) 4KQ0|1|B+4KQ0|1|E
1135NR_4.0_82949.1
Exact match
Bacillus subtilis
4KQY|1|A (4KQY)
  • YitJ S box/SAM-I riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å119(1) 4KQY|1|A
1136NR_4.0_52747.1
Exact match
4KR6|1|C (4KR6)
  • RNA (39-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å39(1) 4KR6|1|C
1137NR_4.0_53766.1
Exact match
4KR6|1|D (4KR6)
  • RNA (39-MER)
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.9 Å39(1) 4KR6|1|D
1138NR_4.0_79645.1
Exact match
Spodoptera frugiperda
4KRE|1|R (4KRE)
  • RNA (5'-R(P*AP*AP*UP*AP*UP*UP*AP*AP*A*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
1.8 Å11(1) 4KRE|1|R
1139NR_4.0_82818.1
Exact match
4KRF|1|R (4KRF)
  • RNA (5'-R(P*UP*GP*AP*GP*GP*UP*AP*GP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.1 Å12(1) 4KRF|1|R
1140NR_4.0_24161.1
Exact match
Spodoptera frugiperda
4KXT|1|B (4KXT)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å12(1) 4KXT|1|B
1141NR_4.0_41718.1
Exact match
4KYY|1|A+4KYY|1|B (4KYY)
  • RNA 17-mer
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
2.4 Å17(1) 4KYY|1|A+4KYY|1|B
1142NR_4.0_45626.1
Exact match
4KZ2|1|B+4KZ2|1|A+4KZ2|1|C (4KZ2)
  • phi29 pRNA 3WJ core RNA 20 mer
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
3.1 Å20(1) 4KZ2|1|B+4KZ2|1|A+4KZ2|1|C
1143NR_4.0_60255.1
Exact match
4LMZ|1|B (4LMZ)
  • RNA (5'-R(*GP*CP*UP*GP*CP*GP*UP*AP*UP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å5(1) 4LMZ|1|B
1144NR_4.0_52315.1
Exact match
4M4O|1|B (4M4O)
  • RNA (59-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å59(1) 4M4O|1|B
1145NR_4.0_80423.1
Exact match
4MDX|1|C (4MDX)
  • RNA, mRNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.5 Å8(1) 4MDX|1|C
1146NR_4.0_45527.1
Exact match
4N2Q|1|B (4N2Q)
  • RNA (5'-R(*AP*AP*GP*AP*AP*GP*AP*AP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å5(1) 4N2Q|1|B
1147NR_4.0_29277.1
Exact match
4N2S|1|B (4N2S)
  • Zm1a-6 RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å4(1) 4N2S|1|B
1148NR_4.0_35969.1
Exact match
4NGC|1|B (4NGC)
  • 5'-R(*GP*CP*GP*AP*AP*UP*UP*CP*GP*CP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.1 Å12(1) 4NGC|1|B
1149NR_4.0_15462.1
Exact match
4NGG|1|B (4NGG)
  • 5'-R(*AP*GP*CP*GP*AP*AP*UP*UP*CP*GP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å13(1) 4NGG|1|B
1150NR_4.0_73378.1
Exact match
4NH3|1|B (4NH3)
  • 5'-R(P*UP*GP*CP*GP*AP*AP*UP*UP*CP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å13(1) 4NH3|1|B
1151NR_4.0_78685.1
Exact match
4NH5|1|B (4NH5)
  • 5'-R(P*UP*UP*GP*CP*GP*AP*AP*UP*UP*CP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å14(1) 4NH5|1|B
1152NR_4.0_33125.1
Exact match
4NH6|1|B (4NH6)
  • 5'-R(P*UP*UP*UP*GP*CP*GP*AP*AP*UP*UP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å15(1) 4NH6|1|B
1153NR_4.0_04426.1
Exact match
4NHA|1|B (4NHA)
  • 5'-R(P*GP*CP*GP*UP*UP*GP*GP*CP*CP*AP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.4 Å16(1) 4NHA|1|B
1154NR_4.0_49228.1
Exact match
4OAV|1|A (4OAV)
  • RNA (5'-R(P*(PO4)P*(PO4)P*AP*AP*AP*AP*(P[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.1 Å4(1) 4OAV|1|A
1155NR_4.0_16274.1
Exact match
4OAV|1|C (4OAV)
  • RNA (5'-R(P*(PO4)P*(PO4)P*AP*AP*AP*AP*(P[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.1 Å4(1) 4OAV|1|C
1156NR_4.0_07579.1
Exact match
4OHZ|1|B (4OHZ)
  • RNA (5'-R(*GP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å4(1) 4OHZ|1|B
1157NR_4.0_79951.1
Exact match
4OJI|1|A (4OJI)
  • RNA (52-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å53(1) 4OJI|1|A
1158NR_4.0_85602.1
Exact match
4OO1|1|S (4OO1)
  • POLY A RNA
  • X-RAY DIFFRACTION
  • Chain(s): S; model(s): 1
3.3 Å6(1) 4OO1|1|S
1159NR_4.0_91105.1
Exact match
4OOG|1|D (4OOG)
  • 34-mer RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.5 Å34(1) 4OOG|1|D
1160NR_4.0_31561.1
Exact match
synthetic construct
4P3T|1|A+4P3T|1|B (4P3T)
  • 5'-D(*UP*UP*GP*CP*GP*UP*CP*CP*CP*GP*(5BU[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
1.6 Å22(1) 4P3T|1|A+4P3T|1|B
1161NR_4.0_07169.1
Exact match
synthetic construct
4P3U|1|B+4P3U|1|A (4P3U)
  • 5'-R(*UP*UP*GP*CP*GP*UP*CP*UP*CP*GP*(5BU[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
3.0 Å21(1) 4P3U|1|B+4P3U|1|A
1162NR_4.0_26059.1
Exact match
synthetic construct
4P3U|1|C+4P3U|1|D (4P3U)
  • 5'-R(*UP*UP*GP*CP*GP*UP*CP*UP*CP*GP*(5BU[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H; model(s): 1
3.0 Å21(1) 4P3U|1|C+4P3U|1|D
1163NR_4.0_42932.1
Exact match
synthetic construct
4P43|1|B+4P43|1|A (4P43)
  • 5'-R(*UP*UP*GP*CP*GP*UP*CP*UP*CP*GP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.0 Å23(1) 4P43|1|B+4P43|1|A
1164NR_4.0_02656.1
Exact match
Turnip yellow mosaic virus
4P5J|1|A (4P5J)
  • Turnip yellow mosaic virus mRNA for the [...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å83(1) 4P5J|1|A
1165NR_4.0_86266.1
Exact match
Didymium iridis
4P8Z|1|A (4P8Z)
  • Didymium iridis partial IGS, 18S rRNA ge[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.9 Å188(1) 4P8Z|1|A
1166NR_4.0_18718.1
Exact match
synthetic construct
4PDB|1|I (4PDB)
  • SELEX RNA aptamer
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
2.6 Å38(1) 4PDB|1|I
1167NR_4.0_06133.1
Exact match
synthetic construct
4PEH|1|Z (4PEH)
  • RNA (5'-R(*CP*UP*AP*(A2P)P*AP*CP*AP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
2.1 Å3(1) 4PEH|1|Z
1168NR_4.0_02574.1
Exact match
Senecavirus A
4PHY|1|A+4PHY|1|B (4PHY)
  • RNA (26-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
3.1 Å26(1) 4PHY|1|A+4PHY|1|B
1169NR_4.0_24202.1
Exact match
Homo sapiens
4PKD|1|V (4PKD)
  • U1 snRNA stem-loops 1 and 2 (55-MER)
  • X-RAY DIFFRACTION
  • Chain(s): V; model(s): 1
2.5 Å54(1) 4PKD|1|V
1170NR_4.0_36990.1
Exact match
Human immunodeficiency virus 1
4PMI|1|A (4PMI)
  • Rev-Response-Element RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.2 Å40(1) 4PMI|1|A
1171NR_4.0_72021.1
Exact match
Murray Valley encephalitis virus
4PQV|1|A (4PQV)
  • XRN1-resistant flaviviral RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.5 Å68(1) 4PQV|1|A
1172NR_4.0_09431.1
Exact match
4PR6|1|B (4PR6)
  • HDV RIBOZYME SELF-CLEAVED
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å74(1) 4PR6|1|B
1173NR_4.0_33669.1
Exact match
4PY5|1|B (4PY5)
  • 5'-R(*GP*AP*GP*UP*GP*CP*GP*AP*CP*AP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.1 Å19(1) 4PY5|1|B
1174NR_4.0_65762.1
Exact match
4Q5S|1|I (4Q5S)
  • RNA (5'-R(P*CP*UP*CP*AP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
3.0 Å5(1) 4Q5S|1|I
1175NR_4.0_19188.1
Exact match
Homo sapiens
4QEI|1|C (4QEI)
  • tRNA-Gly-CCC-2-2
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å68(1) 4QEI|1|C
1176NR_4.0_13250.1
Exact match
4QIK|1|C+4QIK|1|D (4QIK)
  • 5'-R(*AP*C*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H; model(s): 1
1.9 Å18(1) 4QIK|1|C+4QIK|1|D
1177NR_4.0_91474.1
Exact match
4QK9|1|A (4QK9)
  • C-di-AMP riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å116(1) 4QK9|1|A
1178NR_4.0_18913.1
Exact match
4QPX|1|P+4QPX|1|T (4QPX)
  • RNA (5'-R(*UP*GP*CP*CP*CP*GP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, P, T; model(s): 1
1.9 Å8(1) 4QPX|1|P+4QPX|1|T
1179NR_4.0_98920.1
Exact match
synthetic construct
4QU6|1|B (4QU6)
  • RNA 5'-(*AP*GP*GP*GP*UP*GP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å3(1) 4QU6|1|B
1180NR_4.0_47084.1
Exact match
Escherichia coli
4QVC|1|G (4QVC)
  • RNA (5'-R(*AP*U*AP*AP*CP*UP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.0 Å4(1) 4QVC|1|G
1181NR_4.0_78430.1
Exact match
Escherichia coli
4QVD|1|H (4QVD)
  • RNA (5'-R(*AP*AP*CP*UP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.0 Å4(1) 4QVD|1|H
1182NR_4.0_29106.1
Exact match
Escherichia coli
4QYZ|1|L (4QYZ)
  • RNA (55-MER)
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
3.0 Å55(1) 4QYZ|1|L
1183NR_4.0_05993.1
Exact match
Pylaiella littoralis
4R0D|1|A (4R0D)
  • GROUP IIB INTRON LARIAT
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.7 Å617(1) 4R0D|1|A
1184NR_4.0_37244.1
Exact match
synthetic construct
4R3I|0|B (4R3I)
  • RNA (5'-R(*GP*GP*(6MZ)P*CP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 0
1.8 Å4(1) 4R3I|0|B
1185NR_4.0_50652.1
Exact match
synthetic construct
4RBY|1|A (4RBY)
  • 5'-R(*CP*GP*CP*(2SG)P*AP*AP*UP*UP*AP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.2 Å13(1) 4RBY|1|A
1186NR_4.0_12687.1
Exact match
synthetic construct
4RBZ|1|A (4RBZ)
  • 5'-R(*CP*GP*CP*GP*(A2M)P*(ADS)P*UP*UP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.2 Å16(1) 4RBZ|1|A
1187NR_4.0_47141.1
Exact match
synthetic construct
4RC0|1|A (4RC0)
  • 5'-R(*CP*GP*CP*GP*AP*AP*UP*UP*(A2M)P*(2S[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å16(1) 4RC0|1|A
1188NR_4.0_80112.1
Exact match
synthetic construct
4RCJ|1|B (4RCJ)
  • RNA (5'-R(*GP*GP*(6MZ)P*CP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.6 Å4(1) 4RCJ|1|B
1189NR_4.0_42401.1
Exact match
Thermus thermophilus
4RDX|1|C (4RDX)
  • tRNA(his)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.6 Å76(1) 4RDX|1|C
1190NR_4.0_09702.1
Exact match
synthetic construct
4RJ1|1|B (4RJ1)
  • RNA (5'-R(*UP*GP*GP*GP*GP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
0.9 Å6(1) 4RJ1|1|B
1191NR_4.0_88154.1
Exact match
synthetic construct
4RUM|1|A (4RUM)
  • NiCo riboswitch RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.6 Å92(1) 4RUM|1|A
1192NR_4.0_37714.1
Exact match
Faecalibacterium prausnitzii
4RZD|1|A (4RZD)
  • PreQ1-III Riboswitch (Class 3)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å98(1) 4RZD|1|A
1193NR_4.0_45210.1
Exact match
Saccharomyces cerevisiae
4TYW|1|B (4TYW)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å7(1) 4TYW|1|B
1194NR_4.0_21747.1
Exact match
Saccharomyces cerevisiae
4TYY|1|B (4TYY)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å9(1) 4TYY|1|B
1195NR_4.0_20784.1
Exact match
Saccharomyces cerevisiae
4TZ0|1|B (4TZ0)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å7(1) 4TZ0|1|B
1196NR_4.0_75005.1
Exact match
Saccharomyces cerevisiae
4TZ6|1|B (4TZ6)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.2 Å7(1) 4TZ6|1|B
1197NR_4.0_50990.1
Exact match
synthetic construct
4U34|1|B+4U34|1|A (4U34)
  • RNA (5'-R(*GP*GP*AP*GP*CP*UP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
1.4 Å7(1) 4U34|1|B+4U34|1|A
1198NR_4.0_61167.1
Exact match
synthetic construct
4U35|1|B+4U35|1|A (4U35)
  • RNA (5'-R(*GP*GP*UP*GP*CP*UP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
1.6 Å7(1) 4U35|1|B+4U35|1|A
1199NR_4.0_75200.1
Exact match
Salmonella enterica
4V2S|1|Q (4V2S)
  • RYDC
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
3.5 Å58(1) 4V2S|1|Q
1200NR_4.0_46764.1
Exact match
4V5K|1|CX (4V5K)
  • MRNA
  • X-RAY DIFFRACTION
  • Chain(s): CX; model(s): 1
3.2 Å8(1) 4V5K|1|CX
1201NR_4.0_45855.1
Exact match
Thermus thermophilus
4V8Q|1|BY (4V8Q)
  • TMRNA DELA
  • X-RAY DIFFRACTION
  • Chain(s): BY; model(s): 1
3.1 Å61(1) 4V8Q|1|BY
1202NR_4.0_91619.1
Exact match
Kluyveromyces lactis
4V91|1|1+4V91|1|4 (4V91)
  • 25S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 1, 4, B, C, D, F, G, H; model(s): 1
3.7 Å3203(1) 4V91|1|1+4V91|1|4
1203NR_4.0_28848.1
Exact match
Cricket paralysis virus
4V92|1|AZ (4V92)
  • RNA OF CRICKET-PARALYSIS-VIRUS-IRES
  • ELECTRON MICROSCOPY
  • Chain(s): AZ; model(s): 1
3.7 Å190(1) 4V92|1|AZ
1204NR_4.0_66347.1
Exact match
Escherichia coli
4W29|1|AX (4W29)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): AX; model(s): 1
3.8 Å76(1) 4W29|1|AX
1205NR_4.0_83036.1
Exact match
synthetic construct
4W5N|1|B (4W5N)
  • RNA (5'-R(P*UP*UP*CP*AP*CP*AP*UP*UP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å18(1) 4W5N|1|B
1206NR_4.0_91690.1
Exact match
Pseudomonas aeruginosa
4WJ4|1|B (4WJ4)
  • 76mer-tRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.3 Å76(1) 4WJ4|1|B
1207NR_4.0_29002.1
Exact match
unidentified influenza virus
4WSB|1|V+4WSB|1|R (4WSB)
  • Influenza A polymerase vRNA promoter 5' [...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, R, V; model(s): 1
2.7 Å16(1) 4WSB|1|V+4WSB|1|R
1208NR_4.0_47349.1
Exact match
Mitsuaria sp. 67
4WT8|1|D4 (4WT8)
  • tRNA (76-MER)
  • X-RAY DIFFRACTION
  • Chain(s): D4; model(s): 1
3.4 Å76(1) 4WT8|1|D4
1209NR_4.0_65573.1
Exact match
Mitsuaria sp. 67
4WT8|1|DV (4WT8)
  • DNA (55-MER)
  • X-RAY DIFFRACTION
  • Chain(s): DV; model(s): 1
3.4 Å55(1) 4WT8|1|DV
1210NR_4.0_83415.1
Exact match
synthetic construct
4WTC|1|T+4WTC|1|P (4WTC)
  • RNA PRIMER TEMPLATE AGAAAUUU
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, P, T; model(s): 1
2.8 Å8(1) 4WTC|1|T+4WTC|1|P
1211NR_4.0_02402.1
Exact match
synthetic construct
4WTE|1|T+4WTE|1|P (4WTE)
  • RNA PRIMER TEMPLATE ACAAAUUU
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, P, T; model(s): 1
2.9 Å8(1) 4WTE|1|T+4WTE|1|P
1212NR_4.0_01782.1
Exact match
synthetic construct
4WTI|1|T+4WTI|1|P (4WTI)
  • RNA TEMPLATE ACGG
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, P, T; model(s): 1
2.8 Å4(1) 4WTI|1|T+4WTI|1|P
1213NR_4.0_98152.1
Exact match
synthetic construct
4WTJ|1|T+4WTJ|1|P (4WTJ)
  • RNA TEMPLATE AUCC
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, P, T; model(s): 1
2.2 Å4(1) 4WTJ|1|T+4WTJ|1|P
1214NR_4.0_61884.1
Exact match
synthetic construct
4WTK|1|T+4WTK|1|P (4WTK)
  • RNA TEMPLATE AGCC
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, P, T; model(s): 1
2.5 Å4(1) 4WTK|1|T+4WTK|1|P
1215NR_4.0_82735.1
Exact match
synthetic construct
4WTL|1|T+4WTL|1|P (4WTL)
  • RNA TEMPLATE UACC
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, P, T; model(s): 1
2.0 Å4(1) 4WTL|1|T+4WTL|1|P
1216NR_4.0_70063.1
Exact match
synthetic construct
4WTM|1|T+4WTM|1|P (4WTM)
  • RNA TEMPLATE UAGG
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, P, T; model(s): 1
2.2 Å4(1) 4WTM|1|T+4WTM|1|P
1217NR_4.0_39179.1
Exact match
synthetic construct
4WZM|1|B+4WZM|1|C (4WZM)
  • RNA template
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H; model(s): 1
2.5 Å8(1) 4WZM|1|B+4WZM|1|C
1218NR_4.0_77778.1
Exact match
synthetic construct
4WZQ|1|B+4WZQ|1|C (4WZQ)
  • RNA template
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H; model(s): 1
2.8 Å8(1) 4WZQ|1|B+4WZQ|1|C
1219NR_4.0_37566.1
Exact match
synthetic construct
4X2B|1|B+4X2B|1|C (4X2B)
  • RNA template
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H; model(s): 1
2.9 Å7(1) 4X2B|1|B+4X2B|1|C
1220NR_4.0_33059.1
Exact match
Homo sapiens
4X4U|1|G (4X4U)
  • human MenBeta minihelix
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.7 Å18(1) 4X4U|1|G
1221NR_4.0_05749.1
Exact match
synthetic construct
4X6A|1|R (4X6A)
  • RNA_9 mer
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
4.0 Å9(1) 4X6A|1|R
1222NR_4.0_36229.1
Exact match
Homo sapiens
4XBF|1|D (4XBF)
  • RNA (5'-R(*UP*UP*AP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.8 Å5(1) 4XBF|1|D
1223NR_4.0_26354.1
Exact match
Escherichia coli
4XJN|1|N (4XJN)
  • RNA (78-MER)
  • X-RAY DIFFRACTION
  • Chain(s): N; model(s): 1
3.1 Å78(1) 4XJN|1|N
1224NR_4.0_81309.1
Exact match
synthetic construct
4XK0|1|A (4XK0)
  • RNA (5'-(*UP*GP*GP*GP*GP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å6(1) 4XK0|1|A
1225NR_4.0_70938.1
Exact match
Homo sapiens
4XW0|1|A+4XW0|1|B (4XW0)
  • RNA (5'-R(*GP*CP*CP*UP*(LCG)P*CP*CP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
1.8 Å9(1) 4XW0|1|A+4XW0|1|B
1226NR_4.0_03183.1
Exact match
Homo sapiens
4XW1|1|C (4XW1)
  • RNA (5'-R(*GP*CP*CP*UP*(LCG)P*CP*CP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.3 Å8(1) 4XW1|1|C
1227NR_4.0_09504.1
Exact match
synthetic construct
4XWW|1|D (4XWW)
  • RNA (5'-D(UP*UP*UP*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.7 Å7(1) 4XWW|1|D
1228NR_4.0_64642.1
Exact match
synthetic construct
4XWW|1|E (4XWW)
  • RNA (5'-D(UP*UP*UP*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.7 Å7(1) 4XWW|1|E
1229NR_4.0_79685.1
Exact match
Saccharomyces cerevisiae
4YHW|1|E+4YHW|1|C (4YHW)
  • U6 snRNA fragment
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
3.3 Å27(1) 4YHW|1|E+4YHW|1|C
1230NR_4.0_24573.1
Exact match
Saccharomyces cerevisiae
4YHW|1|F+4YHW|1|D (4YHW)
  • U6 snRNA fragment
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H; model(s): 1
3.3 Å27(1) 4YHW|1|F+4YHW|1|D
1231NR_4.0_45187.1
Exact match
synthetic construct
4YOE|1|E (4YOE)
  • RNA AGU
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.9 Å3(1) 4YOE|1|E
1232NR_4.0_73713.1
Exact match
Homo sapiens
4Z31|1|C+4Z31|1|D (4Z31)
  • RNA (5'-R(*A)-D(P*UP*GP*UP*UP*CP*UP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H; model(s): 1
2.5 Å14(1) 4Z31|1|C+4Z31|1|D
1233NR_4.0_79931.1
Exact match
Methanococcus maripaludis
4Z7K|1|C (4Z7K)
  • RNA/DNA Hybrid (31-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.0 Å24(1) 4Z7K|1|C
1234NR_4.0_35406.1
Exact match
Parechovirus A
4Z92|1|D (4Z92)
  • RNA (5'-R(*AP*UP*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.1 Å6(1) 4Z92|1|D
1235NR_4.0_10920.1
Exact match
Homo sapiens
4ZLD|1|B (4ZLD)
  • RNA (5'-R(*UP*AP*AP*CP*UP*UP*CP*UP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.6 Å17(1) 4ZLD|1|B
1236NR_4.0_20306.1
Exact match
synthetic construct
4ZLR|1|C (4ZLR)
  • RNA (5'-R(*UP*UP*GP*UP*UP*GP*UP*UP*UP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.3 Å14(1) 4ZLR|1|C
1237NR_4.0_70335.1
Exact match
Homo sapiens
5A8L|1|P (5A8L)
  • P-SITE TRNA
  • ELECTRON MICROSCOPY
  • Chain(s): P; model(s): 1
3.8 Å18(1) 5A8L|1|P
1238NR_4.0_66843.1
Exact match
California encephalitis orthobunyavirus
5AMQ|1|C (5AMQ)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.0 Å10(1) 5AMQ|1|C
1239NR_4.0_15716.1
Exact match
Dictyostelium discoideum
5AN9|1|N (5AN9)
  • 26S RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): N; model(s): 1
3.3 Å1162(1) 5AN9|1|N
1240NR_4.0_67850.1
Exact match
5B43|1|B (5B43)
  • RNA (43-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å40(1) 5B43|1|B
1241NR_4.0_51248.1
Exact match
Candida albicans
5BUD|1|D (5BUD)
  • RNA (5'-R(P*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.0 Å4(1) 5BUD|1|D
1242NR_4.0_91461.1
Exact match
Candida albicans
5BUD|1|E (5BUD)
  • RNA (5'-R(P*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.0 Å5(1) 5BUD|1|E
1243NR_4.0_08637.1
Exact match
synthetic construct
5BZ1|1|B (5BZ1)
  • RNA (5'-R(*UP*GP*UP*AP*UP*UP*UP*GP*UP*A)[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å11(1) 5BZ1|1|B
1244NR_4.0_86160.1
Exact match
synthetic construct
5BZ5|1|B (5BZ5)
  • RNA (5'-R(*UP*GP*UP*AP*AP*CP*UP*UP*UP*A)[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å10(1) 5BZ5|1|B
1245NR_4.0_85126.1
Exact match
synthetic construct
5BZU|1|B (5BZU)
  • UGUAAUA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å8(1) 5BZU|1|B
1246NR_4.0_09580.1
Exact match
synthetic construct
5C0Y|1|C (5C0Y)
  • poly U RNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.1 Å5(1) 5C0Y|1|C
1247NR_4.0_19677.1
Exact match
synthetic construct
5C0Y|1|D (5C0Y)
  • poly U RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.1 Å9(1) 5C0Y|1|D
1248NR_4.0_09579.1
Exact match
5C5W|1|A (5C5W)
  • RNA (5'-R(P*CP*CP*UP*GP*AP*GP*UP*UP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.3 Å22(1) 5C5W|1|A
1249NR_4.0_30196.1
Exact match
Tetrahymena thermophila
5C9H|1|C+5C9H|1|D (5C9H)
  • RNA (5'-R(P*UP*CP*AP*UP*UP*CP*AP*GP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H; model(s): 1
3.0 Å12(1) 5C9H|1|C+5C9H|1|D
1250NR_4.0_77791.1
Exact match
Tetrahymena thermophila
5C9H|1|G+5C9H|1|E (5C9H)
  • RNA (5'-R(P*UP*CP*AP*UP*UP*CP*AP*GP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
3.0 Å11(1) 5C9H|1|G+5C9H|1|E
1251NR_4.0_90823.1
Exact match
Escherichia coli
5D0B|1|F (5D0B)
  • RNA (5'-D(*GP*CP*AP*GP*AP*CP*UP*(56B)P*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.6 Å16(1) 5D0B|1|F
1252NR_4.0_98593.1
Exact match
Methanocaldococcus jannaschii
5D8H|1|A (5D8H)
  • 23S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å74(1) 5D8H|1|A
1253NR_4.0_69350.1
Exact match
Synechococcus elongatus
5DDO|1|A (5DDO)
  • L-glutamine riboswitch (58-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å58(1) 5DDO|1|A
1254NR_4.0_04601.1
Exact match
Synechococcus elongatus
5DDO|1|B (5DDO)
  • L-glutamine riboswitch (58-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.1 Å58(1) 5DDO|1|B
1255NR_4.0_89128.1
Exact match
Homo sapiens
5DET|1|P (5DET)
  • RNA (5'-R(*UP*CP*AP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.0 Å4(1) 5DET|1|P
1256NR_4.0_45166.1
Exact match
Homo sapiens
5DET|1|Q (5DET)
  • RNA (5'-R(P*UP*CP*AP*CP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
2.0 Å5(1) 5DET|1|Q
1257NR_4.0_63343.1
Exact match
Schizosaccharomyces pombe
5DNO|1|B (5DNO)
  • RNA (5'-R(*CP*UP*UP*AP*AP*AP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å7(1) 5DNO|1|B
1258NR_4.0_38685.1
Exact match
Dengue virus
5DTO|1|B (5DTO)
  • RNA (5'-R(P*AP*GP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å4(1) 5DTO|1|B
1259NR_4.0_83715.1
Exact match
synthetic construct
5DV7|1|A+5DV7|1|B (5DV7)
  • RNA (5'-R(*CP*CP*AP*GP*CP*AP*UP*UP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
3.5 Å18(1) 5DV7|1|A+5DV7|1|B
1260NR_4.0_81599.1
Exact match
synthetic construct
5E02|1|C (5E02)
  • RNA (5'-R(*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.8 Å4(1) 5E02|1|C
1261NR_4.0_43394.1
Exact match
synthetic construct
5E3H|1|B+5E3H|1|C (5E3H)
  • RNA (5'-R(*CP*GP*AP*CP*GP*CP*UP*AP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H; model(s): 1
2.7 Å12(1) 5E3H|1|B+5E3H|1|C
1262NR_4.0_40750.1
Exact match
Mus musculus
5ELH|1|R (5ELH)
  • RNA (5'-R(*UP*UP*AP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
1.8 Å5(1) 5ELH|1|R
1263NR_4.0_55334.1
Exact match
Mus musculus
5ELK|1|R (5ELK)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.3 Å6(1) 5ELK|1|R
1264NR_4.0_98212.1
Exact match
synthetic construct
5ELR|1|B (5ELR)
  • RNA (5'-R(*AP*AP*UP*AP*AP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å5(1) 5ELR|1|B
1265NR_4.0_51148.1
Exact match
synthetic construct
5ELS|1|H (5ELS)
  • RNA (5'-R(P*AP*AP*AP*UP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.9 Å6(1) 5ELS|1|H
1266NR_4.0_26105.1
Exact match
synthetic construct
5ELS|1|I (5ELS)
  • RNA (5'-R(P*AP*AP*AP*UP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
2.9 Å6(1) 5ELS|1|I
1267NR_4.0_54156.1
Exact match
Homo sapiens
5EME|1|A (5EME)
  • RNA (5'-R(*GP*CP*AP*GP*CP*AP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.2 Å18(1) 5EME|1|A
1268NR_4.0_43988.1
Exact match
Homo sapiens
5EMF|1|A (5EMF)
  • RNA (5'-R(*GP*CP*UP*GP*CP*UP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å15(1) 5EMF|1|A
1269NR_4.0_94252.1
Exact match
synthetic construct
5EMO|1|E (5EMO)
  • RNA (5'-R(P*AP*UP*UP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.0 Å6(1) 5EMO|1|E
1270NR_4.0_18857.1
Exact match
synthetic construct
5EMO|1|F (5EMO)
  • RNA (5'-R(P*AP*UP*UP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.0 Å6(1) 5EMO|1|F
1271NR_4.0_15161.1
Exact match
Homo sapiens
5EN1|1|B (5EN1)
  • RNA (5'-R(*AP*GP*GP*AP*CP*UP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å7(1) 5EN1|1|B
1272NR_4.0_19990.1
Exact match
synthetic construct
5EV4|1|B (5EV4)
  • DNA/RNA (5'-R(P*UP*UP*UP*(UD)P*UP*U)-D(P[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.6 Å6(1) 5EV4|1|B
1273NR_4.0_28023.1
Exact match
5EX7|1|B (5EX7)
  • RNA (5'-R(P*UP*UP*UP*GP*UP*UP*GP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å7(1) 5EX7|1|B
1274NR_4.0_39506.1
Exact match
Mus musculus
5F5F|1|F (5F5F)
  • RNA (5'-R(P*UP*GP*AP*CP*UP*GP*CP*GP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.0 Å20(1) 5F5F|1|F
1275NR_4.0_89230.1
Exact match
Mus musculus
5F5H|1|C (5F5H)
  • RNA (5'-R(P*CP*CP*AP*CP*AP*CP*CP*GP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.2 Å21(1) 5F5H|1|C
1276NR_4.0_58991.1
Exact match
Mus musculus
5F5H|1|D (5F5H)
  • RNA (5'-R(P*CP*CP*AP*CP*AP*CP*CP*GP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.2 Å21(1) 5F5H|1|D
1277NR_4.0_58041.1
Exact match
Escherichia coli
5F6C|1|E (5F6C)
  • RNA (5'-R(P*GP*UP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.0 Å3(1) 5F6C|1|E
1278NR_4.0_94618.1
Exact match
Streptococcus pyogenes
5F9R|1|A (5F9R)
  • RNA (116-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.4 Å115(1) 5F9R|1|A
1279NR_4.0_29999.1
Exact match
synthetic construct
5FJ8|1|T (5FJ8)
  • TEMPLATE DNA
  • ELECTRON MICROSCOPY
  • Chain(s): T; model(s): 1
3.9 Å9(1) 5FJ8|1|T
1280NR_4.0_87093.1
Exact match
Pepino mosaic virus
5FN1|1|B (5FN1)
  • 5'-R(*UP*UP*UP*UP*UP)-3'
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
3.9 Å5(1) 5FN1|1|B
1281NR_4.0_28269.1
Exact match
Lactococcus lactis
5G2X|1|A (5G2X)
  • GROUP II INTRON
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.8 Å692(1) 5G2X|1|A
1282NR_4.0_16594.1
Exact match
Haloarcula marismortui
5G4T|1|A+5G4T|1|B (5G4T)
  • HMKT-7
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.8 Å11(1) 5G4T|1|A+5G4T|1|B
1283NR_4.0_89190.1
Exact match
Saccharomyces cerevisiae
5GAM|1|W (5GAM)
  • U6 snRNA, 5' end
  • ELECTRON MICROSCOPY
  • Chain(s): W; model(s): 1
3.7 Å25(1) 5GAM|1|W
1284NR_4.0_89185.1
Exact match
Saccharomyces cerevisiae
5GAP|1|V (5GAP)
  • U4 snRNA, 5' region, nucleotides 1-67
  • ELECTRON MICROSCOPY
  • Chain(s): V; model(s): 1
3.6 Å67(1) 5GAP|1|V
1285NR_4.0_48507.1
Exact match
synthetic construct
5GJB|1|B (5GJB)
  • RNA (5'-R(*AP*GP*AP*UP*CP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.7 Å5(1) 5GJB|1|B
1286NR_4.0_83946.1
Exact match
Bombyx mori
5GUH|1|B (5GUH)
  • RNA (28-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å7(1) 5GUH|1|B
1287NR_4.0_05778.1
Exact match
Homo sapiens
5GXH|1|B (5GXH)
  • RNA (5'-R(*A*AP*UP*UP*UP*UP*UP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å7(1) 5GXH|1|B
1288NR_4.0_24908.1
Exact match
Homo sapiens
5GXI|1|B (5GXI)
  • RNA (5'-R(*A*AP*UP*UP*UP*UP*UP*GP*AP*G)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å5(1) 5GXI|1|B
1289NR_4.0_93255.1
Exact match
5H0R|1|H+5H0R|1|I (5H0R)
  • RNA (42-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): B, C, D, F, G, H, I; model(s): 1
3.9 Å42(1) 5H0R|1|H+5H0R|1|I
1290NR_4.0_69774.1
Exact match
Homo sapiens
5H1K|1|C+5H1K|1|D (5H1K)
  • U4 snRNA (5'-R(*GP*CP*AP*AP*UP*UP*UP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H; model(s): 1
1.9 Å13(1) 5H1K|1|C+5H1K|1|D
1291NR_4.0_67036.1
Exact match
Homo sapiens
5H1L|1|B (5H1L)
  • U4 snRNA (5'-R(*AP*UP*UP*UP*UP*UP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.1 Å7(1) 5H1L|1|B
1292NR_4.0_20024.1
Exact match
Homo sapiens
5H3U|1|C (5H3U)
  • RNA (5'-R(*AP*AP*UP*UP*UP*UP*UP*GP*AP*C)[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.5 Å7(1) 5H3U|1|C
1293NR_4.0_20856.1
Exact match
Mycobacterium tuberculosis
5HJZ|1|C (5HJZ)
  • RNA (5'-R(*CP*AP*UP*C)-D(P*U)-R(P*AP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.0 Å4(1) 5HJZ|1|C
1294NR_4.0_84831.1
Exact match
Mycobacterium tuberculosis
5HKC|1|C (5HKC)
  • RNA (5'-R(*GP*UP*C)-D(P*U)-R(P*CP*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.7 Å1(1) 5HKC|1|C
1295NR_4.0_14212.1
Exact match
synthetic construct
5HO4|1|B (5HO4)
  • RNA (5'-R(*AP*AP*GP*GP*AP*CP*UP*AP*GP*C)[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å10(1) 5HO4|1|B
1296NR_4.0_91999.1
Exact match
Human gammaherpesvirus 8
5HSW|1|B (5HSW)
  • RNA (5'-R(P*UP*CP*UP*UP*GP*AP*AP*GP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.3 Å18(1) 5HSW|1|B
1297NR_4.0_38769.1
Exact match
synthetic construct
5I9D|1|B (5I9D)
  • RNA (5'-R(*GP*GP*GP*G*UP*UP*UP*UP*AP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å11(1) 5I9D|1|B
1298NR_4.0_66760.1
Exact match
synthetic construct
5I9F|1|F (5I9F)
  • RNA (5'-R(*GP*GP*GP*GP*UP*UP*UP*UP*UP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.2 Å11(1) 5I9F|1|F
1299NR_4.0_00518.1
Exact match
synthetic construct
5I9G|1|A (5I9G)
  • RNA (5'-R(*GP*GP*G*GP*UP*UP*UP*UP*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å12(1) 5I9G|1|A
1300NR_4.0_36938.1
Exact match
synthetic construct
5I9H|1|B (5I9H)
  • RNA (5'-R(*GP*GP*GP*GP*UP*UP*UP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å11(1) 5I9H|1|B
1301NR_4.0_08854.1
Exact match
Thermus thermophilus
5IB8|1|1L (5IB8)
  • tRNALys
  • X-RAY DIFFRACTION
  • Chain(s): 1L; model(s): 1
3.1 Å64(1) 5IB8|1|1L
1302NR_4.0_61479.1
Exact match
Thermus thermophilus
5IBB|1|1L (5IBB)
  • tRNAVal
  • X-RAY DIFFRACTION
  • Chain(s): 1L; model(s): 1
3.0 Å67(1) 5IBB|1|1L
1303NR_4.0_09192.1
Exact match
synthetic construct
5ID6|1|G (5ID6)
  • RNA (5'-R(P*AP*AP*UP*UP*UP*CP*UP*AP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.4 Å21(1) 5ID6|1|G
1304NR_4.0_88410.1
Exact match
Salmonella enterica
5IMQ|1|4 (5IMQ)
  • P- site tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 4; model(s): 1
3.8 Å77(1) 5IMQ|1|4
1305NR_4.0_04887.1
Exact match
Salmonella enterica
5IMQ|1|5 (5IMQ)
  • E site tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 5; model(s): 1
3.8 Å76(1) 5IMQ|1|5
1306NR_4.0_08498.1
Exact match
synthetic construct
5IP2|1|E (5IP2)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.3 Å5(1) 5IP2|1|E
1307NR_4.0_95963.2
Exact match
synthetic construct
5IPL|1|3 (5IPL)
  • nascent RNA 4-mer
  • X-RAY DIFFRACTION
  • Chain(s): 3; model(s): 1
3.6 Å3(1) 5IPL|1|3
1308NR_4.0_42334.1
Exact match
Kluyveromyces lactis
5IT7|1|8 (5IT7)
  • 5.8S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 8; model(s): 1
3.6 Å157(1) 5IT7|1|8
1309NR_4.0_87892.3
Exact match
Cricket paralysis virus
5IT9|1|i (5IT9)
  • Cricket paralysis virus IRES RNA
  • ELECTRON MICROSCOPY
  • Chain(s): i; model(s): 1
3.8 Å192(1) 5IT9|1|i
1310NR_4.0_15997.1
Exact match
Homo sapiens
5IYD|1|Z (5IYD)
  • RNA
  • ELECTRON MICROSCOPY
  • Chain(s): Z; model(s): 1
3.9 Å6(1) 5IYD|1|Z
1311NR_4.0_53856.1
Exact match
synthetic construct
5JBG|1|X (5JBG)
  • RNA (5'-R(*GPPP*GP*AP*GP*CP*GP*UP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.0 Å22(1) 5JBG|1|X
1312NR_4.0_60222.1
Exact match
synthetic construct
5JBJ|1|X+5JBJ|1|Y (5JBJ)
  • RNA (5'-R(P*GP*GP*UP*AP*GP*CP*GP*CP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, X, Y; model(s): 1
3.6 Å12(1) 5JBJ|1|X+5JBJ|1|Y
1313NR_4.0_52870.1
Exact match
unidentified
5JC7|1|X+5JC7|1|Y (5JC7)
  • RNA (5'-R(P*GP*GP*AP*CP*GP*UP*CP*AP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, X, Y; model(s): 1
2.8 Å24(1) 5JC7|1|X+5JC7|1|Y
1314NR_4.0_16377.1
Exact match
unidentified
5JCF|1|Y+5JCF|1|X (5JCF)
  • RNA (5'-R(P*AP*GP*GP*UP*AP*CP*GP*UP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, X, Y; model(s): 1
2.6 Å11(1) 5JCF|1|Y+5JCF|1|X
1315NR_4.0_71119.1
Exact match
synthetic construct
5JEA|1|R (5JEA)
  • RNA (29-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.7 Å27(1) 5JEA|1|R
1316NR_4.0_51249.1
Exact match
synthetic construct
5JJI|1|G (5JJI)
  • rU12: 5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.6 Å7(1) 5JJI|1|G
1317NR_4.0_88451.1
Exact match
synthetic construct
5JJK|1|G (5JJK)
  • rA12: RNA (5'-R(P*AP*AP*AP*AP*AP*AP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
3.2 Å7(1) 5JJK|1|G
1318NR_4.0_31449.1
Exact match
synthetic construct
5JJL|1|G (5JJL)
  • rU12: RNA (5'-R(P*UP*UP*UP*UP*UP*UP*U)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
3.2 Å9(1) 5JJL|1|G
1319NR_4.0_89476.1
Exact match
unidentified
5JRC|1|E (5JRC)
  • ssRNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.9 Å7(1) 5JRC|1|E
1320NR_4.0_26975.1
Exact match
synthetic construct
5JS1|1|B (5JS1)
  • siRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å10(1) 5JS1|1|B
1321NR_4.0_55504.1
Exact match
Foot-and-mouth disease virus
5JXS|1|B+5JXS|1|C (5JXS)
  • RNA Template
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H; model(s): 1
2.8 Å8(1) 5JXS|1|B+5JXS|1|C
1322NR_4.0_70040.1
Exact match
synthetic construct
5K36|1|L (5K36)
  • RNA (17-MER)
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
3.1 Å17(1) 5K36|1|L
1323NR_4.0_38498.1
Exact match
synthetic construct
5K36|1|M (5K36)
  • RNA (17-MER)
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
3.1 Å7(1) 5K36|1|M
1324NR_4.0_46370.1
Exact match
synthetic construct
5K8H|1|A (5K8H)
  • RNA 7-mer
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å2(1) 5K8H|1|A
1325NR_4.0_21137.1
Exact match
Escherichia coli
5KCS|1|1x (5KCS)
  • P-site tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 1x; model(s): 1
3.9 Å69(1) 5KCS|1|1x
1326NR_4.0_35200.1
Exact match
Homo sapiens
5KI6|1|B (5KI6)
  • miR-122
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å9(1) 5KI6|1|B
1327NR_4.0_14866.1
Exact match
Acidaminococcus sp. BV3L6
5KK5|1|B (5KK5)
  • RNA (40-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.3 Å40(1) 5KK5|1|B
1328NR_4.0_03624.1
Exact match
Drosophila melanogaster
5KL1|1|C (5KL1)
  • RNA (5'-R(*AP*AP*AP*UP*UP*GP*UP*AP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.7 Å12(1) 5KL1|1|C
1329NR_4.0_65457.1
Exact match
Drosophila melanogaster
5KL8|1|C (5KL8)
  • RNA (5'-R(*UP*AP*UP*UP*UP*GP*UP*AP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
4.0 Å11(1) 5KL8|1|C
1330NR_4.0_11837.1
Exact match
Drosophila melanogaster
5KLA|1|B (5KLA)
  • RNA (5'-R(*UP*GP*UP*AP*CP*AP*UP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.1 Å8(1) 5KLA|1|B
1331NR_4.0_74174.1
Exact match
unidentified
5KPY|1|A (5KPY)
  • 5-hydroxytryptophan RNA aptamer
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å71(1) 5KPY|1|A
1332NR_4.0_43598.1
Exact match
synthetic construct
5KVJ|1|A+5KVJ|1|B (5KVJ)
  • RNA (5'-R(P*CP*CP*AP*UP*CP*CP*UP*CP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.3 Å16(1) 5KVJ|1|A+5KVJ|1|B
1333NR_4.0_30430.1
Exact match
Escherichia coli
5L3P|1|y (5L3P)
  • deacylated A/R-tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): y; model(s): 1
3.7 Å66(1) 5L3P|1|y
1334NR_4.0_16899.1
Exact match
Staphylococcus aureus
5LI0|1|a (5LI0)
  • 16S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): a; model(s): 1
3.8 Å1547(1) 5LI0|1|a
1335NR_4.0_20829.2
Exact match
Saccharomyces cerevisiae
5LJ3|1|Z+5LJ3|1|V (5LJ3)
  • U2 snRNA (small nuclear RNA)
  • ELECTRON MICROSCOPY
  • Chain(s): B, C, D, F, G, H, V, Z; model(s): 1
3.8 Å171(1) 5LJ3|1|Z+5LJ3|1|V
1336NR_4.0_08929.1
Exact match
synthetic construct
5LTA|1|E (5LTA)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.6 Å11(1) 5LTA|1|E
1337NR_4.0_83636.1
Exact match
Escherichia coli
5LZD|1|x (5LZD)
  • SECIS mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): x; model(s): 1
3.4 Å48(1) 5LZD|1|x
1338NR_4.0_76892.1
Exact match
Escherichia coli
5LZD|1|y (5LZD)
  • Sec-tRNASec
  • ELECTRON MICROSCOPY
  • Chain(s): y; model(s): 1
3.4 Å91(1) 5LZD|1|y
1339NR_4.0_93656.1
Exact match
Oryctolagus cuniculus
5LZS|1|ii (5LZS)
  • tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): ii; model(s): 1
3.3 Å76(1) 5LZS|1|ii
1340NR_4.0_66328.1
Exact match
Saccharomyces cerevisiae
5M0H|1|A (5M0H)
  • ASH1 E3 (42 nt-TL/TLR)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å42(1) 5M0H|1|A
1341NR_4.0_90603.1
Exact match
Saccharomyces cerevisiae
5M0I|1|E (5M0I)
  • ASH1-E3 element, RNA (28-MER)
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.4 Å28(1) 5M0I|1|E
1342NR_4.0_86202.1
Exact match
Saccharomyces cerevisiae
5M0I|1|F (5M0I)
  • ASH1-E3 element, RNA (28-MER)
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.4 Å28(1) 5M0I|1|F
1343NR_4.0_57646.1
Exact match
Saccharomyces cerevisiae
5M0J|1|E (5M0J)
  • ASH1 E3 (28 nt-loop)
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.8 Å28(1) 5M0J|1|E
1344NR_4.0_78625.1
Exact match
Saccharomyces cerevisiae
5M0J|1|F (5M0J)
  • ASH1 E3 (28 nt-loop)
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.8 Å28(1) 5M0J|1|F
1345NR_4.0_63925.1
Exact match
Influenza A virus
5M3H|1|V+5M3H|1|R (5M3H)
  • RNA 5'-pAGUAGUAACAAGAGGG
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, R, V; model(s): 1
2.5 Å16(1) 5M3H|1|V+5M3H|1|R
1346NR_4.0_32983.1
Exact match
Saccharomyces cerevisiae
5M5Y|1|R (5M5Y)
  • RNA
  • ELECTRON MICROSCOPY
  • Chain(s): R; model(s): 1
4.0 Å7(1) 5M5Y|1|R
1347NR_4.0_38180.1
Exact match
Zika virus
5MFX|1|B (5MFX)
  • RNA (5'-R(P*AP*GP*AP*CP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.6 Å5(1) 5MFX|1|B
1348NR_4.0_35869.1
Exact match
Escherichia coli
5MGP|1|x (5MGP)
  • P-site tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): x; model(s): 1
3.1 Å77(1) 5MGP|1|x
1349NR_4.0_15375.1
Exact match
Parechovirus A
5MJV|1|D (5MJV)
  • RNA (5'-R(*GP*UP*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.1 Å6(1) 5MJV|1|D
1350NR_4.0_12290.1
Exact match
Spinacia oleracea
5MMM|1|z (5MMM)
  • tRNA-Phe
  • ELECTRON MICROSCOPY
  • Chain(s): z; model(s): 1
3.4 Å76(1) 5MMM|1|z
1351NR_4.0_66736.1
Exact match
synthetic construct
5MSG|1|M (5MSG)
  • RNA (5'-D(*(GDM))-R(P*AP*AP*UP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
3.8 Å4(1) 5MSG|1|M
1352NR_4.0_21041.1
Exact match
Homo sapiens
5MWI|1|A (5MWI)
  • RNA G(CUG)8C duplex
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.5 Å28(1) 5MWI|1|A
1353NR_4.0_17501.1
Exact match
Saccharomyces cerevisiae
5N61|1|S (5N61)
  • product RNA
  • ELECTRON MICROSCOPY
  • Chain(s): S; model(s): 1
3.4 Å5(1) 5N61|1|S
1354NR_4.0_22466.1
Exact match
Leishmania donovani
5T2A|1|2 (5T2A)
  • 18S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
2.9 Å1814(1) 5T2A|1|2
1355NR_4.0_29429.1
Exact match
Leishmania donovani
5T2A|1|B (5T2A)
  • LSU-beta
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
2.9 Å1064(1) 5T2A|1|B
1356NR_4.0_17575.1
Exact match
Leishmania donovani
5T2A|1|E (5T2A)
  • srRNA1
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
2.9 Å169(1) 5T2A|1|E
1357NR_4.0_51521.1
Exact match
Leishmania donovani
5T2A|1|F (5T2A)
  • srRNA3
  • ELECTRON MICROSCOPY
  • Chain(s): F; model(s): 1
2.9 Å71(1) 5T2A|1|F
1358NR_4.0_59892.1
Exact match
Leishmania donovani
5T2A|1|H (5T2A)
  • srRNA4
  • ELECTRON MICROSCOPY
  • Chain(s): H; model(s): 1
2.9 Å93(1) 5T2A|1|H
1359NR_4.0_96269.3
Exact match
Homo sapiens
5T2C|1|An (5T2C)
  • tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): An; model(s): 1
3.6 Å75(1) 5T2C|1|An
1360NR_4.0_37449.1
Exact match
metagenome
5T5A|1|A (5T5A)
  • DNA/RNA (71-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å59(1) 5T5A|1|A
1361NR_4.0_25467.1
Exact match
Trypanosoma cruzi
5T5H|1|A+5T5H|1|C (5T5H)
  • RNA LARGE SUBUNIT ALPHA
  • ELECTRON MICROSCOPY
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.5 Å1246(1) 5T5H|1|A+5T5H|1|C
1362NR_4.0_97060.1
Exact match
Trypanosoma cruzi
5T5H|1|B (5T5H)
  • RNA LARGE SUBUNIT BETA,RNA LARGE SUBUNIT[...]
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
2.5 Å910(1) 5T5H|1|B
1363NR_4.0_54575.1
Exact match
Trypanosoma cruzi
5T5H|1|D (5T5H)
  • 5S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
2.5 Å114(1) 5T5H|1|D
1364NR_4.0_26892.1
Exact match
Trypanosoma cruzi
5T5H|1|E (5T5H)
  • srRNA1,srRNA1
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
2.5 Å146(1) 5T5H|1|E
1365NR_4.0_90150.1
Exact match
Trypanosoma cruzi
5T5H|1|G (5T5H)
  • srRNA2,srRNA2
  • ELECTRON MICROSCOPY
  • Chain(s): G; model(s): 1
2.5 Å120(1) 5T5H|1|G
1366NR_4.0_79575.1
Exact match
Trypanosoma cruzi
5T5H|1|H (5T5H)
  • srRNA4,srRNA4
  • ELECTRON MICROSCOPY
  • Chain(s): H; model(s): 1
2.5 Å91(1) 5T5H|1|H
1367NR_4.0_30259.1
Exact match
Mus musculus
5T7B|1|R (5T7B)
  • RNA (UVP)UAUAGAGCAAGAACACUGUU
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.5 Å10(1) 5T7B|1|R
1368NR_4.0_91539.1
Exact match
Sulfobacillus acidophilus
5T83|1|A (5T83)
  • RNA (95-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å90(1) 5T83|1|A
1369NR_4.0_14458.1
Exact match
Enterobacteria phage MS2
5TC1|1|R (5TC1)
  • phage MS2 genome
  • ELECTRON MICROSCOPY
  • Chain(s): R; model(s): 1
3.6 Å242(1) 5TC1|1|R
1370NR_4.0_01439.1
Exact match
Zika virus
5TPY|1|A (5TPY)
  • RNA (71-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å71(1) 5TPY|1|A
1371NR_4.0_34246.1
Exact match
Norwalk virus
5TSN|1|P+5TSN|1|T (5TSN)
  • RNA (5'-R(*UP*GP*CP*CP*CP*GP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, P, T; model(s): 1
2.1 Å8(1) 5TSN|1|P+5TSN|1|T
1372NR_4.0_04754.1
Exact match
Dickeya dadantii
5U3G|1|B (5U3G)
  • ykkC riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å84(1) 5U3G|1|B
1373NR_4.0_66933.1
Exact match
Mycobacterium tuberculosis
5UH5|1|I (5UH5)
  • RNA (5'-R(*GP*GP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
3.8 Å3(1) 5UH5|1|I
1374NR_4.0_18284.1
Exact match
Mycobacterium tuberculosis
5UHC|1|I (5UHC)
  • RNA (5'-R(*GP*GP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
3.8 Å3(1) 5UHC|1|I
1375NR_4.0_68259.1
Exact match
Homo sapiens
5UNE|1|A+5UNE|1|B (5UNE)
  • RNA (47-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.9 Å47(1) 5UNE|1|A+5UNE|1|B
1376NR_4.0_82154.2
Exact match
5UP6|1|R (5UP6)
  • RNA (5'-R(*GP*CP*AP*UP*UP*CP*AP*AP*AP*GP[...]
  • ELECTRON MICROSCOPY
  • Chain(s): R; model(s): 1
17(1) 5UP6|1|R
1377NR_4.0_77035.1
Exact match
Pseudomonas aeruginosa
5UZ9|2|M (5UZ9)
  • CRISPR RNA (60-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): M; model(s): 2
3.4 Å60(1) 5UZ9|2|M
1378NR_4.0_74928.1
Exact match
Homo sapiens
5V7C|1|C (5V7C)
  • RNA (5'-R(*CP*UP*UP*UP*UP*CP*CP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.6 Å8(1) 5V7C|1|C
1379NR_4.0_95531.1
Exact match
Saccharomyces cerevisiae
5WSG|1|b (5WSG)
  • 3'-exon-intron
  • ELECTRON MICROSCOPY
  • Chain(s): b; model(s): 1
4.0 Å14(1) 5WSG|1|b
1380NR_4.0_90696.1
Exact match
Leptotrichia shahii
5WTK|1|B (5WTK)
  • RNA (58-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å40(1) 5WTK|1|B
1381NR_4.0_66547.1
Exact match
Saccharomyces cerevisiae
5WTY|1|C (5WTY)
  • RNA (5'-R(*AP*AP*AP*GP*GP*AP*AP*UP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å11(1) 5WTY|1|C
1382NR_4.0_63837.1
Exact match
Saccharomyces cerevisiae
5WTY|1|D (5WTY)
  • RNA (5'-R(*AP*AP*AP*GP*GP*AP*AP*UP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.8 Å11(1) 5WTY|1|D
1383NR_4.0_31286.1
Exact match
6MSF|1|R (6MSF)
  • RNA (5'-R(*CP*CP*AP*CP*AP*GP*UP*CP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.8 Å14(1) 6MSF|1|R
1384NR_4.0_11942.1
Exact match
6MSF|1|S (6MSF)
  • RNA (5'-R(*CP*AP*GP*UP*CP*AP*CP*UP*GP*G)[...]
  • X-RAY DIFFRACTION
  • Chain(s): S; model(s): 1
2.8 Å10(1) 6MSF|1|S