Exact match 1019;

#Equivalence classRepresentativeResolutionNtsClass members
1NR_3.0_04268.1
Exact match
Panicum mosaic virus
4V99|1|Jw (4V99)
  • 5'-R(P*UP*UP*AP*AP*UP*AP*UP*UP*UP*UP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): Jw; model(s): 1
2.9 Å17(120) 4V99|1|Jw, 4V99|1|A2, 4V99|1|A7, 4V99|1|AD, 4V99|1|AI, 4V99|1|AN, 4V99|1|AS, 4V99|1|AX, 4V99|1|Ac, 4V99|1|Ah, 4V99|1|Am, 4V99|1|Ar, 4V99|1|Aw, 4V99|1|B2, 4V99|1|B7, 4V99|1|BD, 4V99|1|BI, 4V99|1|BN, 4V99|1|BS, 4V99|1|BX, 4V99|1|Bc, 4V99|1|Bh, 4V99|1|Bm, 4V99|1|Br, 4V99|1|Bw, 4V99|1|C2, 4V99|1|C7, 4V99|1|CD, 4V99|1|CI, 4V99|1|CN, 4V99|1|CS, 4V99|1|CX, 4V99|1|Cc, 4V99|1|Ch, 4V99|1|Cm, 4V99|1|Cr, 4V99|1|Cw, 4V99|1|D2, 4V99|1|D7, 4V99|1|DD, 4V99|1|DI, 4V99|1|DN, 4V99|1|DS, 4V99|1|DX, 4V99|1|Dc, 4V99|1|Dh, 4V99|1|Dm, 4V99|1|Dr, 4V99|1|Dw, 4V99|1|E2, 4V99|1|E7, 4V99|1|ED, 4V99|1|EI, 4V99|1|EN, 4V99|1|ES, 4V99|1|EX, 4V99|1|Ec, 4V99|1|Eh, 4V99|1|Em, 4V99|1|Er, 4V99|1|Ew, 4V99|1|F2, 4V99|1|F7, 4V99|1|FD, 4V99|1|FI, 4V99|1|FN, 4V99|1|FS, 4V99|1|FX, 4V99|1|Fc, 4V99|1|Fh, 4V99|1|Fm, 4V99|1|Fr, 4V99|1|Fw, 4V99|1|G2, 4V99|1|G7, 4V99|1|GD, 4V99|1|GI, 4V99|1|GN, 4V99|1|GS, 4V99|1|GX, 4V99|1|Gc, 4V99|1|Gh, 4V99|1|Gm, 4V99|1|Gr, 4V99|1|Gw, 4V99|1|H2, 4V99|1|H7, 4V99|1|HD, 4V99|1|HI, 4V99|1|HN, 4V99|1|HS, 4V99|1|HX, 4V99|1|Hc, 4V99|1|Hh, 4V99|1|Hm, 4V99|1|Hr, 4V99|1|Hw, 4V99|1|I2, 4V99|1|I7, 4V99|1|ID, 4V99|1|II, 4V99|1|IN, 4V99|1|IS, 4V99|1|IX, 4V99|1|Ic, 4V99|1|Ih, 4V99|1|Im, 4V99|1|Ir, 4V99|1|Iw, 4V99|1|J2, 4V99|1|J7, 4V99|1|JD, 4V99|1|JI, 4V99|1|JN, 4V99|1|JS, 4V99|1|JX, 4V99|1|Jc, 4V99|1|Jh, 4V99|1|Jm, 4V99|1|Jr
2NR_3.0_65795.26
Exact match
Thermus thermophilus
1FJG|1|A (1FJG)
  • 16S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å1507(106) 1FJG|1|A, 2UUA|1|A, 1N32|1|A, 4B3M|1|A, 2UUB|1|A, 2VQE|1|A, 5J8B|1|a, 4W2I|1|AA, 4B3R|1|A, 5FDV|1|1a, 4W2I|1|CA, 5J4C|1|1a, 4V9H|1|AA, 4Y4O|1|1a, 2VQF|1|A, 4Z8C|1|1a, 4B3T|1|A, 4Y4O|1|2a, 5FDU|1|1a, 1VY4|1|AA, 4W2G|1|AA, 5FDU|1|2a, 5J4B|1|1a, 4W2F|1|AA, 2UXC|1|A, 3T1Y|1|A, 1VY5|1|AA, 4W2E|1|a, 4W2F|1|CA, 4WPO|1|DA, 5FDV|1|2a, 5F8K|1|1a, 4Z3S|1|1a, 1VY5|1|CA, 5DOY|1|1a, 4W2G|1|CA, 4WPO|1|BA, 5W4K|1|1a, 4Y4P|1|1a, 5DOY|1|2a, 1XMQ|1|A, 5HAU|1|2a, 4V8I|1|AA, 5J4B|1|2a, 4Z8C|1|2a, 5HCQ|1|1a, 5HCQ|1|2a, 5VP2|1|1a, 5HAU|1|1a, 4LNT|1|QA, 5W4K|1|2a, 5HD1|1|2a, 4V67|1|AA, 4Z3S|1|2a, 4W2H|1|CA, 5F8K|1|2a, 5HCP|1|2a, 4W2H|1|AA, 4V8D|1|CA, 4V67|1|CA, 5J4C|1|2a, 4V8I|1|CA, 5HCR|1|2a, 4WQY|1|BA, 4LNT|1|XA, 5HCR|1|1a, 4V9R|1|CA, 4Y4P|1|2a, 1VY4|1|CA, 1VY6|1|AA, 4WQF|1|BA, 5HCP|1|1a, 5HD1|1|1a, 4V8B|1|CA, 1VY7|1|AA, 4WQU|1|BA, 4V8D|1|AA, 5VP2|1|2a, 4V9R|1|AA, 1VY6|1|CA, 5IBB|1|1G, 5IB7|1|13, 1VY7|1|CA, 4V8B|1|AA, 5IBB|1|13, 4WQY|1|DA, 4WQF|1|DA, 4V90|1|AA, 5E81|1|13, 4V51|1|CA, 4WQU|1|DA, 5E81|1|1G, 4V51|1|AA, 4WSD|1|13, 4WSD|1|1G, 4V8G|1|CA, 4V7W|1|AA, 4V7W|1|CA, 5IB7|1|1G, 4V7X|1|AA, 4V7X|1|CA, 4V7Y|1|CA, 4V7Y|1|AA, 4V8G|1|AA, 4V7L|1|CA, 4V7L|1|AA
3NR_3.0_97519.22
Exact match
Thermus thermophilus
5FDU|1|1A (5FDU)
  • 23S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): 1A; model(s): 1
2.9 Å2861(94) 5FDU|1|1A, 5HCQ|1|1A, 5W4K|1|1A, 5HCR|1|1A, 5FDV|1|1A, 4Y4O|1|1A, 5HD1|1|1A, 4Z8C|1|1A, 5HCP|1|1A, 4V8I|1|DA, 4Y4P|1|1A, 4V9R|1|BA, 5F8K|1|1A, 1VY4|1|BA, 4W2H|1|BA, 5VP2|1|1A, 4WPO|1|AA, 4W2F|1|BA, 5J4B|1|1A, 5DOY|1|1A, 4Z3S|1|1A, 4W2G|1|BA, 4W2I|1|BA, 5FDV|1|2A, 5J4C|1|1A, 4V8I|1|BA, 4Y4O|1|2A, 4V9R|1|DA, 1VY5|1|BA, 5J8B|1|A, 5FDU|1|2A, 5HCQ|1|2A, 4Z8C|1|2A, 5W4K|1|2A, 5F8K|1|2A, 1VY4|1|DA, 1VY7|1|BA, 4W2H|1|DA, 5HAU|1|1A, 4V8G|1|DA, 4WQY|1|AA, 4W2F|1|DA, 4V8G|1|BA, 4Z3S|1|2A, 4W2I|1|DA, 4WQF|1|AA, 4WQU|1|AA, 1VY6|1|BA, 5HD1|1|2A, 4WPO|1|CA, 5HCR|1|2A, 4W2G|1|DA, 1VY5|1|DA, 5J4B|1|2A, 4Y4P|1|2A, 4V9H|1|BA, 5HCP|1|2A, 1VY7|1|DA, 5HAU|1|2A, 5J4C|1|2A, 4LNT|1|YA, 5DOY|1|2A, 4WQU|1|CA, 4W2E|1|A, 4V8B|1|BA, 4WQY|1|CA, 1VY6|1|DA, 5VP2|1|2A, 4WQF|1|CA, 4V67|1|DA, 4V8B|1|DA, 4LNT|1|RA, 5IBB|1|1H, 4V67|1|BA, 4V8D|1|BA, 4V7Y|1|BA, 4V7X|1|BA, 4V7Y|1|DA, 4V7X|1|DA, 5IB7|1|1H, 4V7W|1|BA, 4V7W|1|DA, 5IBB|1|14, 4V90|1|BA, 5E81|1|1H, 4V8D|1|DA, 5E81|1|14, 4V51|1|BA, 5IB7|1|14, 4V51|1|DA, 4WSD|1|1H, 4WSD|1|14, 4V7L|1|BA, 4V7L|1|DA
4NR_3.0_42622.22
Exact match
Thermus thermophilus
5W4K|1|1B (5W4K)
  • 5S Ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): 1B; model(s): 1
2.7 Å120(94) 5W4K|1|1B, 5IB7|1|16, 4Z3S|1|1B, 4Y4P|1|1B, 4WQF|1|AB, 4WQY|1|AB, 4V9R|1|BB, 4W2G|1|BB, 1VY4|1|BB, 5E81|1|16, 5HAU|1|1B, 5DOY|1|1B, 5FDV|1|1B, 5J4C|1|1B, 5VP2|1|1B, 4WPO|1|AB, 5J8B|1|B, 1VY7|1|BB, 1VY6|1|BB, 4W2H|1|DB, 5FDU|1|1B, 4WSD|1|16, 5E81|1|1J, 5IBB|1|1J, 4V8D|1|BB, 4V8B|1|BB, 4V8D|1|DB, 4Y4O|1|1B, 5HCQ|1|1B, 5FDV|1|2B, 4Z3S|1|2B, 4WQU|1|AB, 4W2E|1|B, 4W2I|1|BB, 4W2F|1|BB, 1VY5|1|BB, 4WQY|1|CB, 4WPO|1|CB, 4V9R|1|DB, 4LNT|1|RB, 4LNT|1|YB, 4Z8C|1|1B, 5HCP|1|1B, 5HD1|1|1B, 5F8K|1|2B, 5HAU|1|2B, 4Y4O|1|2B, 5FDU|1|2B, 5HCQ|1|2B, 4W2H|1|BB, 4WQU|1|CB, 4WQF|1|CB, 5IB7|1|1J, 4V8B|1|DB, 5HCR|1|1B, 5J4B|1|1B, 5F8K|1|1B, 4V8I|1|BB, 1VY5|1|DB, 4W2G|1|DB, 4W2I|1|DB, 4V67|1|BB, 4V67|1|DB, 5HCR|1|2B, 4V8G|1|BB, 4V8I|1|DB, 4V7X|1|BB, 5IBB|1|16, 4Z8C|1|2B, 4V8G|1|DB, 4W2F|1|DB, 4V7L|1|BB, 4V9H|1|BB, 4V7Y|1|BB, 4V7Y|1|DB, 4V7X|1|DB, 5HD1|1|2B, 5DOY|1|2B, 1VY4|1|DB, 4V51|1|BB, 4V90|1|BB, 4V7W|1|BB, 4V51|1|DB, 4V7W|1|DB, 4WSD|1|1J, 5J4C|1|2B, 5HCP|1|2B, 5J4B|1|2B, 4V7L|1|DB, 5W4K|1|2B, 1VY6|1|DB, 1VY7|1|DB, 4Y4P|1|2B, 5VP2|1|2B
5NR_3.0_19951.18
Exact match
Escherichia coli
4YCO|1|D (4YCO)
  • tRNAphe
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.1 Å74(90) 4YCO|1|D, 2ZXU|1|C, 2ZM5|1|C, 4YCO|1|E, 3FOZ|1|C, 3L0U|1|A, 4YCO|1|F, 4V9D|1|BV, 3FOZ|1|D, 4WOI|1|DW, 4Z3S|1|2w, 2ZM5|1|D, 5W4K|1|1w, 4W2F|1|AW, 5AFI|1|y, 5DOY|1|1w, 5VP2|1|2y, 2ZXU|1|D, 4Z3S|1|1w, 5J4B|1|1w, 4Y4P|1|1w, 5IQR|1|6, 5VP2|1|1w, 5W4K|1|2w, 5W4K|1|1y, 4W2E|1|w, 4V9H|1|AV, 1VY5|1|AW, 4WQU|1|BW, 4WQF|1|BW, 4WQU|1|DW, 4WQF|1|DW, 5J4C|1|1w, 5DOY|1|1y, 4Z3S|1|1y, 5J4B|1|1y, 5DOY|1|2w, 5W4K|1|2y, 4W2I|1|AW, 1VY4|1|AY, 4W2E|1|x, 5J4C|1|2y, 4Y4P|1|2y, 5J4B|1|2y, 5VP2|1|1y, 5J4C|1|1y, 4W2G|1|AW, 1VY5|1|CW, 4WPO|1|DW, 4Y4P|1|2w, 5VP2|1|2w, 1VY4|1|AW, 4V9D|1|AV, 4W2G|1|AY, 4W2F|1|AY, 4WQU|1|BY, 4WPO|1|BY, 4WQF|1|BY, 1VY4|1|CW, 5J4B|1|2w, 4W2G|1|CW, 4Z3S|1|2y, 5DOY|1|2y, 4W2F|1|CY, 1VY4|1|CY, 4W2G|1|CY, 4V51|1|AW, 4Y4P|1|1y, 4W2I|1|AY, 1VY5|1|AY, 4W2I|1|CW, 4WPO|1|BW, 4W2I|1|CY, 4WQU|1|DY, 4WPO|1|DY, 4WQF|1|DY, 5J4C|1|2w, 4W2F|1|CW, 4V51|1|CW, 1VY5|1|CY, 4WSD|1|3L, 4WSD|1|1L, 4WSD|1|3K, 5IQR|1|4, 4WOI|1|AX, 4WSD|1|1K, 4W2H|1|AY, 1VY7|1|AY, 1VY7|1|CY, 4W2H|1|CY
6NR_3.0_35542.39
Exact match
Escherichia coli
4V9R|1|AX (4V9R)
  • P-site tRNA
  • X-RAY DIFFRACTION
  • Chain(s): AX; model(s): 1
3.0 Å76(79) 4V9R|1|AX, 4V9R|1|CX, 4V67|1|AY, 4V67|1|CY, 5MDV|1|5, 4Z3S|1|1x, 5DOY|1|2x, 5L4O|1|A, 4V8B|1|AC, 4V67|1|AZ, 4V8B|1|CC, 4V67|1|CZ, 4LNT|1|XV, 5HCP|1|1x, 5HCQ|1|1x, 5HCR|1|1x, 4Y4P|1|1x, 5W4K|1|2x, 4Y4P|1|2x, 5VP2|1|2x, 4Z8C|1|2x, 4W2I|1|AX, 4W2G|1|AX, 4W2F|1|AX, 1VY5|1|AX, 4W2H|1|AX, 4W2I|1|CX, 4W2G|1|CX, 4W2F|1|CX, 1VY5|1|CX, 5DOY|1|1x, 5IBB|1|2L, 4Z3S|1|2x, 1VY6|1|AX, 1VY4|1|AX, 1VY7|1|AX, 1VY6|1|CX, 4WPO|1|DX, 4V8D|1|AC, 4LNT|1|QV, 5HAU|1|1w, 5VP2|1|1x, 4Z8C|1|1x, 5J4B|1|1x, 5HD1|1|1x, 5W4K|1|1x, 5IB7|1|2K, 4WSD|1|2K, 5IBB|1|2K, 5HAU|1|2w, 5J4C|1|2x, 5HCQ|1|2x, 5HD1|1|2x, 5HCP|1|2x, 5HCR|1|2x, 5J4B|1|2x, 4WQY|1|BX, 4V8D|1|CC, 4WPO|1|BX, 5F8K|1|1x, 5J4C|1|1x, 4WSD|1|2L, 5F8K|1|2x, 4W2H|1|CX, 4WQY|1|DX, 4V51|1|AV, 4V51|1|CV, 4V7L|1|AX, 1VY4|1|CX, 1VY7|1|CX, 5IB7|1|2L, 2FMT|1|C, 2FMT|1|D, 5AFI|1|v, 5IQR|1|5, 4V7L|1|CX, 4V8B|1|AD, 4V8B|1|CD, 5AFI|1|w
7NR_3.0_26150.1
Exact match
Haloarcula marismortui
4V9F|1|0 (4V9F)
  • 23S Ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): 0; model(s): 1
2.4 Å2803(58) 4V9F|1|0, 1S72|1|0, 1VQO|1|0, 3CC2|1|0, 1VQK|1|0, 1VQP|1|0, 3CCU|1|0, 1JJ2|1|0, 1VQ6|1|0, 3CPW|1|0, 1VQM|1|0, 3CC4|1|0, 3G6E|1|0, 1VQ4|1|0, 1VQ8|1|0, 1VQL|1|0, 1M90|1|A, 3CCM|1|0, 1VQ9|1|0, 1YHQ|1|0, 1NJI|1|A, 1VQ7|1|0, 1VQN|1|0, 1YI2|1|0, 3CC7|1|0, 3CXC|1|0, 1K9M|1|A, 1VQ5|1|0, 3OW2|1|0, 3CCL|1|0, 3CMA|1|0, 1YIT|1|0, 3CCV|1|0, 3CCQ|1|0, 1YIJ|1|0, 1YJW|1|0, 3G71|1|0, 1N8R|1|A, 1Q86|1|A, 1YJN|1|0, 1Q82|1|A, 1FFK|1|0, 2OTL|1|0, 3CD6|1|0, 1Q81|1|A, 1K8A|1|A, 1YJ9|1|0, 3CCE|1|0, 1KD1|1|A, 3I56|1|0, 1QVG|1|0, 2OTJ|1|0, 3CCS|1|0, 2QEX|1|0, 3CME|1|0, 3CCR|1|0, 2QA4|1|0, 1FG0|1|A
8NR_3.0_25303.1
Exact match
Haloarcula marismortui
1S72|1|9 (1S72)
  • 5S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): 9; model(s): 1
2.4 Å122(57) 1S72|1|9, 3CCE|1|9, 3CCQ|1|9, 1VQ5|1|9, 1VQ4|1|9, 1M90|1|B, 1VQO|1|9, 1VQP|1|9, 3CPW|1|9, 3CXC|1|9, 1VQ6|1|9, 1YIJ|1|9, 1VQM|1|9, 3CCV|1|9, 1YHQ|1|9, 1Q86|1|B, 1NJI|1|B, 1YI2|1|9, 1VQK|1|9, 1VQL|1|9, 1JJ2|1|9, 3CCU|1|9, 1VQ7|1|9, 1FFK|1|9, 2QEX|1|9, 3CC4|1|9, 3CCL|1|9, 2OTJ|1|9, 3CC7|1|9, 1YIT|1|9, 1VQ8|1|9, 3CCM|1|9, 1YJW|1|9, 1VQN|1|9, 4V9F|1|9, 1QVG|1|9, 3CC2|1|9, 1VQ9|1|9, 3G6E|1|9, 1Q82|1|B, 1K9M|1|B, 1K8A|1|B, 3CMA|1|9, 2OTL|1|9, 3OW2|1|9, 2QA4|1|9, 1N8R|1|B, 1KD1|1|B, 3CME|1|9, 1YJN|1|9, 3CD6|1|9, 3CCR|1|9, 3G71|1|9, 1Q81|1|B, 1YJ9|1|9, 3CCS|1|9, 3I56|1|9
9NR_3.0_10157.30
Exact match
Escherichia coli
4U26|1|BB (4U26)
  • 5S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): BB; model(s): 1
2.8 Å119(38) 4U26|1|BB, 5AFI|1|B, 4U20|1|DB, 4U27|1|BB, 4U24|1|BB, 5J7L|1|DB, 4YBB|1|DB, 4U1U|1|DB, 4U25|1|BB, 4U1U|1|BB, 4U1V|1|BB, 5J5B|1|DB, 5J91|1|DB, 5IQR|1|3, 5J7L|1|CB, 5NWY|1|O, 4U20|1|BB, 4V9D|1|CB, 4V9P|1|CB, 5J91|1|CB, 4YBB|1|CB, 5J5B|1|CB, 4U27|1|DB, 4V9D|1|DB, 4U25|1|DB, 4WOI|1|BB, 5MDV|1|3, 4V9O|1|AB, 4WOI|1|CB, 4U24|1|DB, 4U1V|1|DB, 4V9O|1|CB, 4U26|1|DB, 4V9P|1|AB, 4V9P|1|EB, 4V9O|1|EB, 4V9O|1|GB, 4V9P|1|GB
10NR_3.0_56726.29
Exact match
Escherichia coli
5J5B|1|BA (5J5B)
  • 16S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): BA; model(s): 1
2.8 Å1522(38) 5J5B|1|BA, 5NWY|1|0, 5J91|1|BA, 5J91|1|AA, 5J5B|1|AA, 5J7L|1|AA, 5J7L|1|BA, 5MDV|1|2, 4V9P|1|FA, 4YBB|1|AA, 4V9O|1|FA, 5IQR|1|2, 4U1U|1|CA, 4V9O|1|BA, 5AFI|1|a, 4U20|1|AA, 4V9P|1|BA, 4U1U|1|AA, 4U26|1|AA, 4U24|1|AA, 4YBB|1|BA, 4U20|1|CA, 4U27|1|AA, 4V9P|1|HA, 4U25|1|AA, 4V9O|1|DA, 4U1V|1|CA, 4WOI|1|DA, 4V9P|1|DA, 4V9D|1|BA, 4U27|1|CA, 4U1V|1|AA, 4V9D|1|AA, 4U25|1|CA, 4WOI|1|AA, 4U26|1|CA, 4U24|1|CA, 4V9O|1|HA
11NR_3.0_83717.30
Exact match
Escherichia coli
5J7L|1|DA (5J7L)
  • 23S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): DA; model(s): 1
3.0 Å2886(38) 5J7L|1|DA, 5J5B|1|DA, 5J91|1|DA, 5NWY|1|N, 4YBB|1|DA, 5MDV|1|1, 5J91|1|CA, 5J5B|1|CA, 4V9P|1|EA, 4V9O|1|EA, 5J7L|1|CA, 4V9D|1|CA, 4U27|1|BA, 4U25|1|BA, 5IQR|1|1, 4U24|1|BA, 4V9P|1|CA, 4V9P|1|AA, 4V9O|1|AA, 4U1U|1|BA, 4V9O|1|CA, 4U1V|1|BA, 4V9P|1|GA, 4U20|1|BA, 4U26|1|BA, 4YBB|1|CA, 4WOI|1|BA, 5AFI|1|A, 4V9D|1|DA, 4U1U|1|DA, 4WOI|1|CA, 4U20|1|DA, 4U1V|1|DA, 4U25|1|DA, 4V9O|1|GA, 4U27|1|DA, 4U24|1|DA, 4U26|1|DA
12NR_3.0_21736.3
Exact match
Tobacco virtovirus 1
4OQ9|1|z (4OQ9)
  • RNA (5'-R(P*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): z; model(s): 1
1.5 Å2(35) 4OQ9|1|z, 4NIA|1|1, 4OQ9|1|1, 4NIA|1|2, 4OQ9|1|2, 4NIA|1|3, 4OQ9|1|3, 4NIA|1|4, 4OQ9|1|4, 4NIA|1|5, 4OQ9|1|5, 4NIA|1|6, 4OQ9|1|6, 4NIA|1|7, 4OQ9|1|7, 4NIA|1|8, 4OQ9|1|8, 3ER9|1|D, 4OQ8|1|D, 1DDL|1|E, 5KAL|1|Y, 5KAL|1|Z, 4NIA|1|t, 4OQ9|1|t, 4NIA|1|u, 4OQ9|1|u, 4NIA|1|v, 4OQ9|1|v, 4NIA|1|w, 4OQ9|1|w, 4NIA|1|x, 4OQ9|1|x, 4NIA|1|y, 4OQ9|1|y, 4NIA|1|z
13NR_3.0_24132.2
Exact match
Tobacco virtovirus 1
4OQ9|1|d (4OQ9)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): d; model(s): 1
1.5 Å10(32) 4OQ9|1|d, 1A34|1|B+1A34|1|C, 4OQ8|1|B+4OQ8|1|C, 4OQ9|1|P+4OQ9|1|e, 4NIA|1|P+4NIA|1|e, 4NIA|1|Q, 4OQ9|1|Q, 4NIA|1|R+4NIA|1|g, 4OQ9|1|R+4OQ9|1|g, 4NIA|1|S+4NIA|1|h, 4OQ9|1|S+4OQ9|1|h, 4OQ9|1|T+4OQ9|1|i, 4NIA|1|T+4NIA|1|i, 4NIA|1|U, 4OQ9|1|U, 4NIA|1|V, 4OQ9|1|V, 4NIA|1|W, 4OQ9|1|W, 4OQ9|1|X+4OQ9|1|m, 4NIA|1|X+4NIA|1|m, 4NIA|1|Y+4NIA|1|n, 4OQ9|1|Y+4OQ9|1|n, 4OQ9|1|Z, 4NIA|1|Z, 4OQ9|1|a, 4NIA|1|a, 4OQ9|1|b, 4NIA|1|b, 4OQ9|1|c, 4NIA|1|c, 4NIA|1|d
14NR_3.0_51266.1
Exact match
1ZDK|1|S (1ZDK)
  • RNA (5'-R(P*AP*CP*AP*UP*GP*AP*GP*GP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): S; model(s): 1
2.9 Å19(30) 1ZDK|1|S, 2C4Z|1|R, 2C4Y|1|R, 2C4Q|1|R, 2BU1|1|R, 2C4Q|1|S, 2BU1|1|S, 2C4Z|1|S, 2IZ9|1|R, 2BQ5|1|S, 2BNY|1|R, 2C51|1|R, 2C4Y|1|S, 2BQ5|1|R, 1ZDI|1|R, 1AQ3|1|R, 1AQ4|1|R, 1ZDH|1|R, 2IZM|1|R, 1ZDI|1|S, 1ZDH|1|S, 2IZM|1|S, 2BNY|1|S, 2C50|1|S, 2C51|1|S, 2C50|1|R, 1AQ4|1|S, 2IZ9|1|S, 1ZDK|1|R, 1AQ3|1|S
15NR_3.0_97151.1
Exact match
3TD1|1|B+3TD1|1|A (3TD1)
  • RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B; model(s): 1
2.1 Å22(30) 3TD1|1|B+3TD1|1|A, 3BNL|1|A+3BNL|1|B, 1MWL|1|A+1MWL|1|B, 5BWS|1|A+5BWS|1|B, 4PDQ|1|A+4PDQ|1|B, 2ESI|1|A+2ESI|1|B, 1YRJ|1|A+1YRJ|1|B, 2F4T|1|B+2F4T|1|A, 5BWS|1|C+5BWS|1|D, 4GPW|1|A+4GPW|1|B, 4WCP|1|A+4WCP|1|B+4WCP|1|C, 4GPY|1|A+4GPY|1|B, 4F8U|1|A+4F8U|1|B, 2BEE|1|A+2BEE|1|B, 4F8V|1|A+4F8V|1|B, 2ET4|1|A+2ET4|1|B, 2BE0|1|A+2BE0|1|B, 1LC4|1|A+1LC4|1|B, 4P20|1|A+4P20|1|B, 4GPX|1|A+4GPX|1|B, 3S4P|1|A+3S4P|1|B, 2ET5|1|A+2ET5|1|B, 2PWT|1|A+2PWT|1|B, 2ESJ|1|A+2ESJ|1|B, 3WRU|1|A+3WRU|1|B, 4K32|1|A+4K32|1|B, 2ET3|1|A+2ET3|1|B, 4WCQ|1|A+4WCQ|1|B, 1J7T|1|A+1J7T|1|B, 4P3S|1|B+4P3S|1|A
16NR_3.0_89429.2
Exact match
4FE5|1|B (4FE5)
  • xpt-pbuX guanine riboswitch aptamer doma[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.3 Å67(27) 4FE5|1|B, 3FO4|1|A, 3GOG|1|A, 2XNZ|1|A, 2EEV|1|A, 2G9C|1|A, 3FO6|1|A, 3GAO|1|A, 3GER|1|A, 2EET|1|A, 4FEN|1|B, 4FEO|1|B, 4FEP|1|B, 2EEW|1|A, 2EES|1|A, 2EEU|1|A, 3GES|1|A, 3DS7|1|A, 4FEJ|1|B, 3DS7|1|B, 4FEL|1|B, 2XO0|1|A, 2XNW|1|A, 2XO1|1|A, 3GOT|1|A, 3G4M|1|A, 2B57|1|A
17NR_3.0_98705.1
Exact match
2P7E|1|D+2P7E|1|C+2P7E|1|P (2P7E)
  • Ribozyme strand III
  • X-RAY DIFFRACTION
  • Chain(s): C, D, P; model(s): 1
2.1 Å19(23) 2P7E|1|D+2P7E|1|C+2P7E|1|P, 2D2K|1|D+2D2K|1|C+2D2K|1|A+2D2K|1|B, 3I2R|1|C, 3I2U|1|C, 3I2Q|1|C, 3CQS|1|C, 3CR1|1|C, 3I2S|1|C, 3GS8|1|D+3GS8|1|C+3GS8|1|A+3GS8|1|B, 1ZFV|1|D+1ZFV|1|C+1ZFV|1|A+1ZFV|1|B, 4G6R|1|D+4G6R|1|C+4G6R|1|A+4G6R|1|B, 2P7D|1|D+2P7D|1|C+2P7D|1|P, 1X9C|1|D+1X9C|1|C+1X9C|1|A+1X9C|1|B, 3GS1|1|D+3GS1|1|C+3GS1|1|A+3GS1|1|B, 2BCZ|1|D+2BCZ|1|C+2BCZ|1|A+2BCZ|1|B, 2NPY|1|D+2NPY|1|C+2NPY|1|A+2NPY|1|B, 2OUE|1|D+2OUE|1|C+2OUE|1|A+2OUE|1|B, 2BCY|1|D+2BCY|1|C+2BCY|1|A+2BCY|1|B, 1ZFT|1|D+1ZFT|1|C+1ZFT|1|A+1ZFT|1|B, 2FGP|1|D+2FGP|1|C+2FGP|1|A+2FGP|1|B, 1ZFX|1|D+1ZFX|1|C+1ZFX|1|A+1ZFX|1|B, 2P7F|1|D+2P7F|1|C+2P7F|1|A+2P7F|1|B, 2D2L|1|D+2D2L|1|C+2D2L|1|A+2D2L|1|B
18NR_3.0_94729.2
Exact match
1JBR|1|D (1JBR)
  • 31-mer SRD RNA analog
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.2 Å31(22) 1JBR|1|D, 1JBT|1|C, 1JBT|1|D, 480D|1|A, 4Y27|1|A, 4NLF|1|A, 1JBS|1|C, 1JBS|1|D, 3DW4|1|A, 1MSY|1|A, 3DW6|1|A, 5D99|1|A, 3DVZ|1|A, 3S7C|1|A, 4NXH|1|A, 5NQI|1|A, 3S8U|1|A, 1Q9A|1|A, 483D|1|A, 3DW5|1|A, 4NMG|1|A, 3DW7|1|A
19NR_3.0_66387.1
Exact match
3OK4|1|Z (3OK4)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
1.2 Å10(22) 3OK4|1|Z, 3OK4|1|2, 3OK4|1|4, 3OK4|1|B, 3OK2|1|B, 3OK4|1|D, 3OK2|1|D, 2BJ6|1|E, 3OK4|1|F, 3OK2|1|F, 2BJ6|1|F, 2BJ6|1|G, 3OK4|1|H, 2BJ6|1|H, 3OK4|1|J, 3OK4|1|L, 3OK4|1|N, 3OK4|1|P, 3OK4|1|R, 3OK4|1|T, 3OK4|1|V, 3OK4|1|X
20NR_3.0_29423.1
Exact match
4V4F|1|BZ (4V4F)
  • 5'-R(*UP*AP*GP*AP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): BZ; model(s): 1
1.9 Å3(22) 4V4F|1|BZ, 4V4F|1|A3, 4V4F|1|A5, 4V4F|1|B0, 4V4F|1|B6, 4V4F|1|A0, 4V4F|1|A1, 4V4F|1|A2, 4V4F|1|A4, 4V4F|1|A7, 4V4F|1|A8, 4V4F|1|A9, 4V4F|1|AZ, 4V4F|1|B1, 4V4F|1|B4, 4V4F|1|B5, 4V4F|1|B7, 4V4F|1|B8, 4V4F|1|B9, 4V4F|1|A6, 4V4F|1|B2, 4V4F|1|B3
21NR_3.0_31819.2
Exact match
Escherichia coli
1QRS|1|B (1QRS)
  • TRNAGLN2
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å74(20) 1QRS|1|B, 1O0C|1|B, 1QTQ|1|B, 1QRT|1|B, 1GTR|1|B, 1GTS|1|B, 1QRU|1|B, 1O0B|1|B, 1EUY|1|B, 4JXX|1|B, 1EXD|1|B, 2RE8|1|B, 5NWY|1|M, 2RD2|1|B, 1ZJW|1|B, 4V7L|1|AW, 4V7L|1|CW, 4V7L|1|CY, 4V7L|1|AY, 1GSG|1|T
22NR_3.0_51111.1
Exact match
Tobacco virtovirus 1
4OQ9|1|s (4OQ9)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): s; model(s): 1
1.5 Å10(18) 4OQ9|1|s, 4OQ9|1|f, 4NIA|1|f, 4OQ9|1|j, 4NIA|1|j, 4OQ9|1|k, 4NIA|1|k, 4OQ9|1|l, 4NIA|1|l, 4OQ9|1|o, 4NIA|1|o, 4NIA|1|p, 4OQ9|1|p, 4OQ9|1|q, 4NIA|1|q, 4OQ9|1|r, 4NIA|1|r, 4NIA|1|s
23NR_3.0_66108.1
Exact match
2DR8|1|B (2DR8)
  • tRNA (33-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å33(17) 2DR8|1|B, 2ZHA|1|B, 2DR7|1|B, 2ZH1|1|B, 2ZH9|1|B, 2ZH7|1|B, 2ZH5|1|B, 2ZH8|1|B, 2ZH4|1|B, 2DR9|1|B, 2ZH6|1|B, 2DVI|1|B, 2ZH3|1|B, 2ZH2|1|B, 2DRA|1|B, 2DRB|1|B, 2DR5|1|B
24NR_3.0_74924.4
Exact match
3PEY|1|B (3PEY)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.4 Å6(17) 3PEY|1|B, 3PF5|1|R, 5ELX|1|B, 3PEW|1|B, 4ALP|1|E, 2HYI|1|F, 3EX7|1|F, 3EX7|1|J, 2HYI|1|L, 4Y91|1|N, 4Y91|1|O, 3O8R|1|C, 3O8C|1|C, 5BTE|1|C, 5BTE|1|D, 5SZE|1|C, 3PF5|1|S
25NR_3.0_09880.4
Exact match
3ULD|1|B (3ULD)
  • RNA (5'-R(*UP*CP*GP*AP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.6 Å6(17) 3ULD|1|B, 2G8K|1|B, 2R7Y|1|B, 5USE|1|B, 2G8F|1|B, 5USA|1|B, 2G8U|1|B, 5W7N|1|B, 5W7O|1|B, 2G8I|1|B, 5USG|1|B, 5US2|1|B, 5WJR|1|B, 2G8H|1|B, 3TWH|1|B, 2G8V|1|B, 2G8W|1|B
26NR_3.0_08692.1
Exact match
2NZ4|1|Q (2NZ4)
  • GlmS ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
2.5 Å140(16) 2NZ4|1|Q, 3G9C|1|S, 2NZ4|1|R, 3L3C|1|R, 3L3C|1|Q, 3G8T|1|P, 2NZ4|1|P, 3G8T|1|R, 3G9C|1|Q, 3G8T|1|Q, 3L3C|1|P, 2NZ4|1|S, 3G9C|1|P, 3G8T|1|S, 3L3C|1|S, 3G9C|1|R
27NR_3.0_60167.3
Exact match
2OIY|1|A+2OIY|1|B (2OIY)
  • 5'-R(*CP*UP*UP*GP*CP*UP*GP*AP*AP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, P; model(s): 1
1.6 Å23(16) 2OIY|1|A+2OIY|1|B, 1Y99|1|A+1Y99|1|B, 1O3Z|1|B+1O3Z|1|A, 1Y73|1|B+1Y73|1|A, 1Y95|1|B+1Y95|1|A, 462D|1|B+462D|1|A, 1NLC|1|B+1NLC|1|A, 1WVD|1|B+1WVD|1|A, 1Y6S|1|B+1Y6S|1|A, 1Y6T|1|B+1Y6T|1|A, 2OIJ|1|A+2OIJ|1|B, 2QEK|1|A+2QEK|1|B, 3FAR|1|A+3FAR|1|B, 2OJ0|1|A+2OJ0|1|B, 3C44|1|A+3C44|1|B, 3DVV|1|A+3DVV|1|B
28NR_3.0_18586.17
Exact match
Saccharomyces cerevisiae
4U4U|1|7 (4U4U)
  • 5S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): 7; model(s): 1
3.0 Å121(16) 4U4U|1|7, 4U4R|1|7, 4U4Q|1|7, 4U3M|1|7, 5TBW|1|AS, 4U3U|1|3, 4U4R|1|3, 4U52|1|3, 4U3U|1|7, 4U52|1|7, 4V88|1|A3, 4V88|1|A7, 5TBW|1|3, 4U4Q|1|3, 4U3M|1|3, 4U4U|1|3
29NR_3.0_90506.17
Exact match
Saccharomyces cerevisiae
4V88|1|A5+4V88|1|A8 (4V88)
  • 25S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): A5, A8, P; model(s): 1
3.0 Å3150(16) 4V88|1|A5+4V88|1|A8, 4V88|1|A1+4V88|1|A4, 5TBW|1|AR+5TBW|1|AT, 4U4Q|1|5+4U4Q|1|8, 4U3U|1|1+4U3U|1|4, 4U4R|1|1+4U4R|1|4, 4U4R|1|5+4U4R|1|8, 4U52|1|5+4U52|1|8, 4U4U|1|1+4U4U|1|4, 5TBW|1|1+5TBW|1|4, 4U4Q|1|1+4U4Q|1|4, 4U3U|1|5+4U3U|1|8, 4U3M|1|1+4U3M|1|4, 4U4U|1|5+4U4U|1|8, 4U52|1|1+4U52|1|4, 4U3M|1|5+4U3M|1|8
30NR_3.0_03510.15
Exact match
Saccharomyces cerevisiae
4V88|1|A6 (4V88)
  • 18S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): A6; model(s): 1
3.0 Å1770(16) 4V88|1|A6, 4U4R|1|6, 4U4Q|1|6, 5TBW|1|sR, 4U3U|1|6, 4U52|1|6, 4U4U|1|6, 4V88|1|A2, 4U4R|1|2, 4U3U|1|2, 4U4Q|1|2, 4U4U|1|2, 4U52|1|2, 5TBW|1|A, 4U3M|1|6, 4U3M|1|2
31NR_3.0_78706.1
Exact match
1XPE|1|A+1XPE|1|B (1XPE)
  • 5'-R(*CP*UP*UP*GP*CP*UP*GP*AP*AP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, P; model(s): 1
1.9 Å23(15) 1XPE|1|A+1XPE|1|B, 2B8S|1|A+2B8S|1|B, 1XP7|1|A+1XP7|1|B, 2B8R|1|A+2B8R|1|B, 1XPF|1|A+1XPF|1|B, 2FCY|1|A+2FCY|1|B, 2FCX|1|A+2FCX|1|B, 1ZCI|1|A+1ZCI|1|B, 2FD0|1|A+2FD0|1|B, 1Y3S|1|A+1Y3S|1|B, 1Y3O|1|A+1Y3O|1|B, 2FCZ|1|A+2FCZ|1|B, 1YXP|1|A+1YXP|1|B, 1ZCI|1|C+1ZCI|1|D, 2FCZ|1|C+2FCZ|1|D
32NR_3.0_31074.1
Exact match
1J8G|1|D (1J8G)
  • 5'-R(*UP*GP*GP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
0.6 Å6(14) 1J8G|1|D, 4RKV|1|A, 4RNE|1|A, 4RNE|1|F, 1J8G|1|A, 4RJ1|1|A, 4RNE|1|B, 1J8G|1|C, 4XK0|1|C, 4RNE|1|C, 4RNE|1|D, 4RNE|1|E, 4RNE|1|G, 4RNE|1|H
33NR_3.0_29085.1
Exact match
2CV1|1|D (2CV1)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å75(14) 2CV1|1|D, 2CV2|1|C, 1N77|1|C, 2CV1|1|C, 2CV0|1|C, 2DXI|1|C, 1N78|1|C, 1G59|1|D, 2DXI|1|D, 1G59|1|B, 1N77|1|D, 1N78|1|D, 2CV2|1|D, 2CV0|1|D
34NR_3.0_27023.1
Exact match
Escherichia coli
2PXV|1|B (2PXV)
  • 4.5 S RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å49(14) 2PXV|1|B, 2PXT|1|B, 2PXQ|1|B, 2PXP|1|B, 2PXB|1|B, 2PXE|1|B, 2PXD|1|B, 2PXK|1|B, 1HQ1|1|B, 3LQX|1|B, 1DUL|1|B, 2PXU|1|B, 2PXF|1|B, 2PXL|1|B
35NR_3.0_32185.1
Exact match
3OWZ|1|B (3OWZ)
  • Domain II of glycine riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å82(14) 3OWZ|1|B, 3OXE|1|A, 3OWZ|1|A, 3OWW|1|A, 3OXM|1|A, 3OWW|1|B, 3OWI|1|B, 3OXE|1|B, 3OXM|1|B, 3OWI|1|A, 3OXB|1|A, 3OXD|1|A, 3OXD|1|B, 3OXB|1|B
36NR_3.0_35133.1
Exact match
2GCS|1|B (2GCS)
  • glmS ribozyme RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.1 Å122(13) 2GCS|1|B, 2HO7|1|B, 2H0X|1|B, 2Z75|1|B, 2HO6|1|B, 3B4B|1|B, 2GCV|1|B, 2H0W|1|B, 2H0S|1|B, 2Z74|1|B, 3B4A|1|B, 2H0Z|1|B, 3B4C|1|B
37NR_3.0_52453.1
Exact match
3OL9|1|J+3OL9|1|N+3OL9|1|K+3OL9|1|O+3OL9|1|L+3OL9|1|P (3OL9)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): J, K, L, N, O, P; model(s): 1
2.3 Å19(13) 3OL9|1|J+3OL9|1|N+3OL9|1|K+3OL9|1|O+3OL9|1|L+3OL9|1|P, 3OL6|1|J+3OL6|1|N+3OL6|1|K+3OL6|1|O+3OL6|1|L+3OL6|1|P, 3OLB|1|J+3OLB|1|N+3OLB|1|K+3OLB|1|O+3OLB|1|L+3OLB|1|P, 3OLB|1|B+3OLB|1|F+3OLB|1|C+3OLB|1|G+3OLB|1|D+3OLB|1|H, 3OL7|1|B+3OL7|1|F+3OL7|1|C+3OL7|1|G+3OL7|1|D+3OL7|1|H, 3OL9|1|B+3OL9|1|F+3OL9|1|C+3OL9|1|G+3OL9|1|D+3OL9|1|H, 3OL6|1|B+3OL6|1|F+3OL6|1|C+3OL6|1|G+3OL6|1|D+3OL6|1|H, 3OLA|1|J+3OLA|1|N+3OLA|1|K+3OLA|1|O+3OLA|1|L+3OLA|1|P, 3OL8|1|B+3OL8|1|F+3OL8|1|C+3OL8|1|G+3OL8|1|D+3OL8|1|H, 3OLA|1|B+3OLA|1|D, 3OLA|1|F+3OLA|1|H, 3OL8|1|J+3OL8|1|N+3OL8|1|K+3OL8|1|O+3OL8|1|L+3OL8|1|P, 3OL7|1|J+3OL7|1|N+3OL7|1|K+3OL7|1|O+3OL7|1|L+3OL7|1|P
38NR_3.0_19539.1
Exact match
synthetic construct
5HNJ|1|E+5HNJ|1|F (5HNJ)
  • RNA (5'-R(*GP*UP*AP*(OFC)P*GP*UP*AP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): E, F, K, L, O, P; model(s): 1
1.2 Å7(13) 5HNJ|1|E+5HNJ|1|F, 5HN2|1|B+5HN2|1|A, 5HNJ|1|A+5HNJ|1|B, 5HNQ|1|A+5HNQ|1|B, 5HNQ|1|C+5HNQ|1|D, 5HNJ|1|C+5HNJ|1|D, 5HN2|1|C+5HN2|1|D, 5HNQ|1|E+5HNQ|1|F, 5HN2|1|E+5HN2|1|F, 5HNQ|1|G+5HNQ|1|H, 5HNQ|1|I+5HNQ|1|J, 5HNQ|1|K+5HNQ|1|L, 5HNQ|1|M
39NR_3.0_73165.1
Exact match
1VBY|1|B (1VBY)
  • Hepatitis Delta virus ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å73(12) 1VBY|1|B, 4PRF|1|B, 2OIH|1|B, 1VC0|1|B, 1VBZ|1|B, 1VBX|1|B, 1SJ4|1|R, 1SJ3|1|R, 1SJF|1|B, 1DRZ|1|B, 1VC6|1|B, 2OJ3|1|B
40NR_3.0_02615.1
Exact match
Escherichia coli
4AQ7|1|B (4AQ7)
  • E. COLI TRNALEU UAA ISOACCEPTOR
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å79(12) 4AQ7|1|B, 3ZGZ|1|E, 4AQ7|1|E, 4ARI|1|B, 4CQN|1|B, 3ZGZ|1|B, 3ZJV|1|B, 3ZJU|1|B, 4AS1|1|B, 4ARC|1|B, 4CQN|1|E, 3ZJT|1|B
41NR_3.0_36481.1
Exact match
synthetic construct
4CSF|1|w (4CSF)
  • RNA (5'-R(*UP*GP*UP*GP*UP*UP*UP*CP*UP)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): w; model(s): 1
2.6 Å9(12) 4CSF|1|w, 4CSF|1|a, 4CSF|1|c, 4CSF|1|g, 4CSF|1|i, 4CSF|1|k, 4CSF|1|m, 4CSF|1|q, 4CSF|1|s, 4CSF|1|u, 4CSF|1|e, 4CSF|1|o
42NR_3.0_31222.1
Exact match
Caldanaerobacter subterraneus
5FJC|1|A (5FJC)
  • SAM-I RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.7 Å96(12) 5FJC|1|A, 5FK4|1|A, 5FKE|1|A, 4B5R|1|A, 5FK2|1|A, 5FK3|1|A, 5FK1|1|A, 5FKF|1|A, 5FKD|1|A, 5FKG|1|A, 5FKH|1|A, 5FK6|1|A
43NR_3.0_96683.1
Exact match
Homo sapiens
5GMF|1|H (5GMF)
  • RNA (5'-R(P*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.5 Å4(12) 5GMF|1|H, 5GMG|1|C, 5GMG|1|D, 3IE1|1|E, 1NB7|1|E, 5GMF|1|E, 3IE1|1|F, 1NB7|1|F, 5GMF|1|F, 5GMF|1|G, 3IE1|1|H, 3IE1|1|G
44NR_3.0_62528.1
Exact match
1GTF|1|W (1GTF)
  • (GAGUU)10GAG 53-NUCLEOTIDE RNA
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
1.8 Å44(11) 1GTF|1|W, 5EEY|1|W, 5EF2|1|W, 5EF3|1|W, 5EEZ|1|W, 5EEW|1|W, 5EEV|1|W, 5EF1|1|W, 5EEU|1|W, 5EF0|1|W, 5EEX|1|W
45NR_3.0_29848.1
Exact match
3DIR|1|A (3DIR)
  • RNA (174-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å172(11) 3DIR|1|A, 3DJ0|1|A, 3DIL|1|A, 3DIQ|1|A, 3DJ2|1|A, 3DIX|1|A, 3DIM|1|A, 3DIG|1|X, 3DIY|1|A, 3DIZ|1|A, 3DIO|1|X
46NR_3.0_82809.4
Exact match
3GX5|1|A (3GX5)
  • RNA (94-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.4 Å94(11) 3GX5|1|A, 2GIS|1|A, 2YGH|1|A, 3GX6|1|A, 3IQR|1|A, 3IQP|1|A, 3GX2|1|A, 3IQN|1|A, 2YDH|1|A, 3GX7|1|A, 3GX3|1|A
47NR_3.0_54592.1
Exact match
466D|1|C+466D|1|D (466D)
  • RNA (5'-R(*UP*AP*GP*CP*UP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C, D, K, L, O, P; model(s): 1
1.2 Å7(11) 466D|1|C+466D|1|D, 4U38|1|A+4U38|1|B, 466D|1|A+466D|1|B, 4U37|1|A+4U37|1|B, 464D|1|A+464D|1|B, 434D|1|A+434D|1|B, 4U38|1|C+4U38|1|D, 434D|1|C+434D|1|D, 464D|1|C+464D|1|D, 4U38|1|E+4U38|1|F, 4U38|1|G+4U38|1|H
48NR_3.0_16130.1
Exact match
1UTD|1|Z (1UTD)
  • 5'-R(*GP*UP*UP*UP*GP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
2.1 Å4(10) 1UTD|1|Z, 1UTD|1|0, 1UTD|1|2, 1UTD|1|3, 1UTD|1|4, 1UTD|1|5, 1UTD|1|6, 1UTD|1|7, 1UTD|1|8, 1UTD|1|9
49NR_3.0_09332.1
Exact match
2JLV|1|D (2JLV)
  • 5'-R(*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.9 Å7(10) 2JLV|1|D, 2JLX|1|C, 2JLX|1|D, 2JLU|1|C, 2JLV|1|C, 2JLZ|1|C, 2JLY|1|C, 2JLU|1|D, 2JLY|1|D, 2JLZ|1|D
50NR_3.0_02086.1
Exact match
3B5S|1|B+3B5S|1|C+3B5S|1|A (3B5S)
  • 29-mer Loop A and Loop B Ribozyme strand
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, L, O, P; model(s): 1
2.3 Å29(10) 3B5S|1|B+3B5S|1|C+3B5S|1|A, 3B5F|1|B+3B5F|1|C+3B5F|1|A, 3BBM|1|B+3BBM|1|C+3BBM|1|A, 3B91|1|B+3B91|1|C+3B91|1|A, 4G6S|1|B+4G6S|1|C+4G6S|1|A, 3BBI|1|B+3BBI|1|C+3BBI|1|A, 3B58|1|B+3B58|1|C+3B58|1|A, 3B5A|1|B+3B5A|1|C+3B5A|1|A, 3BBK|1|B+3BBK|1|C+3BBK|1|A, 4G6P|1|B+4G6P|1|C+4G6P|1|A
51NR_3.0_35054.3
Exact match
Oceanobacillus iheyensis
4FAU|1|A (4FAU)
  • Group IIC intron
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å395(10) 4FAU|1|A, 4FAW|1|A, 4Y1O|1|A, 4Y1N|1|A, 3G78|1|A, 4Y1N|1|B, 4E8Q|1|A, 4E8N|1|A, 4FAR|1|A, 4Y1O|1|B
52NR_3.0_25521.1
Exact match
synthetic construct
4PEI|1|Z (4PEI)
  • RNA (5'-R(*UP*AP*AP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
2.0 Å3(10) 4PEI|1|Z, 5K77|1|V, 5K77|1|W, 5K77|1|X, 5K77|1|Y, 5K77|1|Z, 4PEI|1|V, 4PEI|1|W, 4PEI|1|X, 4PEI|1|Y
53NR_3.0_51503.1
Exact match
Homo sapiens
4X4T|1|D (4X4T)
  • G70A tRNA minihelix ending in CCACCA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.5 Å28(10) 4X4T|1|D, 4X4T|1|B, 4X4N|1|D, 4X4N|1|B, 4X4P|1|D, 4X4P|1|H, 4X4P|1|B, 4X4P|1|F, 4X4T|1|G, 4X4N|1|G
54NR_3.0_25585.2
Exact match
synthetic construct
4Z4D|1|B+4Z4D|1|D (4Z4D)
  • RNA (5'-R(P*UP*UP*CP*AP*CP*AP*UP*UP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, L, O, P; model(s): 1
1.6 Å20(10) 4Z4D|1|B+4Z4D|1|D, 4W5O|1|B+4W5O|1|D, 4Z4H|1|B+4Z4H|1|D, 4Z4G|1|B+4Z4G|1|D, 4Z4I|1|B+4Z4I|1|D, 4Z4C|1|B+4Z4C|1|D, 4Z4E|1|B+4Z4E|1|D, 4Z4F|1|B+4Z4F|1|D, 4W5T|1|B+4W5T|1|D, 4W5R|1|B+4W5R|1|D
55NR_3.0_30153.3
Exact match
Saccharomyces cerevisiae
5AXM|1|P (5AXM)
  • RNA (75-MER)
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.2 Å72(10) 5AXM|1|P, 1I9V|1|A, 1EHZ|1|A, 4TRA|1|A, 1TRA|1|A, 6TNA|1|A, 5AXN|1|P, 1TN1|1|A, 4TNA|1|A, 1TN2|1|A
56NR_3.0_78372.2
Exact match
1B2M|1|E (1B2M)
  • 5'-R(*GP*(U34))-3'
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.0 Å1(9) 1B2M|1|E, 5F6C|1|C, 5K77|1|v, 5K77|1|w, 5K77|1|x, 5K77|1|y, 5K77|1|z, 1B2M|1|C, 1B2M|1|D
57NR_3.0_88496.1
Exact match
1ET4|1|E (1ET4)
  • RNA APTAMER, 35-MER
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.3 Å35(9) 1ET4|1|E, 1ET4|1|A, 1ET4|1|B, 1ET4|1|D, 1DDY|1|E, 1DDY|1|G, 1DDY|1|A, 1ET4|1|C, 1DDY|1|C
58NR_3.0_24819.1
Exact match
Saccharomyces cerevisiae
1IL2|1|C (1IL2)
  • ASPARTYL TRANSFER RNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.6 Å67(9) 1IL2|1|C, 1IL2|1|D, 3TRA|1|A, 1VTQ|1|A, 1ASZ|1|R, 1ASY|1|R, 1ASZ|1|S, 1ASY|1|S, 2TRA|1|A
59NR_3.0_42241.1
Exact match
2GDI|1|Y (2GDI)
  • TPP riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.1 Å78(9) 2GDI|1|Y, 4NYA|1|A, 2GDI|1|X, 2HOJ|1|A, 4NYD|1|A, 2HOL|1|A, 2HOM|1|A, 2HOO|1|A, 4NYA|1|B
60NR_3.0_65533.1
Exact match
3OVA|1|C (3OVA)
  • RNA (34-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.0 Å34(9) 3OVA|1|C, 3OV7|1|C, 3OVS|1|C, 3OVB|1|C, 3OVS|1|D, 3OUY|1|C, 3OVB|1|D, 3OV7|1|D, 3OUY|1|D
61NR_3.0_17782.1
Exact match
3R1C|1|a+3R1C|1|b (3R1C)
  • RNA (5'-R(*GP*CP*GP*GP*CP*GP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, L, O, P, a, b; model(s): 1
2.1 Å8(9) 3R1C|1|a+3R1C|1|b, 3R1C|1|G+3R1C|1|H, 3R1C|1|A+3R1C|1|B, 3R1C|1|M+3R1C|1|N, 3R1C|1|O+3R1C|1|P, 3R1C|1|Q+3R1C|1|R, 3R1C|1|S+3R1C|1|Y, 3R1C|1|T+3R1C|1|U, 3R1C|1|V+3R1C|1|Z
62NR_3.0_12260.3
Exact match
3UCZ|1|R (3UCZ)
  • RNA (92-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.8 Å91(9) 3UCZ|1|R, 3UCU|1|R, 3MXH|1|R, 3MUR|1|R, 4YB1|1|R, 3UD4|1|R, 3MUM|1|R, 3IRW|1|R, 3MUT|1|R
63NR_3.0_26836.2
Exact match
Haloarcula marismortui
4BW0|1|A (4BW0)
  • HMKT-7
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å26(9) 4BW0|1|A, 5FJ1|1|A, 5FJ1|1|B, 5FJ1|1|C, 5FJ1|1|D, 5FJ1|1|E, 5FJ1|1|F, 5FJ1|1|G, 5FJ1|1|H
64NR_3.0_75326.1
Exact match
1M5K|1|E (1M5K)
  • RNA HAIRPIN RIBOZYME
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.4 Å91(8) 1M5K|1|E, 1M5K|1|B, 1M5P|1|B, 1M5O|1|B, 1M5V|1|E, 1M5O|1|E, 1M5V|1|B, 1M5P|1|E
65NR_3.0_84537.1
Exact match
2AWE|1|H (2AWE)
  • 5'-R(*UP*(BGM)P*GP*UP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.1 Å5(8) 2AWE|1|H, 2AWE|1|A, 2AWE|1|B, 2AWE|1|C, 2AWE|1|D, 2AWE|1|E, 2AWE|1|F, 2AWE|1|G
66NR_3.0_52425.1
Exact match
2EZ6|1|D (2EZ6)
  • 28-MER
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.1 Å28(8) 2EZ6|1|D, 2NUF|1|C, 2EZ6|1|C, 2NUF|1|D, 4M30|1|C, 4M2Z|1|C, 4M30|1|D, 4M2Z|1|D
67NR_3.0_58299.1
Exact match
2GRB|1|H (2GRB)
  • 5'-R(*(U33)P*GP*IP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
1.4 Å4(8) 2GRB|1|H, 2GRB|1|A, 2GRB|1|B, 2GRB|1|C, 2GRB|1|D, 2GRB|1|E, 2GRB|1|F, 2GRB|1|G
68NR_3.0_27756.1
Exact match
Arabidopsis thaliana
3D2V|1|A (3D2V)
  • TPP-specific riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å77(8) 3D2V|1|A, 3D2G|1|A, 3D2X|1|A, 3D2V|1|B, 3D2G|1|B, 3D2X|1|B, 2CKY|1|A, 2CKY|1|B
69NR_3.0_21705.1
Exact match
3SKI|1|A (3SKI)
  • RNA (68-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å66(8) 3SKI|1|A, 3SKZ|1|A, 3SLQ|1|A, 3SLM|1|A, 3SKZ|1|B, 3SLQ|1|B, 3SLM|1|B, 3SKI|1|B
70NR_3.0_91231.1
Exact match
3VYX|1|B+3VYX|1|C (3VYX)
  • RNA (5'-R(P*GP*CP*GP*CP*GP*CP*GP*CP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, L, O, P; model(s): 1
2.3 Å10(8) 3VYX|1|B+3VYX|1|C, 3ZD7|1|C+3ZD7|1|D, 4BPB|1|C+4BPB|1|D, 3ZD6|1|C+3ZD6|1|D, 2YKG|1|C+2YKG|1|D, 3VYY|1|C+3VYY|1|D, 3VYY|1|E+3VYY|1|F, 3VYY|1|G
71NR_3.0_89612.3
Exact match
synthetic construct
4AFY|1|D (4AFY)
  • 5'-R(*GP*GP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.0 Å2(8) 4AFY|1|D, 4AFY|1|C, 3U2E|1|C, 5UEF|1|C, 3U2E|1|D, 5UEF|1|D, 4X4U|1|H, 4LQ3|1|R
72NR_3.0_81203.2
Exact match
4K4Z|1|N+4K4Z|1|O+4K4Z|1|P (4K4Z)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): L, N, O, P; model(s): 1
2.2 Å17(8) 4K4Z|1|N+4K4Z|1|O+4K4Z|1|P, 4K4Z|1|F+4K4Z|1|G+4K4Z|1|H, 4K4Z|1|J+4K4Z|1|K+4K4Z|1|L, 4K4Z|1|B+4K4Z|1|C+4K4Z|1|D, 4K4X|1|B+4K4X|1|C+4K4X|1|D, 4K4X|1|F+4K4X|1|G+4K4X|1|H, 4K4X|1|J+4K4X|1|K+4K4X|1|L, 4K4X|1|N+4K4X|1|O+4K4X|1|P
73NR_3.0_51487.1
Exact match
4L8H|1|R (4L8H)
  • RNA operator hairpin
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.4 Å20(8) 4L8H|1|R, 2BS1|1|S, 1ZSE|1|R, 2B2D|1|R, 2BS0|1|S, 2BS0|1|R, 2BS1|1|R, 2B2D|1|S
74NR_3.0_87052.1
Exact match
4MSR|1|A+4MSR|1|B (4MSR)
  • RNA 10mer duplex with six 2'-5'-linkages
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
1.2 Å12(8) 4MSR|1|A+4MSR|1|B, 5TDJ|1|A, 4MS9|1|A, 4MSB|1|A+4MSB|1|B, 5TDK|1|A+5TDK|1|B, 5TDJ|1|B, 4MSB|1|C+4MSB|1|D, 4MSB|1|E+4MSB|1|F
75NR_3.0_48149.1
Exact match
synthetic construct
4RMO|1|P (4RMO)
  • RNA (45-MER)
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.2 Å44(8) 4RMO|1|P, 4RMO|1|B, 4RMO|1|D, 4RMO|1|F, 4RMO|1|H, 4RMO|1|J, 4RMO|1|L, 4RMO|1|N
76NR_3.0_68446.1
Exact match
synthetic construct
4U6K|1|C (4U6K)
  • RNA (5'-R(*GP*AP*AP*GP*AP*AP*GP*AP*G)-3'[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.5 Å9(8) 4U6K|1|C, 4U6M|1|A, 4U6L|1|A, 4U6K|1|A, 2DQP|1|B, 479D|1|B, 2DQO|1|B, 2DQQ|1|B
77NR_3.0_92081.5
Exact match
synthetic construct
5FW3|1|A (5FW3)
  • SGRNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å81(8) 5FW3|1|A, 5VW1|1|C, 4UN5|1|A, 5FQ5|1|A, 5FW1|1|A, 4UN3|1|A, 5FW2|1|A, 4UN4|1|A
78NR_3.0_88047.3
Exact match
unidentified
5UDI|1|B (5UDI)
  • RNA (5'-D(*(GTA))-R(P*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.6 Å3(8) 5UDI|1|B, 5W5H|1|B, 5W5I|1|B, 5UDK|1|B, 5UDL|1|B, 5UDJ|1|B, 5W5H|1|D, 5W5I|1|D
79NR_3.0_27657.1
Exact match
Pseudomonas aeruginosa
5VJ9|1|D (5VJ9)
  • RNA (5'-R(*GP*CP*GP*GP*GP*GP*AP*CP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.6 Å16(8) 5VJ9|1|D, 5VJ9|1|A, 5VJ9|1|B, 5VJ9|1|C, 5VJB|1|A, 5VJB|1|B, 5VJB|1|C, 5VJB|1|D
80NR_3.0_39627.1
Exact match
synthetic construct
1GID|1|B (1GID)
  • P4-P6 RNA RIBOZYME DOMAIN
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å158(7) 1GID|1|B, 1HR2|1|B, 1GID|1|A, 2R8S|1|R, 1HR2|1|A, 1L8V|1|A, 1L8V|1|B
81NR_3.0_25852.1
Exact match
1M8V|1|U (1M8V)
  • 5'-R(P*UP*UP*UP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): U; model(s): 1
2.6 Å6(7) 1M8V|1|U, 1M8V|1|O, 1M8V|1|P, 1M8V|1|Q, 1M8V|1|R, 1M8V|1|S, 1M8V|1|T
82NR_3.0_57955.2
Exact match
1Q93|1|B (1Q93)
  • Sarcin/Ricin 28S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å27(7) 1Q93|1|B, 1Q93|1|A, 1Q96|1|A, 1Q96|1|B, 1Q93|1|C, 1Q96|1|C, 430D|1|A
83NR_3.0_04852.2
Exact match
Moorella thermoacetica
2UWM|1|D (2UWM)
  • 5'-R(*GP*GP*CP*GP*UP*UP*GP*CP*CP*GP *GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.3 Å23(7) 2UWM|1|D, 2PLY|1|C, 2PLY|1|E, 1WSU|1|E, 1WSU|1|F, 2UWM|1|C, 1WSU|1|G
84NR_3.0_08831.2
Exact match
Methanocaldococcus jannaschii
3NDB|1|M (3NDB)
  • SRP RNA
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
3.0 Å136(7) 3NDB|1|M, 4XCO|1|E, 4XCO|1|M, 2V3C|1|N, 1LNG|1|B, 2V3C|1|M, 1Z43|1|A
85NR_3.0_28980.1
Exact match
3P4C|1|B (3P4C)
  • 5'-R(*(CFZ)P*GP*(AF2)P*AP*(UFT)P*UP*(CFZ[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.2 Å4(7) 3P4C|1|B, 3P4B|1|A, 3P4B|1|B, 3P4B|1|C, 3P4B|1|D, 3P4B|1|E, 3P4B|1|F
86NR_3.0_35293.2
Exact match
3P6Y|1|W (3P6Y)
  • 5'-R(*UP*GP*UP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
2.9 Å1(7) 3P6Y|1|W, 3P6Y|1|R, 3P6Y|1|S, 3P6Y|1|T, 3P6Y|1|U, 3P6Y|1|V, 3P6Y|1|Q
87NR_3.0_78797.1
Exact match
4LVZ|1|A (4LVZ)
  • THF riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.8 Å89(7) 4LVZ|1|A, 3SD3|1|A, 4LVX|1|A, 4LVW|1|A, 4LVY|1|A, 4LVV|1|A, 4LW0|1|A
88NR_3.0_10487.1
Exact match
4NFQ|1|B+4NFQ|1|C (4NFQ)
  • GCAG(7AT)CUUAAGUCUGC
  • X-RAY DIFFRACTION
  • Chain(s): B, C, L, O, P; model(s): 1
1.7 Å15(7) 4NFQ|1|B+4NFQ|1|C, 4NFO|1|A, 4NFO|1|B+4NFO|1|C, 4NFQ|1|A, 4NFP|1|A, 4NFP|1|B+4NFP|1|C, 1YZD|1|C
89NR_3.0_78670.1
Exact match
1CVJ|1|T (1CVJ)
  • 5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.6 Å7(6) 1CVJ|1|T, 1CVJ|1|N, 1CVJ|1|O, 1CVJ|1|S, 1CVJ|1|P, 1CVJ|1|R
90NR_3.0_65028.2
Exact match
1NYI|1|B+1NYI|1|A (1NYI)
  • 5'-R(*GP*CP*CP*GP*AP*AP*AP*CP*UP*CP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
2.9 Å24(6) 1NYI|1|B+1NYI|1|A, 1Q29|1|B+1Q29|1|A, 299D|1|B+299D|1|A, 301D|1|B+301D|1|A, 359D|1|B+359D|1|A, 300D|1|B+300D|1|A
91NR_3.0_95614.1
Exact match
1QA6|1|D (1QA6)
  • 58 NUCLEOTIDE RIBOSOMAL RNA DOMAIN
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.8 Å58(6) 1QA6|1|D, 1QA6|1|C, 1HC8|1|C, 1Y39|1|C, 1HC8|1|D, 1Y39|1|D
92NR_3.0_35629.1
Exact match
2O5I|1|Y (2O5I)
  • 5'-R(P*GP*AP*GP*UP*CP*UP*GP*CP*GP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.5 Å16(6) 2O5I|1|Y, 2O5J|1|H, 2O5I|1|H, 2PPB|1|H, 2PPB|1|Y, 2O5J|1|Y
93NR_3.0_02858.1
Exact match
2QUX|1|R (2QUX)
  • RNA (25-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.4 Å25(6) 2QUX|1|R, 2QUX|1|C, 2QUX|1|F, 2QUX|1|I, 2QUX|1|L, 2QUX|1|O
94NR_3.0_38950.2
Exact match
2XD0|1|V (2XD0)
  • TOXI
  • X-RAY DIFFRACTION
  • Chain(s): V; model(s): 1
3.0 Å35(6) 2XD0|1|V, 2XDB|1|G, 2XD0|1|H, 2XD0|1|G, 2XD0|1|I, 2XD0|1|U
95NR_3.0_63789.1
Exact match
Methanopyrus kandleri
3ADD|1|C (3ADD)
  • selenocysteine tRNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.4 Å88(6) 3ADD|1|C, 3ADD|1|D, 3ADC|1|C, 3ADB|1|C, 3ADB|1|D, 3ADC|1|D
96NR_3.0_38099.1
Exact match
3BNS|1|C+3BNS|1|D (3BNS)
  • A site of human mitochondrial ribosome, [...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, L, O, P; model(s): 1
1.9 Å22(6) 3BNS|1|C+3BNS|1|D, 3BNS|1|A+3BNS|1|B, 3BNQ|1|A+3BNQ|1|B, 3BNR|1|A+3BNR|1|B, 3BNR|1|C+3BNR|1|D, 3BNQ|1|C+3BNQ|1|D
97NR_3.0_11791.1
Exact match
3BSU|1|I (3BSU)
  • RNA (5'-R(*GP*AP*CP*AP*CP*CP*UP*GP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
2.1 Å12(6) 3BSU|1|I, 4WKJ|1|A, 4WKJ|1|C, 4WKJ|1|D, 3BSU|1|D, 4WKJ|1|G
98NR_3.0_39651.1
Exact match
3LWR|1|D (3LWR)
  • H/ACA RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.2 Å58(6) 3LWR|1|D, 3LWV|1|D, 3LWP|1|D, 3HJW|1|D, 3LWO|1|D, 3LWQ|1|D
99NR_3.0_96295.1
Exact match
3M7N|1|Z (3M7N)
  • 5'-R(*C*UP*CP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
2.4 Å4(6) 3M7N|1|Z, 3M7N|1|X, 3M7N|1|Y, 3M85|1|X, 3M85|1|Y, 3M85|1|Z
100NR_3.0_22904.1
Exact match
3R1C|1|e+3R1C|1|f (3R1C)
  • RNA (5'-R(*GP*CP*GP*GP*CP*GP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): L, O, P, e, f; model(s): 1
2.1 Å8(6) 3R1C|1|e+3R1C|1|f, 3R1C|1|C+3R1C|1|D, 3R1C|1|I+3R1C|1|J, 3R1C|1|K+3R1C|1|L, 3R1C|1|W+3R1C|1|X, 3R1C|1|c+3R1C|1|d
101NR_3.0_15508.1
Exact match
3TRZ|1|Z (3TRZ)
  • RNA (5'-R(*GP*GP*GP*CP*AP*GP*GP*GP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
2.9 Å20(6) 3TRZ|1|Z, 3TRZ|1|U, 3TRZ|1|V, 3TRZ|1|W, 3TRZ|1|X, 3TRZ|1|Y
102NR_3.0_22632.1
Exact match
4M6D|1|H (4M6D)
  • aptamer
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.7 Å42(6) 4M6D|1|H, 4M6D|1|D, 4M6D|1|L, 4M6D|1|B, 4M6D|1|F, 4M6D|1|J
103NR_3.0_04974.3
Exact match
synthetic construct
4U3L|1|A+4U3L|1|B (4U3L)
  • RNA (5'-R(*UP*CP*GP*UP*AP*CP*GP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
1.5 Å8(6) 4U3L|1|A+4U3L|1|B, 4U78|1|A+4U78|1|B, 4U3P|1|A+4U3P|1|B, 4U3R|1|A+4U3R|1|B, 4U47|1|A+4U47|1|B, 4U3O|1|A+4U3O|1|B
104NR_3.0_15756.1
Exact match
Saccharomyces cerevisiae
4U8T|1|T (4U8T)
  • RNA (5'-R(*AP*GP*GP*(6MZ)P*CP*AP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.7 Å6(6) 4U8T|1|T, 4U8T|1|O, 4U8T|1|P, 4U8T|1|Q, 4U8T|1|R, 4U8T|1|S
105NR_3.0_04935.1
Exact match
Thermotoga maritima
4YVJ|1|C (4YVJ)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å71(6) 4YVJ|1|C, 4YVK|1|C, 3AKZ|1|G, 3AKZ|1|H, 3AKZ|1|F, 3AKZ|1|E
106NR_3.0_46720.1
Exact match
Synechococcus elongatus
5DDP|1|B (5DDP)
  • RNA (61-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å61(6) 5DDP|1|B, 5DDQ|1|B, 5DDQ|1|A, 5DDP|1|A, 5DDR|1|B, 5DDR|1|A
107NR_3.0_67726.2
Exact match
synthetic construct
5F9F|1|L (5F9F)
  • RNA (5'-R(*GP*AP*AP*UP*AP*UP*AP*AP*UP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
2.6 Å24(6) 5F9F|1|L, 5F9F|1|B, 5F9F|1|D, 5F9F|1|F, 5F9F|1|H, 5F9F|1|J
108NR_3.0_33278.1
Exact match
Homo sapiens
5LYV|1|B (5LYV)
  • RNA (57-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å56(6) 5LYV|1|B, 5LYS|1|B, 5LYU|1|B, 5LYU|1|A, 5LYV|1|A, 5LYS|1|A
109NR_3.0_91124.2
Exact match
Gloeobacter violaceus
5NEP|1|A (5NEP)
  • RNA (5'-R(*GP*GP*UP*GP*GP*GP*GP*AP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.6 Å17(6) 5NEP|1|A, 5NOM|1|A, 5NEX|1|A, 5NEF|1|A, 5NEQ|1|A, 5NEO|1|A
110NR_3.0_18996.1
Exact match
1DI2|1|G (1DI2)
  • RNA (5'-R(*GP*GP*CP*GP*CP*GP*CP*GP*CP*C)[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
1.9 Å10(5) 1DI2|1|G, 1RC7|1|B+1RC7|1|C, 1DI2|1|C+1DI2|1|D, 1RC7|1|D+1RC7|1|E, 1DI2|1|E
111NR_3.0_36712.2
Exact match
1K8W|1|B (1K8W)
  • 5'-R(*GP*GP*CP*AP*AP*CP*GP*GP*UP*(FHU)P*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å21(5) 1K8W|1|B, 1ZL3|1|B, 1ZE2|1|C, 1ZE2|1|D, 2AB4|1|B
112NR_3.0_49890.1
Exact match
1NUJ|1|E+1NUJ|1|F (1NUJ)
  • 5'-R(*CP*GP*GP*AP*CP*CP*GP*AP*GP*CP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): E, F, L, O, P; model(s): 1
1.8 Å13(5) 1NUJ|1|E+1NUJ|1|F, 429D|1|C+429D|1|D, 1NUV|1|C+1NUV|1|D, 1NUJ|1|C+1NUJ|1|D, 1NUV|1|E+1NUV|1|F
113NR_3.0_07779.1
Exact match
1NUJ|1|G+1NUJ|1|H (1NUJ)
  • 5'-R(*CP*GP*GP*AP*CP*CP*GP*AP*GP*CP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): G, H, L, O, P; model(s): 1
1.8 Å15(5) 1NUJ|1|G+1NUJ|1|H, 1NUV|1|A+1NUV|1|B, 1NUJ|1|A+1NUJ|1|B, 1NUV|1|G+1NUV|1|H, 429D|1|A+429D|1|B
114NR_3.0_64047.1
Exact match
1PVO|1|L (1PVO)
  • 5'-R(P*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
3.0 Å2(5) 1PVO|1|L, 1PVO|1|G, 1PVO|1|H, 1PVO|1|J, 1PVO|1|K
115NR_3.0_60049.1
Exact match
1VQO|1|4 (1VQO)
  • 5'-R(*CP*CP*(PPU))-3'
  • X-RAY DIFFRACTION
  • Chain(s): 4; model(s): 1
2.2 Å2(5) 1VQO|1|4, 1QVG|1|3, 3CMA|1|5, 3CD6|1|4, 3CME|1|5
116NR_3.0_40597.1
Exact match
1ZHO|1|H (1ZHO)
  • mRNA
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.6 Å38(5) 1ZHO|1|H, 1ZHO|1|D, 1ZHO|1|F, 2HW8|1|B, 1ZHO|1|B
117NR_3.0_92683.1
Exact match
2G3S|1|I+2G3S|1|J (2G3S)
  • 5'-R(*GP*GP*CP*GP*UP*GP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): I, J, L, O, P; model(s): 1
1.5 Å8(5) 2G3S|1|I+2G3S|1|J, 2G3S|1|A+2G3S|1|B, 2G3S|1|C+2G3S|1|D, 2G3S|1|E+2G3S|1|F, 2G3S|1|G+2G3S|1|H
118NR_3.0_86436.1
Exact match
2PN4|1|C+2PN4|1|D (2PN4)
  • 5'-R(*CP*GP*GP*AP*GP*GP*AP*AP*CP*UP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, L, O, P; model(s): 1
2.3 Å24(5) 2PN4|1|C+2PN4|1|D, 2NOK|1|A+2NOK|1|B, 2PN4|1|A+2PN4|1|B, 2PN3|1|A+2PN3|1|B, 2NOK|1|C+2NOK|1|D
119NR_3.0_46403.1
Exact match
3BNN|1|C+3BNN|1|D (3BNN)
  • A site of human ribosome
  • X-RAY DIFFRACTION
  • Chain(s): C, D, L, O, P; model(s): 1
2.0 Å21(5) 3BNN|1|C+3BNN|1|D, 3BNP|1|A+3BNP|1|B, 3BNN|1|A+3BNN|1|B, 3BNO|1|A+3BNO|1|B, 3BNO|1|C+3BNO|1|D
120NR_3.0_22826.1
Exact match
3GPQ|1|F (3GPQ)
  • RNA (5'-R(*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.0 Å2(5) 3GPQ|1|F, 4OAU|1|A, 2A1R|1|C, 2A1R|1|D, 3GPQ|1|E
121NR_3.0_65600.1
Exact match
Pseudomonas aeruginosa
4AL6|1|B (4AL6)
  • CRRNA, 5'-R(CP*UP*GP*CP*CP*GP*UP*AP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å16(5) 4AL6|1|B, 2XLI|1|B, 2XLJ|1|B, 2XLK|1|C, 2XLK|1|D
122NR_3.0_82984.1
Exact match
Thermotoga petrophila
4ENB|1|A (4ENB)
  • Fluoride riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å51(5) 4ENB|1|A, 4ENA|1|A, 3VRS|1|A, 4ENC|1|A, 4EN5|1|A
123NR_3.0_69766.1
Exact match
4MCF|1|H+4MCF|1|G (4MCF)
  • Gas5 GREM Rev
  • X-RAY DIFFRACTION
  • Chain(s): G, H, L, O, P; model(s): 1
1.9 Å10(5) 4MCF|1|H+4MCF|1|G, 4MCF|1|B+4MCF|1|D+4MCF|1|C+4MCF|1|A, 4MCE|1|D+4MCE|1|C, 4MCE|1|B+4MCE|1|A, 4MCF|1|F+4MCF|1|E
124NR_3.0_33394.2
Exact match
4OO8|1|E (4OO8)
  • RNA (97-MER)
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.5 Å97(5) 4OO8|1|E, 4OO8|1|B, 5B2S|1|A, 5B2R|1|A, 5B2T|1|A
125NR_3.0_73731.1
Exact match
Thermus thermophilus
4QVI|1|B (4QVI)
  • fragment of 23S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å80(5) 4QVI|1|B, 3UMY|1|B, 3U4M|1|B, 4QG3|1|B, 3U56|1|B
126NR_3.0_94396.3
Exact match
4WAN|1|H (4WAN)
  • RNA (5'-R(P*UP*AP*CP*UP*AP*AP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
1.8 Å9(5) 4WAN|1|H, 4WAN|1|D, 4WAN|1|F, 4WAN|1|B, 4WAL|1|B
127NR_3.0_10054.2
Exact match
synthetic construct
5DQK|1|A (5DQK)
  • RNA (48-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å48(5) 5DQK|1|A, 5EAO|1|A, 5DH6|1|A, 5DI2|1|A, 5DI4|1|A
128NR_3.0_67574.1
Exact match
synthetic construct
5F8N|1|B+5F8N|1|C (5F8N)
  • RNA (35-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B, C, L, O, P; model(s): 1
2.5 Å9(5) 5F8N|1|B+5F8N|1|C, 4K4W|1|B+4K4W|1|C, 4K4W|1|F+4K4W|1|G, 5F8L|1|B+5F8L|1|C, 5F8M|1|B+5F8M|1|C
129NR_3.0_64208.1
Exact match
Haloarcula marismortui
5G4U|1|I+5G4U|1|J (5G4U)
  • HMKT-7
  • X-RAY DIFFRACTION
  • Chain(s): I, J, L, O, P; model(s): 1
2.7 Å19(5) 5G4U|1|I+5G4U|1|J, 5G4U|1|A+5G4U|1|B, 5G4V|1|A+5G4V|1|B, 5G4V|1|E+5G4V|1|F, 5G4U|1|E+5G4U|1|F
130NR_3.0_89906.2
Exact match
Thermotoga maritima
5HC9|1|D (5HC9)
  • tRNAphe
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.9 Å76(5) 5HC9|1|D, 5HC9|1|C, 4WC2|1|B, 1VFG|1|C, 1VFG|1|D
131NR_3.0_87852.1
Exact match
unidentified
5JCF|1|C+5JCF|1|D (5JCF)
  • RNA (5'-R(P*GP*GP*UP*AP*CP*GP*UP*AP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, L, O, P; model(s): 1
2.6 Å10(5) 5JCF|1|C+5JCF|1|D, 5JC3|1|C+5JC3|1|D, 5JCH|1|U+5JCH|1|V, 5JCH|1|X+5JCH|1|Y, 5JC3|1|X+5JC3|1|Y
132NR_3.0_89026.2
Exact match
synthetic construct
5L00|1|C+5L00|1|D (5L00)
  • RNA (5'-R(*(LCC)P*(LCC)P*(LCC)P*(LCG)P*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, L, O, P; model(s): 1
1.3 Å13(5) 5L00|1|C+5L00|1|D, 5L00|1|A+5L00|1|B, 5V0H|1|A+5V0H|1|B, 5KRG|1|A+5KRG|1|B, 5KRG|1|C+5KRG|1|D
133NR_3.0_56892.1
Exact match
synthetic construct
5UED|1|A+5UED|1|B (5UED)
  • RNA (5'-R(*(LCC)P*(LCC)P*(LCC)P*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
1.5 Å11(5) 5UED|1|A+5UED|1|B, 5UEE|1|A+5UEE|1|B, 5UEF|1|A+5UEF|1|B, 5UEG|1|A+5UEG|1|B, 5UEG|1|C+5UEG|1|D
134NR_3.0_49339.2
Exact match
synthetic construct
5V0J|1|A+5V0J|1|B (5V0J)
  • RNA (5'-R(*(LCC)P*(LCC)P*(LCA)P*(LCG)P*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
1.5 Å10(5) 5V0J|1|A+5V0J|1|B, 5HBX|1|A+5HBX|1|B, 5DHC|1|A+5DHC|1|B, 5DHC|1|C+5DHC|1|D, 5HBX|1|C+5HBX|1|D
135NR_3.0_77140.1
Exact match
synthetic construct
5XUZ|1|F (5XUZ)
  • crRNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.4 Å40(5) 5XUZ|1|F, 5XUT|1|B, 5XUZ|1|B, 5XUU|1|B, 5XUS|1|B
136NR_3.0_24974.1
Exact match
1DUQ|1|H+1DUQ|1|G (1DUQ)
  • THE REV BINDING ELEMENT
  • X-RAY DIFFRACTION
  • Chain(s): G, H, L, O, P; model(s): 1
2.1 Å14(4) 1DUQ|1|H+1DUQ|1|G, 1DUQ|1|B+1DUQ|1|A, 1DUQ|1|D+1DUQ|1|C, 1DUQ|1|F+1DUQ|1|E
137NR_3.0_71520.1
Exact match
Escherichia virus T7
1H38|1|O (1H38)
  • 5'-R(*AP*AP*CP*UP*GP*CP*GP*GP*CP*GP *AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): O; model(s): 1
2.9 Å8(4) 1H38|1|O, 1H38|1|F, 1H38|1|I, 1H38|1|L
138NR_3.0_57348.1
Exact match
1IVS|1|C (1IVS)
  • tRNA (Val)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å75(4) 1IVS|1|C, 1GAX|1|C, 1GAX|1|D, 1IVS|1|D
139NR_3.0_81653.1
Exact match
1J6S|1|D (1J6S)
  • 5'-R(*(BRUP*GP*AP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.4 Å5(4) 1J6S|1|D, 1J6S|1|A, 1J6S|1|B, 1J6S|1|C
140NR_3.0_28334.1
Exact match
1KNZ|1|Z (1KNZ)
  • 5'-R(*UP*GP*AP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
2.5 Å5(4) 1KNZ|1|Z, 1KNZ|1|W, 1KNZ|1|X, 1KNZ|1|Y
141NR_3.0_51549.1
Exact match
1PJO|1|A (1PJO)
  • 5'-R(*CP*AP*AP*AP*GP*AP*AP*AP*AP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å14(4) 1PJO|1|A, 1PJG|1|A, 1G4Q|1|A, 1JB8|1|A
142NR_3.0_06843.2
Exact match
1TTT|1|F (1TTT)
  • TRANSFER RIBONUCLEIC ACID (YEAST, PHE)
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.7 Å62(4) 1TTT|1|F, 1EVV|1|A, 1TTT|1|E, 1TTT|1|D
143NR_3.0_18961.1
Exact match
1WMQ|1|D (1WMQ)
  • 5'-R(P*UP*UP*UP*AP*GP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.6 Å7(4) 1WMQ|1|D, 1WRQ|1|C, 1WMQ|1|C, 1WRQ|1|D
144NR_3.0_85514.1
Exact match
1YYK|1|E+1YYK|1|F (1YYK)
  • 5'-R(*CP*GP*CP*GP*AP*AP*UP*UP*CP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): E, F, L, O, P; model(s): 1
2.5 Å12(4) 1YYK|1|E+1YYK|1|F, 1YYO|1|C+1YYO|1|D, 1YYK|1|C+1YYK|1|D, 1YYO|1|E+1YYO|1|F
145NR_3.0_24746.1
Exact match
1YYW|1|K+1YYW|1|L (1YYW)
  • 5'-R(*AP*AP*AP*UP*AP*UP*AP*UP*AP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): K, L, O, P; model(s): 1
2.8 Å12(4) 1YYW|1|K+1YYW|1|L, 1YYW|1|E+1YYW|1|F, 1YYW|1|G+1YYW|1|H, 1YYW|1|I+1YYW|1|J
146NR_3.0_51779.3
Exact match
1Z7F|1|A (1Z7F)
  • 5'-R(*GP*CP*AP*GP*AP*CP*UP*UP*AP*AP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.1 Å16(4) 1Z7F|1|A, 405D|1|A+405D|1|B, 1Z79|1|A+1Z79|1|B, 1Z79|1|C
147NR_3.0_23650.1
Exact match
259D|1|A+259D|1|B (259D)
  • RNA (5'-R(*CP*CP*CP*CP*GP*GP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
1.5 Å8(4) 259D|1|A+259D|1|B, 1RXA|1|A, 1RXB|1|A+1RXB|1|B, 2A0P|1|A+2A0P|1|B
148NR_3.0_58761.1
Exact match
2CT8|1|D (2CT8)
  • RNA (74-MER)
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.7 Å74(4) 2CT8|1|D, 2CSX|1|C, 2CT8|1|C, 2CSX|1|D
149NR_3.0_59612.1
Exact match
2DB3|1|H (2DB3)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.2 Å6(4) 2DB3|1|H, 2DB3|1|E, 2DB3|1|F, 2DB3|1|G
150NR_3.0_54657.1
Exact match
2FQN|1|A+2FQN|1|B (2FQN)
  • 5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*UP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
2.3 Å22(4) 2FQN|1|A+2FQN|1|B, 2O3Y|1|A+2O3Y|1|B, 2G5K|1|A+2G5K|1|B, 2O3W|1|A+2O3W|1|B
151NR_3.0_98374.1
Exact match
2I82|1|H (2I82)
  • 5'-R(*GP*AP*GP*GP*GP*GP*AP*UP*UP*GP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.1 Å20(4) 2I82|1|H, 2I82|1|E, 2I82|1|F, 2I82|1|G
152NR_3.0_58198.1
Exact match
2R20|1|A+2R20|1|B (2R20)
  • RNA (5'-R(*GP*CP*GP*UP*UP*(5BU)P*GP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
1.3 Å12(4) 2R20|1|A+2R20|1|B, 2R22|1|A+2R22|1|B, 2R1S|1|A+2R1S|1|B, 2R21|1|A+2R21|1|B
153NR_3.0_16115.1
Exact match
2R7W|1|X (2R7W)
  • RNA (5'-R(*UP*GP*UP*GP*AP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.6 Å7(4) 2R7W|1|X, 2R7X|1|X, 2R7R|1|X, 2R7X|1|Y
154NR_3.0_64844.1
Exact match
3BSO|1|T+3BSO|1|P (3BSO)
  • RNA (5'-R(P*UP*GP*CP*CP*CP*GP*GP*GP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): L, O, P, T; model(s): 1
1.7 Å9(4) 3BSO|1|T+3BSO|1|P, 3H5X|1|T+3H5X|1|P, 3H5Y|1|T+3H5Y|1|P, 3BSN|1|T+3BSN|1|P
155NR_3.0_49553.1
Exact match
3CUL|1|D (3CUL)
  • RNA (92-MER)
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.8 Å92(4) 3CUL|1|D, 3CUL|1|C, 3CUN|1|C, 3CUN|1|D
156NR_3.0_22479.1
Exact match
3D0U|1|A (3D0U)
  • Lysine Riboswitch RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å161(4) 3D0U|1|A, 4ERJ|1|A, 4ERL|1|A, 3D0X|1|A
157NR_3.0_95363.2
Exact match
3FU2|1|A (3FU2)
  • PreQ1 riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å32(4) 3FU2|1|A, 3FU2|1|B, 3FU2|1|C, 3K1V|1|A
158NR_3.0_26629.1
Exact match
3HK2|1|F (3HK2)
  • 5'-R(*UP*AP*UP*AP*CP*AP*AP*CP*CP*UP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.8 Å15(4) 3HK2|1|F, 3HK2|1|D, 3F73|1|H, 3F73|1|Y
159NR_3.0_18955.1
Exact match
3I2S|1|A (3I2S)
  • 5'-R(*UP*CP*CP*CP*(A2M)P*GP*UP*CP*CP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å13(4) 3I2S|1|A, 3I2R|1|A, 3I2U|1|A, 3I2Q|1|A
160NR_3.0_51748.1
Exact match
3I5X|1|B (3I5X)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å10(4) 3I5X|1|B, 3I61|1|B, 3I62|1|B, 3I5Y|1|B
161NR_3.0_50890.1
Exact match
3JXR|1|K (3JXR)
  • r[CGCG(5-fluoro)CG]2
  • X-RAY DIFFRACTION
  • Chain(s): K; model(s): 1
1.3 Å5(4) 3JXR|1|K, 3JXQ|1|B+3JXQ|1|A, 3JXQ|1|L+3JXQ|1|K, 3JXR|1|A+3JXR|1|B
162NR_3.0_79254.1
Exact match
Thermus thermophilus
3KFU|1|L (3KFU)
  • tRNA-Asn
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
3.0 Å71(4) 3KFU|1|L, 3KFU|1|K, 3KFU|1|M, 3KFU|1|N
163NR_3.0_56855.1
Exact match
3KMS|1|B+3KMS|1|C (3KMS)
  • RNA (5'-R(*AP*UP*GP*GP*GP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B, C, L, O, P; model(s): 1
2.2 Å7(4) 3KMS|1|B+3KMS|1|C, 3KLV|1|B+3KLV|1|C, 4IQX|1|B+4IQX|1|C, 3KNA|1|B+3KNA|1|C
164NR_3.0_25369.1
Exact match
3NJ6|1|A (3NJ6)
  • 5'-R(*GP*GP*CP*AP*GP*CP*AP*GP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.0 Å10(4) 3NJ6|1|A, 3NJ7|1|A+3NJ7|1|B, 3NJ7|1|C+3NJ7|1|D, 3NJ7|1|E+3NJ7|1|F
165NR_3.0_83027.1
Exact match
Ralstonia solanacearum
3NPN|1|A (3NPN)
  • S-ADENOSYLHOMOCYSTEINE RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å50(4) 3NPN|1|A, 3NPQ|1|C, 3NPQ|1|A, 3NPQ|1|B
166NR_3.0_41959.1
Exact match
3P22|1|G (3P22)
  • Core ENE hairpin from KSHV PAN RNA
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.5 Å39(4) 3P22|1|G, 3P22|1|A, 3P22|1|C, 3P22|1|E
167NR_3.0_76114.1
Exact match
3RKF|1|B (3RKF)
  • Guanine riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å67(4) 3RKF|1|B, 3RKF|1|A, 3RKF|1|D, 3RKF|1|C
168NR_3.0_59870.1
Exact match
3S49|1|G (3S49)
  • RNA (5'-R(*GP*UP*AP*UP*AP*(RUS)P*AP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.3 Å7(4) 3S49|1|G, 3S49|1|A+3S49|1|B, 3S49|1|C+3S49|1|D, 3S49|1|E+3S49|1|F
169NR_3.0_47330.1
Exact match
3SKL|1|A (3SKL)
  • RNA (66-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å64(4) 3SKL|1|A, 3SKL|1|B, 3SKW|1|A, 3SKW|1|B
170NR_3.0_94275.1
Exact match
synthetic construct
3ZP8|1|A (3ZP8)
  • HAMMERHEAD RIBOZYME, ENZYME STRAND
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.6 Å42(4) 3ZP8|1|A, 3ZD4|1|A, 2OEU|1|A, 3ZD5|1|A
171NR_3.0_72182.1
Exact match
Escherichia coli
4AM3|1|I (4AM3)
  • RNA, 5'-R(*UP*AP*AP*CP*UP*UP*UP*GP*GP)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
3.0 Å1(4) 4AM3|1|I, 4AM3|1|E, 4AM3|1|D, 4AM3|1|H
172NR_3.0_87746.1
Exact match
4IQS|1|F (4IQS)
  • RNA (5'-R(*GP*UP*GP*(S5)P*AP*CP*AP*C)-3'[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.6 Å7(4) 4IQS|1|F, 4IQS|1|A+4IQS|1|B, 4IQS|1|C+4IQS|1|D, 4IQS|1|E
173NR_3.0_88517.2
Exact match
4JNG|1|L (4JNG)
  • RNA (42-MER)
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
2.1 Å42(4) 4JNG|1|L, 4J1G|1|E, 3PU4|1|R, 2GIC|1|R
174NR_3.0_81920.1
Exact match
4K4Y|1|N+4K4Y|1|P (4K4Y)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): L, N, O, P; model(s): 1
2.7 Å17(4) 4K4Y|1|N+4K4Y|1|P, 4K4Y|1|B+4K4Y|1|D, 4K4Y|1|J+4K4Y|1|L, 4K4Y|1|F+4K4Y|1|H
175NR_3.0_31091.1
Exact match
4K50|1|F (4K50)
  • RNA (33-MER)
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.9 Å31(4) 4K50|1|F, 4K50|1|N, 4K50|1|B, 4K50|1|J
176NR_3.0_24235.1
Exact match
4LGT|1|F (4LGT)
  • stem-loop of 23S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
1.3 Å19(4) 4LGT|1|F, 4LGT|1|E, 3DH3|1|F+3DH3|1|E, 3DH3|1|G+3DH3|1|H
177NR_3.0_40559.1
Exact match
synthetic construct
4PEH|1|Y (4PEH)
  • RNA (5'-R(*CP*UP*AP*(A2P)P*AP*CP*AP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.1 Å4(4) 4PEH|1|Y, 4PEH|1|X, 4PEH|1|W, 4PEH|1|V
178NR_3.0_67439.2
Exact match
4PQU|1|T (4PQU)
  • 5'-R(*AP*UP*GP*GP*UP*CP*GP*GP*CP*GP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.5 Å21(4) 4PQU|1|T, 4PQU|1|E, 4PUO|1|T, 4PUO|1|E
179NR_3.0_19645.1
Exact match
4QI2|1|E (4QI2)
  • RNA (5'-R(*AP*CP*AP*UP*GP*UP*UP*UP*UP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.0 Å19(4) 4QI2|1|E, 4QI2|1|F, 4QI2|1|G, 4QI2|1|H
180NR_3.0_26321.1
Exact match
4QOZ|1|A (4QOZ)
  • histone mRNA stem-loop
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å26(4) 4QOZ|1|A, 4L8R|1|A, 4QOZ|1|D, 4L8R|1|D
181NR_3.0_19502.2
Exact match
synthetic construct
4RGE|1|B (4RGE)
  • env22 twister ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å55(4) 4RGE|1|B, 4RGE|1|C, 4RGE|1|A, 5DUN|1|A
182NR_3.0_30317.1
Exact match
synthetic construct
4S3N|1|B+4S3N|1|C (4S3N)
  • RNA (5'-R(*GP*GP*CP*UP*UP*UP*UP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, L, O, P; model(s): 1
2.0 Å19(4) 4S3N|1|B+4S3N|1|C, 4RWP|1|B+4RWP|1|C, 4RWN|1|B+4RWN|1|C, 4RWO|1|B+4RWO|1|C
183NR_3.0_89292.1
Exact match
4V8D|1|AD (4V8D)
  • TRNA-TYR
  • X-RAY DIFFRACTION
  • Chain(s): AD; model(s): 1
3.0 Å84(4) 4V8D|1|AD, 4V8D|1|AB, 4V8D|1|CD, 4V8D|1|CB
184NR_3.0_49730.1
Exact match
Homo sapiens
4X4V|1|B (4X4V)
  • Human MenBeta minihelix ending in CCACC
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å34(4) 4X4V|1|B, 4X4U|1|D, 4X4U|1|B, 4X4V|1|D
185NR_3.0_00143.1
Exact match
Lactococcus lactis
4Y1J|1|A (4Y1J)
  • yybP-ykoY riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.2 Å100(4) 4Y1J|1|A, 4Y1I|1|B, 4Y1I|1|A, 4Y1J|1|B
186NR_3.0_31480.1
Exact match
4YAZ|1|R (4YAZ)
  • RNA (84-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.0 Å83(4) 4YAZ|1|R, 4YAZ|1|A, 4YB0|1|A, 4YB0|1|R
187NR_3.0_49464.1
Exact match
synthetic construct
5AY3|1|A+5AY3|1|B (5AY3)
  • RNA (5'-R(*GP*GP*AP*CP*UP*(CBR)P*GP*A*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
1.2 Å12(4) 5AY3|1|A+5AY3|1|B, 5AY2|1|A+5AY2|1|B, 5AY4|1|A+5AY4|1|B, 5AY2|1|C+5AY2|1|D
188NR_3.0_55964.1
Exact match
Lactobacillus rhamnosus
5D5L|1|D (5D5L)
  • PreQ1-II riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.5 Å76(4) 5D5L|1|D, 5D5L|1|A, 5D5L|1|B, 5D5L|1|C
189NR_3.0_56345.1
Exact match
Vibrio vulnificus
5E54|1|B (5E54)
  • Vibrio vulnificus strain 93U204 chromoso[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å68(4) 5E54|1|B, 5SWD|1|B, 5E54|1|A, 5SWD|1|A
190NR_3.0_08138.1
Exact match
Homo sapiens
5F0Q|1|E (5F0Q)
  • RNA (5'-R(P*GP*GP*CP*GP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.2 Å5(4) 5F0Q|1|E, 5F0S|1|C, 5F0Q|1|C, 5F0S|1|E
191NR_3.0_20758.1
Exact match
synthetic construct
5F8H|1|B+5F8H|1|C (5F8H)
  • RNA (35-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B, C, L, O, P; model(s): 1
2.5 Å12(4) 5F8H|1|B+5F8H|1|C, 5F8J|1|B+5F8J|1|C, 5F8G|1|B+5F8G|1|C, 5F8I|1|B+5F8I|1|C
192NR_3.0_76703.4
Exact match
Escherichia coli
5IB7|1|1L (5IB7)
  • tRNALys
  • X-RAY DIFFRACTION
  • Chain(s): 1L; model(s): 1
3.0 Å66(4) 5IB7|1|1L, 5IB7|1|1K, 5E81|1|1K, 5E81|1|1L
193NR_3.0_73988.1
Exact match
Saccharomyces cerevisiae
5L2L|1|H (5L2L)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*G)[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
1.6 Å11(4) 5L2L|1|H, 5L2L|1|D, 5L2L|1|G, 5L2L|1|C
194NR_3.0_77294.1
Exact match
Gloeobacter violaceus
5NDH|1|D (5NDH)
  • RNA (5'-R(*GP*(CBV)P*GP*GP*GP*GP*AP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.8 Å15(4) 5NDH|1|D, 5NDH|1|A, 5NDH|1|B, 5NDH|1|C
195NR_3.0_66896.1
Exact match
Escherichia coli
5NDI|1|D (5NDI)
  • RNA (5'-R(*UP*UP*UP*GP*CP*AP*GP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.6 Å19(4) 5NDI|1|D, 5NDI|1|A, 5NDI|1|B, 5NDI|1|C
196NR_3.0_59689.3
Exact match
Vibrio vulnificus
5SWE|1|X (5SWE)
  • Vibrio vulnificus strain 93U204 chromoso[...]
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.0 Å71(4) 5SWE|1|X, 4TZY|1|X, 4TZX|1|X, 4XNR|1|X
197NR_3.0_42653.1
Exact match
5T16|1|P (5T16)
  • RNA substrate analog
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.8 Å33(4) 5T16|1|P, 5T16|1|G, 5T16|1|H, 5T16|1|O
198NR_3.0_83745.1
Exact match
synthetic construct
5T3K|1|C+5T3K|1|D (5T3K)
  • RNA (5'-R(*GP*GP*UP*GP*GP*UP*GP*AP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, L, O, P; model(s): 1
2.1 Å17(4) 5T3K|1|C+5T3K|1|D, 5T3K|1|A+5T3K|1|B, 1T0D|1|A+1T0D|1|B, 1T0D|1|C+1T0D|1|D
199NR_3.0_93599.1
Exact match
Homo sapiens
5UDZ|1|W (5UDZ)
  • let-7f-1 pre-element
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
2.0 Å23(4) 5UDZ|1|W, 5UDZ|1|V, 3TS0|1|U, 3TS0|1|V
200NR_3.0_03710.1
Exact match
Escherichia coli
1EFW|1|D (1EFW)
  • ASPARTYL-TRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å63(3) 1EFW|1|D, 1EFW|1|C, 1C0A|1|B
201NR_3.0_23049.1
Exact match
1F7Y|1|B (1F7Y)
  • 16S RIBOSOMAL RNA FRAGMENT
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å60(3) 1F7Y|1|B, 1DK1|1|B, 1KUQ|1|B
202NR_3.0_61174.1
Exact match
Escherichia coli
1H2C|1|R (1H2C)
  • 5'-R(*UP*GP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
1.6 Å3(3) 1H2C|1|R, 1H2D|1|R, 1H2D|1|S
203NR_3.0_52295.1
Exact match
Escherichia coli
1O9M|1|A+1O9M|1|B (1O9M)
  • EUBACTERIAL A-SITE
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
2.4 Å21(3) 1O9M|1|A+1O9M|1|B, 2ET8|1|A+2ET8|1|B, 2F4U|1|A+2F4U|1|B
204NR_3.0_08416.1
Exact match
1QBP|1|E+1QBP|1|F (1QBP)
  • 5'-R(*UP*GP*(CBV)P*(CBV)P*AP*GP*UP*UP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): E, F, L, O, P; model(s): 1
2.1 Å13(3) 1QBP|1|E+1QBP|1|F, 1QBP|1|A+1QBP|1|B, 1QBP|1|C+1QBP|1|D
205NR_3.0_03715.1
Exact match
Staphylococcus aureus
1QU2|1|T (1QU2)
  • ISOLEUCYL-TRNA
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.2 Å75(3) 1QU2|1|T, 1FFY|1|T, 1QU3|1|T
206NR_3.0_99363.1
Exact match
1SA9|1|E (1SA9)
  • 5'-R(*GP*GP*CP*GP*AP*GP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.9 Å8(3) 1SA9|1|E, 1SA9|1|A+1SA9|1|B, 1SA9|1|C+1SA9|1|D
207NR_3.0_16422.1
Exact match
1SAQ|1|E (1SAQ)
  • 5'-R(*GP*IP*CP*GP*AP*GP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.7 Å7(3) 1SAQ|1|E, 1SAQ|1|A+1SAQ|1|B, 1SAQ|1|C+1SAQ|1|D
208NR_3.0_73551.1
Exact match
1SDS|1|F (1SDS)
  • box H/ACA sRNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
1.8 Å15(3) 1SDS|1|F, 1SDS|1|D, 1SDS|1|E
209NR_3.0_79612.1
Exact match
1UVI|1|F (1UVI)
  • 5'-R(*UP*UP*UP*UP*CP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.2 Å4(3) 1UVI|1|F, 1UVI|1|D, 1UVI|1|E
210NR_3.0_81635.1
Exact match
1UVJ|1|F (1UVJ)
  • 5'-R(*UP*UP*CP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
1.9 Å4(3) 1UVJ|1|F, 1UVJ|1|D, 1UVJ|1|E
211NR_3.0_96572.1
Exact match
1UVL|1|F (1UVL)
  • 5'-R(*UP*UP*UP*CP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.0 Å5(3) 1UVL|1|F, 1UVL|1|B, 1UVL|1|D
212NR_3.0_95409.1
Exact match
1UVM|1|F (1UVM)
  • 5'-R(*UP*UP*UP*CP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.0 Å5(3) 1UVM|1|F, 1UVM|1|D, 1UVM|1|E
213NR_3.0_31949.1
Exact match
1UVN|1|F (1UVN)
  • 5'-R(*UP*UP*UP*UP*CP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.0 Å4(3) 1UVN|1|F, 1UVN|1|B, 1UVN|1|D
214NR_3.0_42126.1
Exact match
2B3J|1|E (2B3J)
  • anticodon stem-loop of t-RNA-Arg2 (nucle[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.0 Å14(3) 2B3J|1|E, 2B3J|1|H, 2B3J|1|F
215NR_3.0_83080.1
Exact match
2QWY|1|C (2QWY)
  • SAM-II riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å52(3) 2QWY|1|C, 2QWY|1|A, 2QWY|1|B
216NR_3.0_95171.1
Exact match
3B31|1|A (3B31)
  • RNA (29-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.4 Å29(3) 3B31|1|A, 3MJA|1|B, 3MJB|1|A
217NR_3.0_58167.1
Exact match
3E5C|1|A (3E5C)
  • SMK box (SAM-III) Riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å52(3) 3E5C|1|A, 3E5F|1|A, 3E5E|1|A
218NR_3.0_81896.1
Exact match
3GLP|1|E (3GLP)
  • 5'-R(*GP*CP*UP*GP*CP*UP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.2 Å8(3) 3GLP|1|E, 3GLP|1|B+3GLP|1|A, 3GLP|1|C+3GLP|1|D
219NR_3.0_92727.1
Exact match
3K49|1|F (3K49)
  • RNA (5'-R(*CP*CP*UP*GP*UP*AP*AP*AP*UP*A)[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.5 Å10(3) 3K49|1|F, 3K49|1|B, 3K49|1|D
220NR_3.0_53884.1
Exact match
3O7V|1|A (3O7V)
  • RNA (5'-R(*GP*CP*GP*AP*AP*UP*AP*UP*UP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.1 Å13(3) 3O7V|1|A, 3O3I|1|A, 3O6E|1|A
221NR_3.0_40560.1
Exact match
3OIN|1|C (3OIN)
  • 5'-R(*GP*GP*GP*CP*UP*UP*CP*AP*AP*CP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.9 Å14(3) 3OIN|1|C, 3OIJ|1|C, 3OIJ|1|D
222NR_3.0_47162.1
Exact match
Bacillus subtilis
3PDR|1|A (3PDR)
  • M-box Riboswitch RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.9 Å161(3) 3PDR|1|A, 2QBZ|1|X, 3PDR|1|X
223NR_3.0_81724.1
Exact match
3Q0N|1|D (3Q0N)
  • 5'-R(UP*GP*UP*AP*CP*AP*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å7(3) 3Q0N|1|D, 3Q0O|1|C, 3Q0O|1|D
224NR_3.0_54128.1
Exact match
3Q0R|1|B (3Q0R)
  • 5'-R(UP*GP*UP*AP*GP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å8(3) 3Q0R|1|B, 3Q0M|1|C, 3Q0M|1|D
225NR_3.0_89202.1
Exact match
3Q50|1|A (3Q50)
  • PREQ1 RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å33(3) 3Q50|1|A, 3Q51|1|A, 3GCA|1|A
226NR_3.0_68171.1
Exact match
3R1C|1|i+3R1C|1|j (3R1C)
  • RNA (5'-R(*GP*CP*GP*GP*CP*GP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): L, O, P, i, j; model(s): 1
2.1 Å8(3) 3R1C|1|i+3R1C|1|j, 3R1C|1|g+3R1C|1|h, 3R1C|1|E+3R1C|1|F
227NR_3.0_45159.1
Exact match
3SYW|1|A+3SYW|1|B (3SYW)
  • RNA (5'-R(*UP*UP*GP*GP*GP*CP*CP*UP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
1.6 Å21(3) 3SYW|1|A+3SYW|1|B, 4YN6|1|A+4YN6|1|B, 4J50|1|A+4J50|1|B
228NR_3.0_66740.1
Exact match
Escherichia coli
3T5N|1|C (3T5N)
  • RNA (5'-R(P*UP*AP*UP*CP*UP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.8 Å6(3) 3T5N|1|C, 3T5Q|1|H, 3T5Q|1|L
229NR_3.0_18396.1
Exact match
synthetic construct
3ZC0|1|O (3ZC0)
  • 5'-R(*UP*UP*CP*GP*AP*CP*GP*CP*GP*UP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): O; model(s): 1
3.0 Å28(3) 3ZC0|1|O, 3ZC0|1|M, 3ZC0|1|N
230NR_3.0_57688.1
Exact match
409D|1|E+409D|1|F (409D)
  • RNA (5'-R(*CP*CP*CP*IP*UP*GP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): E, F, L, O, P; model(s): 1
2.5 Å7(3) 409D|1|E+409D|1|F, 409D|1|A+409D|1|B, 409D|1|C+409D|1|D
231NR_3.0_37735.1
Exact match
437D|1|A (437D)
  • RNA PSEUDOKNOT
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.6 Å32(3) 437D|1|A, 1L3D|1|A, 1L2X|1|A
232NR_3.0_95734.1
Exact match
Thermus thermophilus
4B3T|1|Z+4B3T|1|W (4B3T)
  • 5'-R(*GP*GP*GP*AP*UP*UP*GP*AP*AP*AP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): L, O, P, W, Z; model(s): 1
3.0 Å15(3) 4B3T|1|Z+4B3T|1|W, 4B3R|1|Z+4B3R|1|W, 4B3M|1|Z+4B3M|1|W
233NR_3.0_02622.1
Exact match
4GHA|1|I+4GHA|1|J (4GHA)
  • RNA (5'-R(*CP*UP*AP*GP*AP*CP*GP*UP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): I, J, L, O, P; model(s): 1
2.5 Å12(3) 4GHA|1|I+4GHA|1|J, 4LG2|1|I+4LG2|1|J, 4LG2|1|E+4LG2|1|F
234NR_3.0_85566.1
Exact match
4GV3|1|C+4GV3|1|B (4GV3)
  • RNA (5'-R(P*CP*GP*CP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B, C, L, O, P; model(s): 1
1.7 Å4(3) 4GV3|1|C+4GV3|1|B, 4GV9|1|F+4GV9|1|E, 4GV6|1|C+4GV6|1|B
235NR_3.0_73115.1
Exact match
Homo sapiens
4HT9|1|D (4HT9)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.8 Å7(3) 4HT9|1|D, 4HT8|1|I, 4HT8|1|K
236NR_3.0_88706.1
Exact match
synthetic construct
4JAH|1|E+4JAH|1|F (4JAH)
  • RNA (5'-R(*GP*UP*GP*UP*AP*(RUS)P*AP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): E, F, L, O, P; model(s): 1
1.5 Å7(3) 4JAH|1|E+4JAH|1|F, 4JAH|1|A+4JAH|1|B, 4JAH|1|C+4JAH|1|D
237NR_3.0_25361.2
Exact match
4JNX|1|B+4JNX|1|G (4JNX)
  • 5'-R(P*GP*CP*UP*GP*CP*UP*GP*CP*UP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, G, L, O, P; model(s): 1
2.0 Å39(3) 4JNX|1|B+4JNX|1|G, 4E48|1|A+4E48|1|B, 4E48|1|D
238NR_3.0_09443.2
Exact match
4K4S|1|B+4K4S|1|F+4K4S|1|C+4K4S|1|G+4K4S|1|D+4K4S|1|H (4K4S)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H; model(s): 1
2.4 Å17(3) 4K4S|1|B+4K4S|1|F+4K4S|1|C+4K4S|1|G+4K4S|1|D+4K4S|1|H, 4K4T|1|B+4K4T|1|C+4K4T|1|D, 4K4T|1|F+4K4T|1|G+4K4T|1|H
239NR_3.0_06951.1
Exact match
4KZD|1|R (4KZD)
  • RNA (84-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.2 Å83(3) 4KZD|1|R, 4KZE|1|R, 4Q9Q|1|R
240NR_3.0_80093.2
Exact match
4LJ0|1|E (4LJ0)
  • polyadenosine RNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.2 Å2(3) 4LJ0|1|E, 4LJ0|1|C, 4LJ0|1|D
241NR_3.0_50478.2
Exact match
4OHY|1|B (4OHY)
  • RNA (5'-R(*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å2(3) 4OHY|1|B, 4OI1|1|B, 4OI0|1|B
242NR_3.0_33558.1
Exact match
Endothia gyrosa
4PCO|1|E (4PCO)
  • RNA (5'-D(*GP*GP*UP*GP*GP*CP*UP*GP*UP*U)[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.3 Å16(3) 4PCO|1|E, 4PCO|1|A+4PCO|1|B, 4PCO|1|C+4PCO|1|D
243NR_3.0_22602.1
Exact match
synthetic construct
4QU7|1|X (4QU7)
  • RNA 5'-(*AP*GP*GP*GP*AP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.5 Å3(3) 4QU7|1|X, 4QU7|1|V, 4QU7|1|U
244NR_3.0_52096.2
Exact match
synthetic construct
4TV0|1|B (4TV0)
  • RNA (26-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å26(3) 4TV0|1|B, 4TUW|1|D, 4TUW|1|C
245NR_3.0_95556.5
Exact match
Thermus thermophilus
4V90|1|AV (4V90)
  • RNA (77-MER)
  • X-RAY DIFFRACTION
  • Chain(s): AV; model(s): 1
3.0 Å76(3) 4V90|1|AV, 5J8B|1|w, 5J8B|1|y
246NR_3.0_50058.1
Exact match
synthetic construct
4WTF|1|T+4WTF|1|P (4WTF)
  • RNA PRIMER TEMPLATE CAAAAUUU
  • X-RAY DIFFRACTION
  • Chain(s): C, D, G, H, P, T; model(s): 1
2.7 Å8(3) 4WTF|1|T+4WTF|1|P, 4WTA|1|T+4WTA|1|P, 4WTG|1|T+4WTG|1|P
247NR_3.0_90840.2
Exact match
Homo sapiens
4ZDO|1|E (4ZDO)
  • selenocysteine tRNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.7 Å150(3) 4ZDO|1|E, 4ZDP|1|E, 3HL2|1|E
248NR_3.0_18889.3
Exact match
Fusobacterium nucleatum
5C45|1|X+5C45|1|Y (5C45)
  • FMN Riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): C, D, G, H, X, Y; model(s): 1
2.9 Å54(3) 5C45|1|X+5C45|1|Y, 5KX9|1|X+5KX9|1|Y, 2YIE|1|X+2YIE|1|Z
249NR_3.0_25771.1
Exact match
Escherichia coli
5D0A|1|F (5D0A)
  • RNA (5'-R(*G*CP*AP*GP*AP*CP*UP*GP*UP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.1 Å14(3) 5D0A|1|F, 5D0A|1|E, 5T8Y|1|X
250NR_3.0_34346.1
Exact match
synthetic construct
5D8T|1|A+5D8T|1|B (5D8T)
  • RNA oligonucleotide containing (S)-C5'-M[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, G, H; model(s): 1
1.2 Å6(3) 5D8T|1|A+5D8T|1|B, 5DER|1|A+5DER|1|B, 5DER|1|C+5DER|1|D
251NR_3.0_84026.1
Exact match
synthetic construct
5DHB|1|C+5DHB|1|D (5DHB)
  • RNA (5'-R(*(LCC)P*(TLN)P*(LCG)P*UP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, G, H; model(s): 1
1.8 Å4(3) 5DHB|1|C+5DHB|1|D, 5DHB|1|A+5DHB|1|B, 5HBW|1|A+5HBW|1|B
252NR_3.0_88987.5
Exact match
Deinococcus radiodurans
5DM6|1|X (5DM6)
  • 23S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.9 Å2780(3) 5DM6|1|X, 2ZJR|1|X, 5DM7|1|X
253NR_3.0_17405.5
Exact match
Deinococcus radiodurans
5DM6|1|Y (5DM6)
  • 5S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.9 Å122(3) 5DM6|1|Y, 2ZJR|1|Y, 5DM7|1|Y
254NR_3.0_16758.1
Exact match
Mus musculus
5F5F|1|H (5F5F)
  • RNA (5'-R(P*UP*GP*AP*CP*UP*GP*CP*GP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.0 Å20(3) 5F5F|1|H, 5F5F|1|B, 5F5F|1|D
255NR_3.0_69813.2
Exact match
Escherichia coli
5IBB|1|3L (5IBB)
  • tRNAVal
  • X-RAY DIFFRACTION
  • Chain(s): 3L; model(s): 1
3.0 Å71(3) 5IBB|1|3L, 5IBB|1|1K, 5IBB|1|3K
256NR_3.0_20721.6
Exact match
Thermus thermophilus
5J8B|1|x (5J8B)
  • P-site tRNA
  • X-RAY DIFFRACTION
  • Chain(s): x; model(s): 1
2.6 Å73(3) 5J8B|1|x, 5E81|1|2K, 5E81|1|2L
257NR_3.0_92635.1
Exact match
synthetic construct
5SUP|1|F (5SUP)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.6 Å6(3) 5SUP|1|F, 5SUP|1|D, 5SUP|1|E
258NR_3.0_60469.1
Exact match
Saccharomyces cerevisiae
5TF6|1|B (5TF6)
  • U6 snRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å71(3) 5TF6|1|B, 4N0T|1|B, 5TF6|1|D
259NR_3.0_97573.1
Exact match
synthetic construct
5W0M|1|J (5W0M)
  • U5 single-stranded RNA
  • X-RAY DIFFRACTION
  • Chain(s): J; model(s): 1
2.3 Å4(3) 5W0M|1|J, 5W0M|1|H, 5W0M|1|I
260NR_3.0_74407.1
Exact match
Acidaminococcus sp. BV3L6
5XH7|1|B (5XH7)
  • crRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å40(3) 5XH7|1|B, 5B43|1|B, 5XH6|1|B
261NR_3.0_89332.1
Exact match
Homo sapiens
1A9N|1|R (1A9N)
  • RNA (5'-R(*CP*CP*UP*GP*GP*UP*AP*UP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.4 Å24(2) 1A9N|1|R, 1A9N|1|Q
262NR_3.0_68428.1
Exact match
1D4R|1|C (1D4R)
  • 29-MER OF MODIFIED SRP RNA HELIX 6
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.0 Å28(2) 1D4R|1|C, 1D4R|1|B+1D4R|1|A
263NR_3.0_43622.1
Exact match
Homo sapiens
1E7K|1|D (1E7K)
  • RNA (5'-R(*GP*CP*CP*AP*AP*UP*GP*AP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.9 Å17(2) 1E7K|1|D, 1E7K|1|C
264NR_3.0_82534.1
Exact match
1F7V|1|B (1F7V)
  • TRNA(ARG)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å60(2) 1F7V|1|B, 1F7U|1|B
265NR_3.0_99953.1
Exact match
1FEU|1|F+1FEU|1|E (1FEU)
  • 21 NT FRAGMENT OF 5S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, G, H; model(s): 1
2.3 Å21(2) 1FEU|1|F+1FEU|1|E, 1FEU|1|C+1FEU|1|B
266NR_3.0_14518.1
Exact match
1FUF|1|A+1FUF|1|B (1FUF)
  • (5'-R(*GP*GP*UP*AP*UP*UP*UP*CP*GP*GP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, G, H; model(s): 1
1.7 Å13(2) 1FUF|1|A+1FUF|1|B, 1IK5|1|A+1IK5|1|B
267NR_3.0_26284.1
Exact match
Thermus thermophilus
1H4S|1|T (1H4S)
  • TRNAPRO(CGG)
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.9 Å65(2) 1H4S|1|T, 1H4Q|1|T
268NR_3.0_55907.2
Exact match
1HMH|1|E (1HMH)
  • HAMMERHEAD RIBOZYME-RNA STRAND
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.6 Å34(2) 1HMH|1|E, 1HMH|1|C
269NR_3.0_27949.4
Exact match
1I5L|1|Y (1I5L)
  • 5'-R(*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.8 Å3(2) 1I5L|1|Y, 1I5L|1|U
270NR_3.0_49782.1
Exact match
1I6U|1|C (1I6U)
  • 16S RRNA FRAGMENT
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.6 Å37(2) 1I6U|1|C, 1I6U|1|D
271NR_3.0_41566.1
Exact match
1J8G|1|B (1J8G)
  • 5'-R(*UP*GP*GP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
0.6 Å6(2) 1J8G|1|B, 4RKV|1|B
272NR_3.0_16983.1
Exact match
1J9H|1|C+1J9H|1|D (1J9H)
  • 5'-R(*GP*UP*GP*UP*CP*GP*(CBR)P*AP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C, D, G, H; model(s): 1
1.4 Å8(2) 1J9H|1|C+1J9H|1|D, 1J9H|1|A+1J9H|1|B
273NR_3.0_19241.1
Exact match
1JZV|1|D+1JZV|1|C (1JZV)
  • 5'-R(*CP*AP*GP*UP*AP*CP*GP*(5IC)P*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C, D, G, H; model(s): 1
1.7 Å8(2) 1JZV|1|D+1JZV|1|C, 1JZV|1|B+1JZV|1|A
274NR_3.0_03986.1
Exact match
1KD5|1|A+1KD5|1|B (1KD5)
  • 5'-R(*GP*GP*UP*CP*AP*CP*AP*GP*CP*CP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, G, H; model(s): 1
1.6 Å11(2) 1KD5|1|A+1KD5|1|B, 1KD3|1|A+1KD3|1|B
275NR_3.0_54586.1
Exact match
1L3Z|1|B (1L3Z)
  • 5'-R(*GP*UP*AP*UP*AP*CP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å7(2) 1L3Z|1|B, 1L3Z|1|A
276NR_3.0_81068.1
Exact match
1M8X|1|C (1M8X)
  • 5'-R(P*UP*UP*GP*UP*AP*UP*AP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.2 Å8(2) 1M8X|1|C, 1M8W|1|C
277NR_3.0_48641.1
Exact match
1M8X|1|D (1M8X)
  • 5'-R(P*UP*GP*UP*AP*UP*AP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.2 Å7(2) 1M8X|1|D, 1M8W|1|D
278NR_3.0_81175.1
Exact match
1M8Y|1|D (1M8Y)
  • 5'-R(P*AP*UP*UP*GP*UP*AP*CP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.6 Å10(2) 1M8Y|1|D, 1M8Y|1|C
279NR_3.0_62367.1
Exact match
Escherichia coli
1MJI|1|C (1MJI)
  • 5S rRNA fragment
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.5 Å34(2) 1MJI|1|C, 1MJI|1|D
280NR_3.0_74849.1
Exact match
1MMS|1|D (1MMS)
  • 23S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.6 Å58(2) 1MMS|1|D, 1MMS|1|C
281NR_3.0_74199.1
Exact match
1NTB|1|A+1NTB|1|B (1NTB)
  • 5'-R(*GP*GP*AP*UP*CP*GP*CP*AP*UP*UP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, G, H; model(s): 1
2.9 Å22(2) 1NTB|1|A+1NTB|1|B, 1NTA|1|A+1NTA|1|B
282NR_3.0_55924.2
Exact match
1OOA|1|D (1OOA)
  • RNA aptamer
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.5 Å29(2) 1OOA|1|D, 1OOA|1|C
283NR_3.0_01597.1
Exact match
1Q2R|1|F (1Q2R)
  • RNA (5'-R(*AP*GP*CP*AP*CP*GP*GP*CP*UP*(N[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.9 Å19(2) 1Q2R|1|F, 1Q2R|1|E
284NR_3.0_80055.1
Exact match
1RLG|1|D (1RLG)
  • 25-MER
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.7 Å22(2) 1RLG|1|D, 1RLG|1|C
285NR_3.0_81475.1
Exact match
1SDR|1|C+1SDR|1|D (1SDR)
  • RNA (5'-R(*UP*AP*AP*GP*GP*AP*GP*GP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, G, H; model(s): 1
2.6 Å12(2) 1SDR|1|C+1SDR|1|D, 1SDR|1|A+1SDR|1|B
286NR_3.0_65598.1
Exact match
1TFW|1|I+1TFW|1|F (1TFW)
  • 5'-R(*GP*CP*GP*GP*AP*UP*CP*CP*GP*CP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, G, H, I; model(s): 1
2.2 Å13(2) 1TFW|1|I+1TFW|1|F, 1TFW|1|H+1TFW|1|E
287NR_3.0_13485.1
Exact match
1U1Y|1|R (1U1Y)
  • 5'-R(*CP*CP*GP*GP*(2PR)P*GP*GP*AP*UP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.9 Å16(2) 1U1Y|1|R, 1U1Y|1|S
288NR_3.0_22775.2
Exact match
1URN|1|Q (1URN)
  • RNA (5'-R(*AP*AP*UP*CP*CP*AP*UP*UP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
1.9 Å21(2) 1URN|1|Q, 1URN|1|R
289NR_3.0_19039.1
Exact match
1WPU|1|D (1WPU)
  • 5'-R(*UP*UP*GP*AP*GP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.5 Å7(2) 1WPU|1|D, 1WPU|1|C
290NR_3.0_90215.1
Exact match
1YLS|1|D (1YLS)
  • RNA Diels-Alder ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å34(2) 1YLS|1|D, 1YLS|1|B
291NR_3.0_45851.1
Exact match
1YTU|1|E+1YTU|1|F (1YTU)
  • 5'-R(P*AP*GP*AP*CP*AP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, G, H; model(s): 1
2.5 Å6(2) 1YTU|1|E+1YTU|1|F, 1YTU|1|C+1YTU|1|D
292NR_3.0_65678.1
Exact match
1YVP|1|E+1YVP|1|F (1YVP)
  • Y RNA sequence, first strand
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, G, H; model(s): 1
2.2 Å9(2) 1YVP|1|E+1YVP|1|F, 1YVP|1|C+1YVP|1|D
293NR_3.0_74336.1
Exact match
1ZBH|1|F (1ZBH)
  • 5'-R(*CP*CP*GP*GP*CP*UP*CP*UP*UP*UP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.0 Å16(2) 1ZBH|1|F, 1ZBH|1|E
294NR_3.0_93523.1
Exact match
1ZBI|1|C (1ZBI)
  • 5'-R(*GP*AP*CP*AP*CP*CP*UP*GP*AP*UP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.9 Å12(2) 1ZBI|1|C, 1ZBL|1|C
295NR_3.0_53827.1
Exact match
1ZDJ|1|S (1ZDJ)
  • RNA (5'-R(*GP*GP*AP*UP*CP*AP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): S; model(s): 1
2.9 Å8(2) 1ZDJ|1|S, 1ZDJ|1|R
296NR_3.0_72030.1
Exact match
1ZH5|1|C+1ZH5|1|D (1ZH5)
  • 5'-R(*UP*GP*CP*UP*GP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C, D, G, H; model(s): 1
1.9 Å9(2) 1ZH5|1|C+1ZH5|1|D, 1YTY|1|C+1YTY|1|D
297NR_3.0_87784.1
Exact match
1ZX7|1|C+1ZX7|1|E+1ZX7|1|D+1ZX7|1|F (1ZX7)
  • 5'-R(*GP*UP*GP*GP*UP*GP*AP*AP*GP*UP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, H; model(s): 1
2.2 Å15(2) 1ZX7|1|C+1ZX7|1|E+1ZX7|1|D+1ZX7|1|F, 1ZX7|1|A+1ZX7|1|G+1ZX7|1|B+1ZX7|1|H
298NR_3.0_49362.3
Exact match
280D|1|C+280D|1|D (280D)
  • RNA (5'-R(*GP*GP*CP*GP*CP*UP*UP*GP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, H; model(s): 1
2.4 Å12(2) 280D|1|C+280D|1|D, 280D|1|A+280D|1|B
299NR_3.0_33604.1
Exact match
2A04|1|A+2A04|1|C+2A04|1|B+2A04|1|D (2A04)
  • 5'-R(*GP*UP*GP*GP*UP*GP*AP*AP*GP*UP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, H; model(s): 1
3.0 Å15(2) 2A04|1|A+2A04|1|C+2A04|1|B+2A04|1|D, 1ZZ5|1|A+1ZZ5|1|C+1ZZ5|1|B+1ZZ5|1|D
300NR_3.0_36231.1
Exact match
2ANR|1|B (2ANR)
  • 5'-R(*CP*(5BU)P*CP*GP*CP*GP*GP*AP*UP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å24(2) 2ANR|1|B, 2ANN|1|B
301NR_3.0_53890.1
Exact match
2AO5|1|C+2AO5|1|D (2AO5)
  • 5'-R(*GP*GP*CP*GP*(5BU)P*GP*CP*GP*CP*U)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, H; model(s): 1
2.1 Å9(2) 2AO5|1|C+2AO5|1|D, 2AO5|1|A+2AO5|1|B
302NR_3.0_28532.1
Exact match
2ATW|1|D (2ATW)
  • ribosomal RNA (5'- AGAACUCAAUAG -3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.3 Å12(2) 2ATW|1|D, 2ATW|1|B
303NR_3.0_93219.1
Exact match
2AZ2|1|C+2AZ2|1|D (2AZ2)
  • 5'-R(*GP*CP*AP*(5BU)P*GP*GP*AP*CP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, H; model(s): 1
2.6 Å15(2) 2AZ2|1|C+2AZ2|1|D, 2AZ0|1|C+2AZ0|1|D
304NR_3.0_98033.1
Exact match
2AZX|1|C (2AZX)
  • 72-MER
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å72(2) 2AZX|1|C, 2AZX|1|D
305NR_3.0_57734.1
Exact match
2BGG|1|R+2BGG|1|S (2BGG)
  • 5'-R(*UP*UP*CP*GP*AP*CP*GP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, D, H, R, S; model(s): 1
2.2 Å8(2) 2BGG|1|R+2BGG|1|S, 2BGG|1|P+2BGG|1|Q
306NR_3.0_03525.1
Exact match
Escherichia coli
2BH2|1|D (2BH2)
  • 23S RIBOSOMAL RNA 1932-1968
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.2 Å29(2) 2BH2|1|D, 2BH2|1|C
307NR_3.0_23989.1
Exact match
Thermus thermophilus
2BTE|1|E (2BTE)
  • TRNALEU TRANSCRIPT WITH ANTICODON CAG
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.9 Å78(2) 2BTE|1|E, 2BTE|1|B
308NR_3.0_33389.1
Exact match
2DU3|1|D (2DU3)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.6 Å71(2) 2DU3|1|D, 2DU4|1|C
309NR_3.0_53841.1
Exact match
2E9T|1|E+2E9T|1|F (2E9T)
  • 5'-R(P*UP*AP*GP*GP*GP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, H; model(s): 1
2.6 Å8(2) 2E9T|1|E+2E9T|1|F, 2E9T|1|B+2E9T|1|C
310NR_3.0_16755.1
Exact match
2EC0|1|E+2EC0|1|F (2EC0)
  • 5'-R(P*AP*UP*GP*GP*GP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, H; model(s): 1
2.8 Å8(2) 2EC0|1|E+2EC0|1|F, 2EC0|1|B+2EC0|1|C
311NR_3.0_82951.1
Exact match
2F4S|1|A+2F4S|1|B (2F4S)
  • 5'-R(P*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
2.8 Å21(2) 2F4S|1|A+2F4S|1|B, 2O3X|1|A+2O3X|1|B
312NR_3.0_54661.1
Exact match
2GJW|1|I+2GJW|1|J+2GJW|1|L (2GJW)
  • 5'-R(*GP*CP*GP*AP*CP*CP*GP*AP*CP*CP*AP*([...]
  • X-RAY DIFFRACTION
  • Chain(s): D, H, I, J, L; model(s): 1
2.9 Å18(2) 2GJW|1|I+2GJW|1|J+2GJW|1|L, 2GJW|1|E+2GJW|1|F+2GJW|1|H
313NR_3.0_19413.1
Exact match
2I91|1|F+2I91|1|E (2I91)
  • 5'-R(*C*GP*GP*UP*AP*GP*GP*CP*UP*UP*UP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, H, L; model(s): 1
2.7 Å15(2) 2I91|1|F+2I91|1|E, 2I91|1|D+2I91|1|C
314NR_3.0_75028.1
Exact match
Enterobacteria phage MS2
2IZN|1|R (2IZN)
  • 5'-R(*AP*CP*AP*UP*CP*GP*CP*GP*AP*UP *UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.6 Å15(2) 2IZN|1|R, 2IZN|1|S
315NR_3.0_59755.1
Exact match
2JLW|1|D (2JLW)
  • 5'-R(*UP*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.6 Å7(2) 2JLW|1|D, 2JLW|1|C
316NR_3.0_75945.1
Exact match
2OE8|1|B+2OE8|1|A (2OE8)
  • RNA (5'-R(*CP*GP*GP*UP*AP*CP*UP*AP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H, L; model(s): 1
1.8 Å17(2) 2OE8|1|B+2OE8|1|A, 2OE6|1|B+2OE6|1|A
317NR_3.0_22747.1
Exact match
2OZB|1|C (2OZB)
  • RNA comprising the 5' Stem-Loop RNA of [...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.6 Å33(2) 2OZB|1|C, 2OZB|1|F
318NR_3.0_83079.1
Exact match
2P7E|1|A (2P7E)
  • 5' substrate strand, pentameric fragment
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.1 Å5(2) 2P7E|1|A, 2P7D|1|A
319NR_3.0_64649.1
Exact match
2PY9|1|F (2PY9)
  • 12-mer C-rich strand of human telomeric [...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.6 Å12(2) 2PY9|1|F, 2PY9|1|E
320NR_3.0_43749.1
Exact match
2Q1O|1|C+2Q1O|1|D (2Q1O)
  • RNA (5'-R(*CP*GP*CP*(NF2)P*AP*AP*UP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H, L; model(s): 1
1.1 Å11(2) 2Q1O|1|C+2Q1O|1|D, 2Q1O|1|A+2Q1O|1|B
321NR_3.0_17726.1
Exact match
2Q1R|1|A (2Q1R)
  • RNA (5'-R(*CP*GP*CP*GP*AP*AP*UP*UP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å12(2) 2Q1R|1|A, 157D|1|A+157D|1|B
322NR_3.0_40252.1
Exact match
2QUS|1|B (2QUS)
  • Hammerhead ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å68(2) 2QUS|1|B, 2QUS|1|A
323NR_3.0_36634.1
Exact match
2QUW|1|B (2QUW)
  • Hammerhead ribozyme, cleaved fragment
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å57(2) 2QUW|1|B, 2QUW|1|D
324NR_3.0_33592.3
Exact match
2TMV|1|R (2TMV)
  • RNA (5'-R(P*GP*AP*A)-3')
  • FIBER DIFFRACTION
  • Chain(s): R; model(s): 1
2.9 Å3(2) 2TMV|1|R, 1RMV|1|B
325NR_3.0_03697.3
Exact match
Thermus thermophilus
2UUA|1|Y+2UUA|1|X (2UUA)
  • 5'-R(*CP*CP*UP*CP*CP*CP*UP*CM0P*AP*CP*6M[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, H, L, X, Y; model(s): 1
2.9 Å11(2) 2UUA|1|Y+2UUA|1|X, 2UUB|1|Y+2UUB|1|X
326NR_3.0_36129.1
Exact match
Escherichia coli
2VAL|1|B+2VAL|1|D (2VAL)
  • 5'-R(*GP*CP*GP*GP*GP*AP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, D, H, L; model(s): 1
2.0 Å7(2) 2VAL|1|B+2VAL|1|D, 2VAL|1|A+2VAL|1|C
327NR_3.0_16324.1
Exact match
Homo sapiens
2VOD|1|D (2VOD)
  • 5'-R(*AP*UP*AP*UP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.1 Å7(2) 2VOD|1|D, 2VOD|1|C
328NR_3.0_71707.1
Exact match
Homo sapiens
2VON|1|D (2VON)
  • 5'-R(*AP*UP*AP*AP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.1 Å7(2) 2VON|1|D, 2VON|1|C
329NR_3.0_25856.1
Exact match
Homo sapiens
2VOO|1|D (2VOO)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.8 Å3(2) 2VOO|1|D, 2VOO|1|C
330NR_3.0_09706.1
Exact match
Methanocaldococcus jannaschii
2VPL|1|B (2VPL)
  • FRAGMENT OF MRNA FOR L1-OPERON CONTAININ[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å48(2) 2VPL|1|B, 2VPL|1|D
331NR_3.0_60790.1
Exact match
Thermus thermophilus
2VQE|1|Y+2VQE|1|X (2VQE)
  • 5'-R(*GP*CP*AP*UP*GP*CP*UP*TM2P*AP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, H, L, X, Y; model(s): 1
2.5 Å6(2) 2VQE|1|Y+2VQE|1|X, 2VQF|1|Y+2VQF|1|X
332NR_3.0_97569.1
Exact match
Escherichia coli
2W89|1|C+2W89|1|D (2W89)
  • 5'-R(*GP*CP*AP*UP*CP*CP*GP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H, L; model(s): 1
2.0 Å7(2) 2W89|1|C+2W89|1|D, 2W89|1|A+2W89|1|B
333NR_3.0_28594.1
Exact match
2X1F|1|B (2X1F)
  • 5'-R(*GP*UP*UP*GP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.6 Å2(2) 2X1F|1|B, 2X1A|1|B
334NR_3.0_44600.1
Exact match
Mus musculus
2XS5|1|D (2XS5)
  • 5'-R(*UP*GP*UP*UP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.6 Å5(2) 2XS5|1|D, 2XS5|1|C
335NR_3.0_17264.1
Exact match
Thermus thermophilus
2XSL|1|C+2XSL|1|D (2XSL)
  • 5'-R(*GP*CP*GP*GP*GP*AP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H, L; model(s): 1
1.6 Å7(2) 2XSL|1|C+2XSL|1|D, 2XSL|1|A+2XSL|1|B
336NR_3.0_72322.1
Exact match
2Y9H|1|F (2Y9H)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.5 Å18(2) 2Y9H|1|F, 2Y9H|1|B
337NR_3.0_24738.1
Exact match
2Y9H|1|H (2Y9H)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.5 Å18(2) 2Y9H|1|H, 2Y9H|1|D
338NR_3.0_46586.1
Exact match
2Y9H|1|L (2Y9H)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
2.5 Å18(2) 2Y9H|1|L, 2Y9H|1|J
339NR_3.0_15533.1
Exact match
2Y9H|1|N (2Y9H)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): N; model(s): 1
2.5 Å17(2) 2Y9H|1|N, 2Y9H|1|P
340NR_3.0_73930.1
Exact match
synthetic construct
2YJY|1|D (2YJY)
  • 5'-R(*AP*UP*UP*GP*CP*AP*UP*AP*UP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.6 Å10(2) 2YJY|1|D, 2YJY|1|C
341NR_3.0_65284.1
Exact match
2ZUE|1|B (2ZUE)
  • tRNA-Arg
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å77(2) 2ZUE|1|B, 2ZUF|1|B
342NR_3.0_90969.1
Exact match
2ZZN|1|D (2ZZN)
  • RNA (71-MER)
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å71(2) 2ZZN|1|D, 2ZZN|1|C
343NR_3.0_70871.1
Exact match
377D|1|C+377D|1|D (377D)
  • RNA-DNA (5'-R(*CP*GP*UP*AP*CP*DG)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H, L; model(s): 1
1.8 Å5(2) 377D|1|C+377D|1|D, 377D|1|A+377D|1|B
344NR_3.0_34492.3
Exact match
398D|1|C (398D)
  • RNA (5'-R(*GP*CP*AP*GP*UP*GP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.9 Å8(2) 398D|1|C, 398D|1|A
345NR_3.0_30596.1
Exact match
3A6P|1|J+3A6P|1|I (3A6P)
  • pre-microRNA
  • X-RAY DIFFRACTION
  • Chain(s): D, H, I, J, L; model(s): 1
2.9 Å24(2) 3A6P|1|J+3A6P|1|I, 3A6P|1|E+3A6P|1|D
346NR_3.0_23187.1
Exact match
3AGV|1|S (3AGV)
  • 5'-R(*GP*GP*AP*GP*GP*(UFT)P*GP*(CFZ)P*(U[...]
  • X-RAY DIFFRACTION
  • Chain(s): S; model(s): 1
2.2 Å10(2) 3AGV|1|S, 3AGV|1|U
347NR_3.0_35987.1
Exact match
Thermus thermophilus
3B0U|1|B (3B0U)
  • RNA (5'-R(*GP*GP*(H2U)P*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å3(2) 3B0U|1|B, 3B0U|1|A
348NR_3.0_91544.1
Exact match
3BSX|1|D (3BSX)
  • 5'-R(*UP*UP*GP*UP*AP*AP*UP*AP*UP*UP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.3 Å9(2) 3BSX|1|D, 3BSX|1|C
349NR_3.0_51674.1
Exact match
3BT7|1|D (3BT7)
  • RNA (5'-D(P*GP*CP*UP*GP*UP*GP*(5MU)P*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å18(2) 3BT7|1|D, 3BT7|1|C
350NR_3.0_27661.1
Exact match
3BX2|1|D (3BX2)
  • HO endonuclease 3' UTR binding sequence
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.8 Å9(2) 3BX2|1|D, 3BX2|1|C
351NR_3.0_95803.1
Exact match
3BX3|1|D (3BX3)
  • COX17 RNA target sequence
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å8(2) 3BX3|1|D, 3BX3|1|C
352NR_3.0_22223.1
Exact match
3CGP|1|B+3CGP|1|A (3CGP)
  • RNA (5'-R(*CP*GP*CP*UP*AP*CP*UP*AP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H, L; model(s): 1
1.6 Å13(2) 3CGP|1|B+3CGP|1|A, 3CGQ|1|B+3CGQ|1|A
353NR_3.0_13929.1
Exact match
3CR1|1|A (3CR1)
  • RNA (5'-R(*UP*CP*CP*CP*(A2M)P*GP*UP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å13(2) 3CR1|1|A, 3CQS|1|A
354NR_3.0_67685.1
Exact match
3D2S|1|G (3D2S)
  • 5'-R(*CP*GP*CP*UP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
1.7 Å6(2) 3D2S|1|G, 3D2S|1|E
355NR_3.0_35553.1
Exact match
3D2S|1|H (3D2S)
  • 5'-R(*CP*GP*CP*UP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
1.7 Å5(2) 3D2S|1|H, 3D2S|1|F
356NR_3.0_45040.1
Exact match
3EPH|1|E (3EPH)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.0 Å69(2) 3EPH|1|E, 3EPH|1|F
357NR_3.0_47203.1
Exact match
3F2Q|1|X (3F2Q)
  • FMN riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.0 Å107(2) 3F2Q|1|X, 3F2T|1|X
358NR_3.0_79282.1
Exact match
3FTM|1|D+3FTM|1|C (3FTM)
  • 5'-R(*CP*CP*AP*GP*UP*CP*GP*GP*AP*AP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H, L; model(s): 1
2.7 Å12(2) 3FTM|1|D+3FTM|1|C, 3FTM|1|B+3FTM|1|A
359NR_3.0_25125.1
Exact match
3GM7|1|G+3GM7|1|H (3GM7)
  • 5'-R(*CP*UP*GP*CP*UP*GP*CP*UP*GP*CP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, G, H, L; model(s): 1
1.6 Å18(2) 3GM7|1|G+3GM7|1|H, 1ZEV|1|A+1ZEV|1|B
360NR_3.0_12080.1
Exact match
3HGA|1|X (3HGA)
  • 5'-R(*UP*(US5)P*CP*GP*CP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
1.3 Å5(2) 3HGA|1|X, 1OSU|1|A
361NR_3.0_66484.2
Exact match
3HHN|1|E (3HHN)
  • Class I ligase ribozyme, self-ligation p[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.0 Å136(2) 3HHN|1|E, 3HHN|1|C
362NR_3.0_66984.1
Exact match
Bacillus subtilis
3IVN|1|B (3IVN)
  • A-riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å69(2) 3IVN|1|B, 3IVN|1|A
363NR_3.0_84036.1
Exact match
3K5Y|1|B (3K5Y)
  • 5'-R(*UP*GP*UP*GP*CP*CP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å9(2) 3K5Y|1|B, 3QGB|1|B
364NR_3.0_34992.1
Exact match
3L25|1|C+3L25|1|F (3L25)
  • RNA (5'-R(*CP*GP*CP*AP*UP*GP*CP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, H, L; model(s): 1
2.0 Å8(2) 3L25|1|C+3L25|1|F, 3L26|1|C
365NR_3.0_46231.1
Exact match
Pyrococcus furiosus
3NMU|1|D+3NMU|1|I (3NMU)
  • RNA (34-MER)
  • X-RAY DIFFRACTION
  • Chain(s): D, H, I, L; model(s): 1
2.7 Å34(2) 3NMU|1|D+3NMU|1|I, 3NMU|1|E+3NMU|1|K
366NR_3.0_50588.1
Exact match
Pyrococcus furiosus
3NVI|1|F (3NVI)
  • RNA (5'-R(*CP*UP*CP*UP*GP*AP*CP*CP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.7 Å24(2) 3NVI|1|F, 3NVI|1|E
367NR_3.0_61988.1
Exact match
3OG8|1|C+3OG8|1|D (3OG8)
  • RNA (5'-R(*GP*GP*CP*GP*CP*GP*CP*GP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H, L; model(s): 1
2.4 Å14(2) 3OG8|1|C+3OG8|1|D, 3LRN|1|C+3LRN|1|D
368NR_3.0_97537.1
Exact match
3P4D|1|B (3P4D)
  • 5'-R(*(CFZ)P*CP*(CFZ)P*CP*(GF2)P*GP*(GF2[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å4(2) 3P4D|1|B, 3P4D|1|A
369NR_3.0_08738.1
Exact match
3Q0P|1|D (3Q0P)
  • 5'-R(UP*GP*UP*AP*UP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.6 Å8(2) 3Q0P|1|D, 3Q0P|1|C
370NR_3.0_98055.1
Exact match
3Q0S|1|B (3Q0S)
  • 5'-R(UP*GP*UP*AP*CP*AP*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å8(2) 3Q0S|1|B, 3Q0N|1|C
371NR_3.0_65073.1
Exact match
Clostridium acetobutylicum
3Q3Z|1|V (3Q3Z)
  • c-di-GMP-II riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): V; model(s): 1
2.5 Å74(2) 3Q3Z|1|V, 3Q3Z|1|A
372NR_3.0_10014.1
Exact match
3QGC|1|B (3QGC)
  • 5'-R(*UP*GP*UP*GP*CP*CP*UP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å9(2) 3QGC|1|B, 3QG9|1|B
373NR_3.0_34288.1
Exact match
3QJL|1|X (3QJL)
  • RNA (5'-R(*GP*UP*UP*AP*CP*AP*AP*UP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.7 Å12(2) 3QJL|1|X, 3QJL|1|R
374NR_3.0_40400.1
Exact match
3QSU|1|R (3QSU)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.2 Å4(2) 3QSU|1|R, 3QSU|1|P
375NR_3.0_95407.1
Exact match
3R1D|1|C+3R1D|1|D (3R1D)
  • RNA (5'-R(*GP*CP*(GRB)P*GP*CP*GP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H, L; model(s): 1
1.5 Å16(2) 3R1D|1|C+3R1D|1|D, 3R1D|1|A+3R1D|1|B
376NR_3.0_86424.1
Exact match
Aquifex aeolicus
3R2C|1|S (3R2C)
  • 5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): S; model(s): 1
1.9 Å10(2) 3R2C|1|S, 3R2C|1|R
377NR_3.0_07663.1
Exact match
3RER|1|K (3RER)
  • 5'-R(*AP*UP*UP*UP*UP*UP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): K; model(s): 1
1.7 Å8(2) 3RER|1|K, 4HT9|1|E
378NR_3.0_57598.2
Exact match
Mus musculus
3RG5|1|B (3RG5)
  • tRNA(Sec)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å86(2) 3RG5|1|B, 3RG5|1|A
379NR_3.0_76909.1
Exact match
3RW6|1|H (3RW6)
  • constitutive transport element(CTE)of Ma[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.3 Å60(2) 3RW6|1|H, 3RW6|1|F
380NR_3.0_14513.1
Exact match
Homo sapiens
3SIU|1|F (3SIU)
  • U4atac snRNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.6 Å28(2) 3SIU|1|F, 3SIU|1|C
381NR_3.0_53881.1
Exact match
3SNP|1|D (3SNP)
  • ferritin H IRE RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.8 Å30(2) 3SNP|1|D, 3SNP|1|C
382NR_3.0_51156.1
Exact match
3SQW|1|B (3SQW)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å8(2) 3SQW|1|B, 3SQX|1|B
383NR_3.0_20814.1
Exact match
[Eubacterium] siraeum
3SUX|1|X (3SUX)
  • Riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.9 Å100(2) 3SUX|1|X, 3SUH|1|X
384NR_3.0_61644.1
Exact match
3T1Y|1|X+3T1Y|1|W (3T1Y)
  • tRNA ASL human Lys3
  • X-RAY DIFFRACTION
  • Chain(s): D, H, L, W, X; model(s): 1
2.8 Å8(2) 3T1Y|1|X+3T1Y|1|W, 1XMQ|1|X+1XMQ|1|W
385NR_3.0_47433.1
Exact match
Caldanaerobacter subterraneus
3V7E|1|C (3V7E)
  • SAM-I riboswitch aptamer with an enginee[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å126(2) 3V7E|1|C, 3V7E|1|D
386NR_3.0_45693.1
Exact match
3VJR|1|D (3VJR)
  • tRNA CCA-acceptor
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å36(2) 3VJR|1|D, 3VJR|1|B
387NR_3.0_68126.1
Exact match
420D|1|A+420D|1|B (420D)
  • RNA (5'-R(*GP*CP*AP*GP*AP*GP*UP*UP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H, L; model(s): 1
1.9 Å16(2) 420D|1|A+420D|1|B, 2H1M|1|A+2H1M|1|B
388NR_3.0_08327.1
Exact match
435D|1|C+435D|1|D (435D)
  • RNA (5'-R(*UP*AP*GP*CP*CP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H, L; model(s): 1
1.4 Å7(2) 435D|1|C+435D|1|D, 435D|1|A+435D|1|B
389NR_3.0_06402.1
Exact match
Pseudomonas aeruginosa
4AL7|1|B (4AL7)
  • 5'-R(*CP*UP*GP*CP*CP*GP*UP*AP*UP*AP*GP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å15(2) 4AL7|1|B, 4AL5|1|B
390NR_3.0_23939.1
Exact match
Kneallhazia solenopsae
4C4W|1|H (4C4W)
  • TSKT-23
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.0 Å35(2) 4C4W|1|H, 4C4W|1|D
391NR_3.0_88374.1
Exact match
Thermus thermophilus
4C9D|1|C (4C9D)
  • R3 REPEAT RNA CLEAVAGE PRODUCT
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.0 Å12(2) 4C9D|1|C, 4C9D|1|D
392NR_3.0_67355.1
Exact match
Haloarcula marismortui
4CS1|1|A (4CS1)
  • 5'-(*GP*GP*CP*GP*AP*AP*GP*AP*AP*CP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å19(2) 4CS1|1|A, 4C40|1|A
393NR_3.0_68928.1
Exact match
Bombyx mori
4D25|1|D (4D25)
  • 5'-R(*UP*GP*AP*CP*AP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.9 Å6(2) 4D25|1|D, 4D26|1|D
394NR_3.0_06694.1
Exact match
4ED5|1|D (4ED5)
  • 5'-R(*A*UP*UP*UP*UP*UP*AP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.0 Å10(2) 4ED5|1|D, 4ED5|1|C
395NR_3.0_68289.1
Exact match
4F02|1|E (4F02)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.0 Å9(2) 4F02|1|E, 4F02|1|B
396NR_3.0_01779.1
Exact match
marine metagenome
4FRG|1|B (4FRG)
  • cobalamin riboswitch aptamer domain
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å84(2) 4FRG|1|B, 4FRG|1|X
397NR_3.0_49582.1
Exact match
4FXD|1|F (4FXD)
  • RNA (5'-R(*AP*GP*GP*CP*GP*GP*GP*CP*AP*G)[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.0 Å8(2) 4FXD|1|F, 4FXD|1|E
398NR_3.0_04288.1
Exact match
4G7O|1|S (4G7O)
  • 5'-R(*GP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): S; model(s): 1
3.0 Å2(2) 4G7O|1|S, 4G7O|1|I
399NR_3.0_79184.1
Exact match
4GCW|1|B (4GCW)
  • TRNA(THR)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å53(2) 4GCW|1|B, 2FK6|1|R
400NR_3.0_00536.1
Exact match
4GHL|1|F (4GHL)
  • short palindromic RNA AGACAGCAUAUGCUGUCU
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.0 Å18(2) 4GHL|1|F, 4GHL|1|E
401NR_3.0_00747.1
Exact match
4H5P|1|F (4H5P)
  • 28-mer poly(U) RNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.2 Å14(2) 4H5P|1|F, 4H5P|1|E
402NR_3.0_31263.1
Exact match
4ILL|1|C (4ILL)
  • RNA (5'-R(*GP*CP*UP*AP*AP*UP*CP*UP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.5 Å17(2) 4ILL|1|C, 4ILL|1|R
403NR_3.0_93859.1
Exact match
4J39|1|B (4J39)
  • 5'-R(P*CP*AP*GP*CP*AP*GP*CP*AP*GP*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.7 Å21(2) 4J39|1|B, 4J5V|1|B
404NR_3.0_40086.1
Exact match
4JGN|1|E (4JGN)
  • 5'-R(P*UP*UP*GP*CP*UP*GP*CP*UP*GP*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.9 Å20(2) 4JGN|1|E, 4JK0|1|B
405NR_3.0_26186.1
Exact match
4JRC|1|B (4JRC)
  • Distal Stem I region of the glyQS T box [...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å56(2) 4JRC|1|B, 4JRC|1|A
406NR_3.0_76613.1
Exact match
4JRD|1|B (4JRD)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.0 Å11(2) 4JRD|1|B, 4JRD|1|A
407NR_3.0_40895.1
Exact match
4JVY|1|F (4JVY)
  • RNA (5'-R(P*CP*UP*AP*AP*CP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.9 Å8(2) 4JVY|1|F, 4JVY|1|D
408NR_3.0_28348.1
Exact match
synthetic construct
4JXZ|1|B (4JXZ)
  • RNA (71-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å71(2) 4JXZ|1|B, 4JYZ|1|B
409NR_3.0_96460.1
Exact match
4JZU|1|C (4JZU)
  • RNA (5'-R(*(GCP)P*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.7 Å1(2) 4JZU|1|C, 4JZV|1|C
410NR_3.0_33790.1
Exact match
4K4U|1|F+4K4U|1|G+4K4U|1|H (4K4U)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, F, G, H; model(s): 1
2.9 Å19(2) 4K4U|1|F+4K4U|1|G+4K4U|1|H, 4K4U|1|B+4K4U|1|C+4K4U|1|D
411NR_3.0_31084.1
Exact match
4K4V|1|F (4K4V)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.6 Å13(2) 4K4V|1|F, 4K4V|1|B
412NR_3.0_41922.1
Exact match
4KTG|1|E (4KTG)
  • 5'-R(P*GP*CP*GP*GP*CP*GP*GP*CP*GP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.9 Å21(2) 4KTG|1|E, 4KTG|1|B
413NR_3.0_73445.1
Exact match
Vibrio vulnificus
4LX6|1|A (4LX6)
  • Mutated adenine riboswitch aptamer
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.2 Å71(2) 4LX6|1|A, 4LX5|1|A
414NR_3.0_55785.1
Exact match
4M59|1|C (4M59)
  • psaJ RNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.5 Å14(2) 4M59|1|C, 4OE1|1|C
415NR_3.0_27182.1
Exact match
4M59|1|D (4M59)
  • psaJ RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.5 Å18(2) 4M59|1|D, 4OE1|1|D
416NR_3.0_17764.1
Exact match
4M7A|1|P (4M7A)
  • U6 snRNA
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.8 Å5(2) 4M7A|1|P, 4M7A|1|O
417NR_3.0_42085.1
Exact match
4M7D|1|P (4M7D)
  • U6 snRNA
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.6 Å4(2) 4M7D|1|P, 4M7D|1|O
418NR_3.0_98303.1
Exact match
4N48|1|G (4N48)
  • capped RNA
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.7 Å4(2) 4N48|1|G, 4N48|1|D
419NR_3.0_47933.1
Exact match
4NGD|1|B (4NGD)
  • 5'-R(P*GP*CP*GP*AP*AP*UP*UP*CP*GP*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å12(2) 4NGD|1|B, 4NGB|1|B
420NR_3.0_48777.1
Exact match
4NKU|1|H (4NKU)
  • 5'-R(*AP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
1.9 Å2(2) 4NKU|1|H, 4NKU|1|D
421NR_3.0_11458.2
Exact match
Oryzias latipes
4O26|1|E (4O26)
  • Telomerase TR
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.0 Å47(2) 4O26|1|E, 4O26|1|F
422NR_3.0_56235.1
Exact match
4O41|1|C+4O41|1|D (4O41)
  • AMIDE LINKED RNA
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H; model(s): 1
1.2 Å10(2) 4O41|1|C+4O41|1|D, 4O41|1|B+4O41|1|A
423NR_3.0_41964.1
Exact match
4O8J|1|E (4O8J)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.0 Å6(2) 4O8J|1|E, 4O8J|1|D
424NR_3.0_47021.1
Exact match
Homo sapiens
4OLA|1|B (4OLA)
  • 5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å10(2) 4OLA|1|B, 4OLB|1|B
425NR_3.0_43274.1
Exact match
Senecavirus A
4P97|1|C+4P97|1|D (4P97)
  • RNA (5'-R(*CP*GP*UP*CP*UP*AP*CP*CP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H; model(s): 1
1.9 Å16(2) 4P97|1|C+4P97|1|D, 4P97|1|A+4P97|1|B
426NR_3.0_57460.1
Exact match
Didymium iridis
4P9R|1|A (4P9R)
  • RNA (189-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å191(2) 4P9R|1|A, 4P95|1|A
427NR_3.0_52610.1
Exact match
synthetic construct
4PCJ|1|A (4PCJ)
  • trCUG-3('5)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.9 Å34(2) 4PCJ|1|A, 4FNJ|1|A
428NR_3.0_13685.1
Exact match
unidentified
4PMW|1|D (4PMW)
  • U-U-U-U-U-U-U-U-U-U-U-U-U-U
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å14(2) 4PMW|1|D, 4PMW|1|C
429NR_3.0_73328.1
Exact match
4PWD|1|T (4PWD)
  • 5'-R(*AP*UP*GP*GP*UP*CP*GP*GP*CP*GP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
3.0 Å21(2) 4PWD|1|T, 4PWD|1|E
430NR_3.0_91665.3
Exact match
4Q5V|1|F (4Q5V)
  • RNA primer
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.5 Å10(2) 4Q5V|1|F, 4Q5V|1|B
431NR_3.0_61892.1
Exact match
4QIL|1|D (4QIL)
  • 5'-R(*CP*UP*CP*CP*CP*UP*UP*CP*UP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.9 Å16(2) 4QIL|1|D, 4QIL|1|C
432NR_3.0_53735.1
Exact match
Caldanaerobacter subterraneus
4QLM|1|A (4QLM)
  • RNA (108-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å108(2) 4QLM|1|A, 4QLN|1|A
433NR_3.0_75344.1
Exact match
4QM6|1|D (4QM6)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.5 Å7(2) 4QM6|1|D, 4QM6|1|C
434NR_3.0_29353.1
Exact match
4QQB|1|P (4QQB)
  • msl2 mRNA
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.8 Å17(2) 4QQB|1|P, 4QQB|1|C
435NR_3.0_77810.1
Exact match
4S2X|1|B (4S2X)
  • RNA (5'-R(*(APC)*GP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.5 Å2(2) 4S2X|1|B, 4S2Y|1|B
436NR_3.0_80828.1
Exact match
synthetic construct
4TS0|1|Y+4TS0|1|X (4TS0)
  • Spinach RNA aptamer, bimolecular constru[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, H, X, Y; model(s): 1
2.8 Å46(2) 4TS0|1|Y+4TS0|1|X, 4TS2|1|Y+4TS2|1|X
437NR_3.0_63520.1
Exact match
synthetic construct
4TU0|1|G (4TU0)
  • 2'-5' OLIGOADENYLATE TRIMER
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.3 Å2(2) 4TU0|1|G, 4TU0|1|F
438NR_3.0_39792.1
Exact match
Escherichia coli
4U7U|1|X (4U7U)
  • crRNA
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.0 Å61(2) 4U7U|1|X, 4U7U|1|L
439NR_3.0_40540.1
Exact match
Escherichia coli
4V8B|1|AB (4V8B)
  • TRNA-LEU
  • X-RAY DIFFRACTION
  • Chain(s): AB; model(s): 1
3.0 Å87(2) 4V8B|1|AB, 4V8B|1|CB
440NR_3.0_97864.1
Exact match
synthetic construct
4WTD|1|T+4WTD|1|P (4WTD)
  • RNA PRIMER TEMPLATE AUAAAUUU
  • X-RAY DIFFRACTION
  • Chain(s): D, H, P, T; model(s): 1
2.7 Å8(2) 4WTD|1|T+4WTD|1|P, 5UJ2|1|T+5UJ2|1|P
441NR_3.0_48352.1
Exact match
Actinomyces odontolyticus
4XWF|1|A (4XWF)
  • pfl RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.8 Å64(2) 4XWF|1|A, 4XW7|1|A
442NR_3.0_83641.1
Exact match
Escherichia coli
4Y1M|1|B (4Y1M)
  • E. coli yybP-ykoY riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å107(2) 4Y1M|1|B, 4Y1M|1|A
443NR_3.0_39569.1
Exact match
Saccharomyces cerevisiae
4YYE|1|D (4YYE)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.3 Å74(2) 4YYE|1|D, 4YYE|1|C
444NR_3.0_98573.1
Exact match
synthetic construct
4Z0C|1|C (4Z0C)
  • DNA (5'-R(P*AP*CP*GP*GP*AP*AP*AP*GP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.3 Å13(2) 4Z0C|1|C, 4Z0C|1|B
445NR_3.0_80882.1
Exact match
Homo sapiens
4Z31|1|F (4Z31)
  • RNA (5'-R(*A)-D(P*UP*GP*UP*UP*CP*UP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.5 Å15(2) 4Z31|1|F, 4Z31|1|E
446NR_3.0_45659.1
Exact match
synthetic construct
4ZNP|1|A (4ZNP)
  • pfI Riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å73(2) 4ZNP|1|A, 4ZNP|1|B
447NR_3.0_65123.1
Exact match
Streptococcus pyogenes
4ZT0|1|D (4ZT0)
  • single-guide RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.9 Å72(2) 4ZT0|1|D, 4ZT0|1|B
448NR_3.0_86148.1
Exact match
Escherichia coli
5A0T|1|F (5A0T)
  • 5'-R(*CP*GP*CP*CP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.3 Å6(2) 5A0T|1|F, 5A0T|1|E
449NR_3.0_60836.1
Exact match
Streptomyces coelicolor
5A0V|1|F (5A0V)
  • 5'-R(*CP*GP*CP*CP*UP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.8 Å6(2) 5A0V|1|F, 5A0V|1|E
450NR_3.0_09775.1
Exact match
Agrobacterium tumefaciens
5AH5|1|C (5AH5)
  • TRNA-LEU TAA ISOACCEPTOR
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.1 Å80(2) 5AH5|1|C, 5AH5|1|D
451NR_3.0_52445.1
Exact match
California encephalitis orthobunyavirus
5AMR|1|B+5AMR|1|C (5AMR)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, H; model(s): 1
2.6 Å16(2) 5AMR|1|B+5AMR|1|C, 5AMQ|1|B+5AMQ|1|c
452NR_3.0_31135.1
Exact match
synthetic construct
5AOR|1|D (5AOR)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.1 Å10(2) 5AOR|1|D, 5AOR|1|C
453NR_3.0_59099.1
Exact match
synthetic construct
5AOX|1|C (5AOX)
  • ALU JO CONSENSUS RNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.0 Å86(2) 5AOX|1|C, 5AOX|1|F
454NR_3.0_43992.1
Exact match
synthetic construct
5AWH|1|E (5AWH)
  • RNA (5'-D(P*UP*UP*AP*CP*AP*AP*CP*CP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.0 Å18(2) 5AWH|1|E, 5AWH|1|C
455NR_3.0_90160.3
Exact match
synthetic construct
5B2Q|1|B (5B2Q)
  • Guide RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.7 Å93(2) 5B2Q|1|B, 5B2O|1|B
456NR_3.0_63919.1
Exact match
Geobacillus stearothermophilus
5B63|1|B (5B63)
  • tRNA-Arg
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å63(2) 5B63|1|B, 5B63|1|D
457NR_3.0_74260.1
Exact match
Homo sapiens
5BTM|1|A (5BTM)
  • RNA (55-mer)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å43(2) 5BTM|1|A, 5BTM|1|B
458NR_3.0_76901.1
Exact match
synthetic construct
5BTP|1|A (5BTP)
  • RNA (62-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å62(2) 5BTP|1|A, 5BTP|1|B
459NR_3.0_74556.1
Exact match
synthetic construct
5BZV|1|B (5BZV)
  • RNA (5'-R(*UP*GP*UP*AP*CP*UP*AP*UP*A)-3'[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å9(2) 5BZV|1|B, 5BYM|1|C
460NR_3.0_72172.1
Exact match
Homo sapiens
5CCB|1|N (5CCB)
  • tRNA3Lys
  • X-RAY DIFFRACTION
  • Chain(s): N; model(s): 1
2.0 Å78(2) 5CCB|1|N, 5CCX|1|N
461NR_3.0_56975.1
Exact match
synthetic construct
5CKK|1|D (5CKK)
  • RNA (5'-R(P*GP*CP*AP*CP*UP*AP*GP*AP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.8 Å15(2) 5CKK|1|D, 5CKI|1|D
462NR_3.0_02070.1
Exact match
Senecavirus A
5CNR|1|E+5CNR|1|F (5CNR)
  • RNA (5'-R(*GP*UP*CP*UP*AP*CP*CP*CP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, H; model(s): 1
2.6 Å16(2) 5CNR|1|E+5CNR|1|F, 5CNR|1|A+5CNR|1|B
463NR_3.0_96162.1
Exact match
Staphylococcus aureus
5CZZ|1|B (5CZZ)
  • RNA (73-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å73(2) 5CZZ|1|B, 5AXW|1|B
464NR_3.0_79481.1
Exact match
Trypanosoma brucei
5DA6|1|A (5DA6)
  • RNA (32-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å36(2) 5DA6|1|A, 4RBQ|1|A
465NR_3.0_70098.1
Exact match
synthetic construct
5DEA|1|A (5DEA)
  • sc1
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å35(2) 5DEA|1|A, 5DE5|1|A
466NR_3.0_02963.1
Exact match
synthetic construct
5DEA|1|C (5DEA)
  • sc1
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å35(2) 5DEA|1|C, 5DE5|1|C
467NR_3.0_06496.1
Exact match
Homo sapiens
5E6M|1|E (5E6M)
  • tRNA(Gly)
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.9 Å73(2) 5E6M|1|E, 5E6M|1|C
468NR_3.0_32332.1
Exact match
Thermus thermophilus
5E81|1|3L (5E81)
  • tRNA-Lys
  • X-RAY DIFFRACTION
  • Chain(s): 3L; model(s): 1
3.0 Å72(2) 5E81|1|3L, 5E81|1|3K
469NR_3.0_54107.1
Exact match
Saccharomyces cerevisiae
5ED1|1|C+5ED1|1|B (5ED1)
  • RNA (5'-R(*GP*AP*CP*UP*GP*AP*AP*CP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, H; model(s): 1
2.8 Å23(2) 5ED1|1|C+5ED1|1|B, 5HP2|1|C+5HP2|1|B
470NR_3.0_45605.1
Exact match
Homo sapiens
5ED2|1|F+5ED2|1|E (5ED2)
  • RNA (5'-R(P*CP*AP*GP*AP*GP*CP*CP*CP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, H; model(s): 1
3.0 Å23(2) 5ED2|1|F+5ED2|1|E, 5ED2|1|C+5ED2|1|B
471NR_3.0_00179.1
Exact match
synthetic construct
5EIM|1|D (5EIM)
  • RNA (5'-R(*AP*UP*UP*AP*AP*AP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.5 Å8(2) 5EIM|1|D, 5EIM|1|C
472NR_3.0_09020.1
Exact match
synthetic construct
5ELT|1|F (5ELT)
  • RNA (5'-R(P*UP*AP*AP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.1 Å4(2) 5ELT|1|F, 5ELT|1|E
473NR_3.0_30433.1
Exact match
Homo sapiens
5EW4|1|B+5EW4|1|A (5EW4)
  • RNA (5'-R(*CP*CP*CP*CP*GP*GP*CP*CP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.5 Å21(2) 5EW4|1|B+5EW4|1|A, 5EW7|1|B+5EW7|1|A
474NR_3.0_86832.1
Exact match
Haloarcula marismortui
5FJ0|1|C (5FJ0)
  • HMKT-7
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.2 Å19(2) 5FJ0|1|C, 5FJ0|1|A+5FJ0|1|B
475NR_3.0_70895.1
Exact match
Haloarcula marismortui
5FJ4|1|H (5FJ4)
  • HMKT-7
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.0 Å35(2) 5FJ4|1|H, 5FJ4|1|D
476NR_3.0_86169.1
Exact match
synthetic construct
5HAB|1|D (5HAB)
  • RNA (5'-R(P*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.3 Å5(2) 5HAB|1|D, 5HAB|1|C
477NR_3.0_23118.1
Exact match
synthetic construct
5HBY|1|A (5HBY)
  • RNA (5'-R(*(LCC)P*(LCC)P*(LCC)P*(LCG)P*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.2 Å9(2) 5HBY|1|A, 5V0K|1|A
478NR_3.0_91027.1
Exact match
Mycobacterium tuberculosis
5HK0|1|F (5HK0)
  • RNA (5'-R(*AP*GP*UP*C)-D(P*U)-R(P*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.3 Å1(2) 5HK0|1|F, 5HK0|1|E
479NR_3.0_65615.1
Exact match
Escherichia coli
5HR6|1|C (5HR6)
  • tRNA Glu
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å68(2) 5HR6|1|C, 5HR6|1|D
480NR_3.0_42502.1
Exact match
Escherichia coli
5HR7|1|D (5HR7)
  • tRNA Glu
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å70(2) 5HR7|1|D, 5HR7|1|C
481NR_3.0_56203.1
Exact match
synthetic construct
5I4A|1|D (5I4A)
  • RNA (5'-R(*UP*AP*UP*AP*CP*AP*AP*CP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.0 Å13(2) 5I4A|1|D, 5I4A|1|B
482NR_3.0_07733.2
Exact match
Escherichia coli
5IB7|1|3L (5IB7)
  • tRNALys
  • X-RAY DIFFRACTION
  • Chain(s): 3L; model(s): 1
3.0 Å72(2) 5IB7|1|3L, 5IB7|1|3K
483NR_3.0_19209.1
Exact match
unidentified
5JAJ|1|X+5JAJ|1|Y (5JAJ)
  • RNA (5'-R(P*GP*GP*UP*AP*CP*GP*UP*AP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, H, X, Y; model(s): 1
1.5 Å13(2) 5JAJ|1|X+5JAJ|1|Y, 5JB2|1|X+5JB2|1|Y
484NR_3.0_80570.5
Exact match
synthetic construct
5JJU|1|C (5JJU)
  • RNA (5'-R(P*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.3 Å2(2) 5JJU|1|C, 4EJT|1|G
485NR_3.0_71651.1
Exact match
Saccharomyces cerevisiae
5K78|1|Y (5K78)
  • branch 1 of branched RNA 5'-UACUAA(2'-GU[...]
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.6 Å4(2) 5K78|1|Y, 5K78|1|X
486NR_3.0_33619.1
Exact match
Saccharomyces cerevisiae
5K78|1|y (5K78)
  • branch 2 of branched RNA 5'-UACUAA(2'-GU[...]
  • X-RAY DIFFRACTION
  • Chain(s): y; model(s): 1
2.6 Å5(2) 5K78|1|y, 5K78|1|x
487NR_3.0_23226.1
Exact match
metagenome
5KTJ|1|C (5KTJ)
  • Pistol (50-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.0 Å49(2) 5KTJ|1|C, 5KTJ|1|A
488NR_3.0_86088.1
Exact match
Homo sapiens
5LR4|1|C+5LR4|1|D (5LR4)
  • RNA (5'-R(*GP*(CBV)P*CP*GP*GP*(6MZ)P*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H; model(s): 1
1.8 Å8(2) 5LR4|1|C+5LR4|1|D, 5LR4|1|A+5LR4|1|B
489NR_3.0_96413.1
Exact match
Homo sapiens
5LR5|1|C+5LR5|1|D (5LR5)
  • RNA (5'-R(*GP*GP*(6MZ)P*CP*UP*AP*GP*UP*([...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H; model(s): 1
2.4 Å8(2) 5LR5|1|C+5LR5|1|D, 5LR5|1|A+5LR5|1|B
490NR_3.0_72335.1
Exact match
5MSF|1|R (5MSF)
  • 5'-R(*CP*CP*GP*GP*AP*GP*GP*AP*UP*CP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.8 Å18(2) 5MSF|1|R, 5MSF|1|S
491NR_3.0_36683.1
Exact match
Leishmania donovani
5T2A|1|A+5T2A|1|C (5T2A)
  • LSU-alpha
  • ELECTRON MICROSCOPY
  • Chain(s): A, C, D, H; model(s): 1
2.9 Å1603(2) 5T2A|1|A+5T2A|1|C, 3JCS|1|1+3JCS|1|7
492NR_3.0_69984.1
Exact match
Leishmania donovani
5T2A|1|D (5T2A)
  • 5S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
2.9 Å119(2) 5T2A|1|D, 3JCS|1|8
493NR_3.0_01258.1
Exact match
Leishmania donovani
5T2A|1|G (5T2A)
  • srRNA2
  • ELECTRON MICROSCOPY
  • Chain(s): G; model(s): 1
2.9 Å183(2) 5T2A|1|G, 3JCS|1|4
494NR_3.0_50424.1
Exact match
Alicyclobacillus acidoterrestris
5U31|1|B (5U31)
  • sgRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å99(2) 5U31|1|B, 5U30|1|B
495NR_3.0_93701.1
Exact match
synthetic construct
5V3F|1|A (5V3F)
  • RNA (31-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.7 Å31(2) 5V3F|1|A, 5V3F|1|B
496NR_3.0_60079.1
Exact match
Campylobacter jejuni
5X2G|1|B (5X2G)
  • sgRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å93(2) 5X2G|1|B, 5X2H|1|B
497NR_3.0_60411.1
Exact match
7MSF|1|R (7MSF)
  • 5'-R(*UP*CP*GP*CP*CP*AP*AP*CP*AP*GP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.8 Å14(2) 7MSF|1|R, 7MSF|1|S
498NR_3.0_00122.1
Exact match
165D|1|A+165D|1|B (165D)
  • DNA/RNA (5'-R(*GP*CP*UP*UP*CP*GP*GP*CP*)[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.6 Å8(1) 165D|1|A+165D|1|B
499NR_3.0_76648.1
Exact match
1AV6|1|B (1AV6)
  • RNA (5'-R(*GP*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å6(1) 1AV6|1|B
500NR_3.0_34221.1
Exact match
Escherichia coli
1B23|1|R (1B23)
  • CYSTEINYL TRNA
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.6 Å66(1) 1B23|1|R
501NR_3.0_61964.1
Exact match
1B7F|1|P (1B7F)
  • RNA (5'-R(P*GP*UP*UP*GP*UP*UP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.6 Å12(1) 1B7F|1|P
502NR_3.0_09952.1
Exact match
1B7F|1|Q (1B7F)
  • RNA (5'-R(P*GP*UP*UP*GP*UP*UP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
2.6 Å12(1) 1B7F|1|Q
503NR_3.0_11198.1
Exact match
1BMV|1|M (1BMV)
  • RNA (5'-R(*GP*GP*UP*CP*AP*AP*AP*AP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
3.0 Å11(1) 1BMV|1|M
504NR_3.0_10796.1
Exact match
1BR3|1|A (1BR3)
  • RNA (5'-R(*GP*GP*AP*CP*AP*GP*AP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å13(1) 1BR3|1|A
505NR_3.0_55702.1
Exact match
1C9S|1|W (1C9S)
  • SINGLE STRANDED RNA (55-MER)
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
1.9 Å55(1) 1C9S|1|W
506NR_3.0_53157.1
Exact match
1CSL|1|B+1CSL|1|A (1CSL)
  • 5'-R(*UP*CP*UP*GP*AP*CP*GP*GP*UP*AP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.6 Å15(1) 1CSL|1|B+1CSL|1|A
507NR_3.0_85902.1
Exact match
1CVJ|1|M (1CVJ)
  • 5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
2.6 Å9(1) 1CVJ|1|M
508NR_3.0_87059.1
Exact match
1CVJ|1|Q (1CVJ)
  • 5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
2.6 Å9(1) 1CVJ|1|Q
509NR_3.0_03657.1
Exact match
1DDL|1|D (1DDL)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.7 Å7(1) 1DDL|1|D
510NR_3.0_14136.1
Exact match
1DFU|1|M+1DFU|1|N (1DFU)
  • 5S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): D, H, M, N; model(s): 1
1.8 Å19(1) 1DFU|1|M+1DFU|1|N
511NR_3.0_14653.1
Exact match
1DQF|1|B+1DQF|1|A (1DQF)
  • RNA (5'-R(*CP*AP*GP*GP*GP*UP*CP*GP*GP*C)[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
2.2 Å10(1) 1DQF|1|B+1DQF|1|A
512NR_3.0_57060.1
Exact match
1DQH|1|B+1DQH|1|A (1DQH)
  • RNA (5'-R(*CP*AP*GP*GP*GP*UP*CP*GP*GP*C)[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.7 Å10(1) 1DQH|1|B+1DQH|1|A
513NR_3.0_99432.1
Exact match
1DUH|1|A (1DUH)
  • 4.5S RNA DOMAIN IV
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å44(1) 1DUH|1|A
514NR_3.0_94113.1
Exact match
1EC6|1|C (1EC6)
  • 20-MER RNA HAIRPIN
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.4 Å20(1) 1EC6|1|C
515NR_3.0_53294.1
Exact match
1EC6|1|D (1EC6)
  • 20-MER RNA HAIRPIN
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å20(1) 1EC6|1|D
516NR_3.0_73942.1
Exact match
1EFO|1|B (1EFO)
  • RNA (5'-R(*GP*AP*AP*GP*AP*GP*AP*GP*AP*G)[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å10(1) 1EFO|1|B
517NR_3.0_74421.1
Exact match
1F1T|1|A (1F1T)
  • MALACHITE GREEN APTAMER RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å33(1) 1F1T|1|A
518NR_3.0_16825.1
Exact match
1F27|1|A (1F27)
  • RNA (5'-R(*AP*CP*CP*GP*UP*CP*AP*GP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.3 Å19(1) 1F27|1|A
519NR_3.0_08337.1
Exact match
Pariacoto virus
1F8V|1|R (1F8V)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.0 Å25(1) 1F8V|1|R
520NR_3.0_92759.1
Exact match
1FIX|1|A (1FIX)
  • RNA (5'-R(*UP*UP*CP*GP*GP*GP*CP*GP*CP*C)[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å10(1) 1FIX|1|A
521NR_3.0_58357.1
Exact match
Thermus thermophilus
1FJG|1|X (1FJG)
  • FRAGMENT OF MESSENGER RNA
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.0 Å6(1) 1FJG|1|X
522NR_3.0_50004.1
Exact match
1FXL|1|B (1FXL)
  • 5'-R(P*UP*UP*UP*UP*AP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å9(1) 1FXL|1|B
523NR_3.0_13125.1
Exact match
1G1X|1|D+1G1X|1|E (1G1X)
  • 16S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): D, E, H; model(s): 1
2.6 Å40(1) 1G1X|1|D+1G1X|1|E
524NR_3.0_40657.1
Exact match
1G1X|1|J+1G1X|1|I (1G1X)
  • 16S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): D, H, I, J; model(s): 1
2.6 Å44(1) 1G1X|1|J+1G1X|1|I
525NR_3.0_88266.1
Exact match
1G2E|1|B (1G2E)
  • 5'-R(P*UP*AP*UP*UP*UP*AP*UP*UP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å10(1) 1G2E|1|B
526NR_3.0_36794.1
Exact match
1G2J|1|A (1G2J)
  • 5'-R(*CP*CP*CP*(PYY)P*GP*GP*GP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å7(1) 1G2J|1|A
527NR_3.0_84424.1
Exact match
1GTN|1|W (1GTN)
  • (GAGCC)11G 56-NUCLEOTIDE RNA
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
2.5 Å44(1) 1GTN|1|W
528NR_3.0_13221.1
Exact match
Thermus thermophilus
1H3E|1|B (1H3E)
  • WILD-TYPE TRNATYR(GUA)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å80(1) 1H3E|1|B
529NR_3.0_82681.1
Exact match
1HMH|1|A (1HMH)
  • HAMMERHEAD RIBOZYME-RNA STRAND
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.6 Å34(1) 1HMH|1|A
530NR_3.0_23180.1
Exact match
1HYS|1|E (1HYS)
  • 5'-R(*UP*CP*AP*GP*CP*CP*AP*CP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.0 Å23(1) 1HYS|1|E
531NR_3.0_16044.1
Exact match
1I9X|1|A+1I9X|1|B (1I9X)
  • 5'-R(*UP*AP*CP*UP*AP*AP*CP*GP*UP*AP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
2.2 Å13(1) 1I9X|1|A+1I9X|1|B
532NR_3.0_70420.1
Exact match
1J1U|1|B (1J1U)
  • tRNA(Tyr)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å74(1) 1J1U|1|B
533NR_3.0_26846.1
Exact match
1JBR|1|C+1JBR|1|F (1JBR)
  • 5'-R(*GP*CP*GP*CP*UP*CP*CP*UP*CP*AP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, H; model(s): 1
2.2 Å17(1) 1JBR|1|C+1JBR|1|F
534NR_3.0_26264.1
Exact match
1JID|1|B (1JID)
  • HELIX 6 OF HUMAN SRP RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å26(1) 1JID|1|B
535NR_3.0_64635.1
Exact match
1KD4|1|A+1KD4|1|B (1KD4)
  • 5'-R(*GP*GP*UP*CP*AP*CP*AP*GP*CP*CP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.9 Å11(1) 1KD4|1|A+1KD4|1|B
536NR_3.0_38877.1
Exact match
1KFO|1|A (1KFO)
  • 5'-R(*GP*AP*AP*UP*GP*CP*CP*UP*GP*CP*GP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.6 Å18(1) 1KFO|1|A
537NR_3.0_15417.1
Exact match
1KH6|1|A (1KH6)
  • JIIIabc
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å42(1) 1KH6|1|A
538NR_3.0_18162.1
Exact match
1KQ2|1|R (1KQ2)
  • 5'-R(*AP*UP*UP*UP*UP*UP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.7 Å7(1) 1KQ2|1|R
539NR_3.0_26998.1
Exact match
1KXK|1|A (1KXK)
  • ai5g group II Self-splicing intron
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å70(1) 1KXK|1|A
540NR_3.0_49785.2
Exact match
1L9A|1|B (1L9A)
  • signal recognition particle RNA S domain
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å125(1) 1L9A|1|B
541NR_3.0_32544.1
Exact match
1LNT|1|A+1LNT|1|B (1LNT)
  • 5'-R(*GP*CP*GP*UP*CP*AP*GP*GP*UP*CP*(CBV[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.7 Å11(1) 1LNT|1|A+1LNT|1|B
542NR_3.0_40126.1
Exact match
1M8W|1|E (1M8W)
  • 5'-R(P*UP*UP*GP*UP*CP*CP*AP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.2 Å8(1) 1M8W|1|E
543NR_3.0_93459.1
Exact match
1M8W|1|F (1M8W)
  • 5'-R(P*UP*GP*UP*CP*CP*AP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.2 Å7(1) 1M8W|1|F
544NR_3.0_78371.1
Exact match
1MDG|1|A (1MDG)
  • 5'-R(*UP*(BGM)GP*AP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.5 Å5(1) 1MDG|1|A
545NR_3.0_39003.1
Exact match
1MHK|1|L+1MHK|1|S (1MHK)
  • RNA 14-mer BCh12
  • X-RAY DIFFRACTION
  • Chain(s): D, H, L, S; model(s): 1
2.5 Å14(1) 1MHK|1|L+1MHK|1|S
546NR_3.0_99181.1
Exact match
1MSW|1|R (1MSW)
  • RNA message
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.1 Å10(1) 1MSW|1|R
547NR_3.0_46884.1
Exact match
1MZP|1|B (1MZP)
  • fragment of 23S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å55(1) 1MZP|1|B
548NR_3.0_92778.1
Exact match
1N1H|1|B (1N1H)
  • 5'-R(*AP*UP*UP*AP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å4(1) 1N1H|1|B
549NR_3.0_13358.1
Exact match
Thermus thermophilus
1N32|1|Y+1N32|1|Z (1N32)
  • ANTICODON STEM-LOOP OF LEU-2 TRANSFER RN[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, H, Y, Z; model(s): 1
3.0 Å14(1) 1N32|1|Y+1N32|1|Z
550NR_3.0_57770.1
Exact match
1N35|1|C+1N35|1|B (1N35)
  • 5'-R(*AP*UP*UP*AP*GP*CP*CP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, H; model(s): 1
2.5 Å8(1) 1N35|1|C+1N35|1|B
551NR_3.0_11290.1
Exact match
1N38|1|C+1N38|1|B (1N38)
  • 5'-R(*AP*UP*UP*AP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, H; model(s): 1
2.8 Å5(1) 1N38|1|C+1N38|1|B
552NR_3.0_10469.1
Exact match
1P79|1|A (1P79)
  • 5'-R(*UP*GP*UP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å5(1) 1P79|1|A
553NR_3.0_28964.1
Exact match
1PGL|1|3 (1PGL)
  • 5'-R(*AP*GP*UP*CP*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): 3; model(s): 1
2.8 Å6(1) 1PGL|1|3
554NR_3.0_30844.1
Exact match
1QC0|1|B+1QC0|1|A (1QC0)
  • 5'-R(GP*CP*AP*CP*CP*GP*CP*UP*AP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.6 Å10(1) 1QC0|1|B+1QC0|1|A
555NR_3.0_51076.1
Exact match
1QC0|1|C+1QC0|1|D (1QC0)
  • 5'-R(*GP*CP*AP*CP*CP*GP*UP*UP*GP*GP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H; model(s): 1
1.6 Å19(1) 1QC0|1|C+1QC0|1|D
556NR_3.0_23784.1
Exact match
1QCU|1|A+1QCU|1|B (1QCU)
  • 5'-R(P*GP*GP*GP*GP*GP*GP*GP*GP*GP*GP*G)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.2 Å11(1) 1QCU|1|A+1QCU|1|B
557NR_3.0_20366.1
Exact match
1QCU|1|C+1QCU|1|D (1QCU)
  • 5'-R(P*CP*CP*CP*CP*CP*CP*CP*CP*CP*CP*C)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H; model(s): 1
1.2 Å11(1) 1QCU|1|C+1QCU|1|D
558NR_3.0_85174.1
Exact match
Escherichia coli
1QF6|1|B (1QF6)
  • THREONINE TRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å69(1) 1QF6|1|B
559NR_3.0_27378.1
Exact match
1QLN|1|R (1QLN)
  • RNA (5- R(PPP*GP*GP*G)-3)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.4 Å2(1) 1QLN|1|R
560NR_3.0_22464.1
Exact match
1R3E|1|C (1R3E)
  • 5'-R(*CP*UP*GP*UP*GP*UP*(FHU)P*CP*GP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.1 Å16(1) 1R3E|1|C
561NR_3.0_43901.1
Exact match
1R3E|1|D+1R3E|1|E (1R3E)
  • 5'-R(*CP*UP*GP*UP*GP*UP*UP*CP*GP*AP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, E, H; model(s): 1
2.1 Å17(1) 1R3E|1|D+1R3E|1|E
562NR_3.0_01598.1
Exact match
1R9F|1|B (1R9F)
  • 5'-R(*CP*GP*UP*AP*CP*GP*CP*GP*GP*AP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å20(1) 1R9F|1|B
563NR_3.0_42973.1
Exact match
1R9F|1|C (1R9F)
  • 5'-R(*UP*CP*GP*AP*AP*GP*UP*AP*UP*UP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.9 Å20(1) 1R9F|1|C
564NR_3.0_51826.1
Exact match
1RNA|1|A+1RNA|1|B (1RNA)
  • RNA (5'-R(*UP*UP*AP*UP*AP*UP*AP*UP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
2.3 Å14(1) 1RNA|1|A+1RNA|1|B
565NR_3.0_95110.1
Exact match
1RPU|1|C+1RPU|1|D (1RPU)
  • 5'-R(P*CP*GP*UP*AP*CP*GP*CP*GP*UP*CP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H; model(s): 1
2.5 Å42(1) 1RPU|1|C+1RPU|1|D
566NR_3.0_06780.1
Exact match
1S03|1|A (1S03)
  • 47-MER
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å47(1) 1S03|1|A
567NR_3.0_07004.1
Exact match
1S03|1|B (1S03)
  • 47-MER
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å47(1) 1S03|1|B
568NR_3.0_85719.1
Exact match
1S76|1|R (1S76)
  • RNA (5'-R(P*AP*CP*AP*CP*GP*GP*CP*GP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.9 Å9(1) 1S76|1|R
569NR_3.0_98913.1
Exact match
1S77|1|R (1S77)
  • RNA (5'-R(*AP*CP*AP*CP*GP*GP*CP*GP*AP*(3[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.7 Å9(1) 1S77|1|R
570NR_3.0_03470.1
Exact match
Thermus thermophilus
1SER|1|T (1SER)
  • TRNASER
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.9 Å62(1) 1SER|1|T
571NR_3.0_56046.1
Exact match
1SI3|1|B (1SI3)
  • 5'-R(*CP*GP*UP*GP*AP*CP*UP*CP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å9(1) 1SI3|1|B
572NR_3.0_72697.1
Exact match
1T0E|1|A+1T0E|1|C (1T0E)
  • 5'-R(*GP*GP*UP*GP*GP*UP*GP*AP*AP*GP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, C, D, H; model(s): 1
1.7 Å21(1) 1T0E|1|A+1T0E|1|C
573NR_3.0_12093.1
Exact match
1TFW|1|G+1TFW|1|J (1TFW)
  • 5'-R(*GP*CP*GP*GP*AP*UP*CP*CP*GP*CP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, G, H, J; model(s): 1
2.2 Å13(1) 1TFW|1|G+1TFW|1|J
574NR_3.0_83386.1
Exact match
Escherichia coli
1U0B|1|A (1U0B)
  • Cysteinyl-tRNA synthetase
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å74(1) 1U0B|1|A
575NR_3.0_72627.1
Exact match
1U9S|1|A (1U9S)
  • RIBONUCLEASE P
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å155(1) 1U9S|1|A
576NR_3.0_67852.1
Exact match
1URN|1|P (1URN)
  • RNA (5'-R(*AP*AP*UP*CP*CP*AP*UP*UP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
1.9 Å20(1) 1URN|1|P
577NR_3.0_96260.1
Exact match
1UTD|1|1 (1UTD)
  • 5'-R(*GP*UP*UP*UP*GP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): 1; model(s): 1
2.1 Å3(1) 1UTD|1|1
578NR_3.0_35535.1
Exact match
1VQ6|1|4 (1VQ6)
  • 5'-R(*CP*(5AA)*(HFA))-3'
  • X-RAY DIFFRACTION
  • Chain(s): 4; model(s): 1
2.7 Å1(1) 1VQ6|1|4
579NR_3.0_28222.1
Exact match
1VQL|1|4 (1VQL)
  • 5'-R(*CP*CP*(PPU)*(TSE)*(DA)*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): 4; model(s): 1
2.3 Å4(1) 1VQL|1|4
580NR_3.0_56657.1
Exact match
1VQM|1|4 (1VQM)
  • 5'-R(*CP*CP*(PPU)P*(PO2)P*(DA)P*C*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): 4; model(s): 1
2.3 Å4(1) 1VQM|1|4
581NR_3.0_63152.1
Exact match
1VQN|1|4 (1VQN)
  • 5'-R(*CP*CP*(PPU)*(LOF))-3'
  • X-RAY DIFFRACTION
  • Chain(s): 4; model(s): 1
2.4 Å2(1) 1VQN|1|4
582NR_3.0_41538.1
Exact match
1WNE|1|B+1WNE|1|C (1WNE)
  • 5'-R(*CP*AP*UP*GP*GP*GP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, H; model(s): 1
3.0 Å8(1) 1WNE|1|B+1WNE|1|C
583NR_3.0_08212.1
Exact match
1XJR|1|A (1XJR)
  • s2m RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å46(1) 1XJR|1|A
584NR_3.0_30667.1
Exact match
1XOK|1|A (1XOK)
  • alfalfa mosaic virus RNA 3' UTR
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å27(1) 1XOK|1|A
585NR_3.0_69516.1
Exact match
Vibrio vulnificus
1Y26|1|X (1Y26)
  • Vibrio vulnificus A-riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.1 Å71(1) 1Y26|1|X
586NR_3.0_70496.1
Exact match
Bacillus subtilis
1Y27|1|X (1Y27)
  • Bacillus subtilis xpt
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.4 Å68(1) 1Y27|1|X
587NR_3.0_99632.2
Exact match
Saccharomyces cerevisiae
1YFG|1|A (1YFG)
  • YEAST INITIATOR TRNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å64(1) 1YFG|1|A
588NR_3.0_08150.1
Exact match
1YVP|1|G (1YVP)
  • Y RNA sequence, first strand
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.2 Å5(1) 1YVP|1|G
589NR_3.0_10769.1
Exact match
1YVP|1|H (1YVP)
  • Y RNA sequence, first strand
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.2 Å7(1) 1YVP|1|H
590NR_3.0_29659.1
Exact match
1YZ9|1|C+1YZ9|1|D+1YZ9|1|E+1YZ9|1|F (1YZ9)
  • 5'-R(*CP*GP*AP*AP*CP*UP*UP*CP*GP*CP*G)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, H; model(s): 1
2.1 Å11(1) 1YZ9|1|C+1YZ9|1|D+1YZ9|1|E+1YZ9|1|F
591NR_3.0_38795.1
Exact match
1YZD|1|A+1YZD|1|B (1YZD)
  • RNA 5'-R(*GP*CP*AP*GP*AP*(A5M)P*UP*UP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, H; model(s): 1
2.4 Å15(1) 1YZD|1|A+1YZD|1|B
592NR_3.0_89129.1
Exact match
1Z7F|1|B+1Z7F|1|C (1Z7F)
  • 5'-R(*GP*CP*AP*GP*AP*CP*UP*UP*AP*AP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, H; model(s): 1
2.1 Å16(1) 1Z7F|1|B+1Z7F|1|C
593NR_3.0_55496.1
Exact match
205D|1|A+205D|1|B (205D)
  • RNA (5'-R(*GP*GP*AP*CP*UP*UP*UP*GP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, H; model(s): 1
2.6 Å12(1) 205D|1|A+205D|1|B
594NR_3.0_19715.1
Exact match
255D|1|A (255D)
  • RNA (5'-R(*GP*GP*AP*CP*UP*UP*CP*GP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å12(1) 255D|1|A
595NR_3.0_36371.1
Exact match
283D|1|A (283D)
  • RNA (5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å12(1) 283D|1|A
596NR_3.0_08420.1
Exact match
2A43|1|A (2A43)
  • RNA Pseudoknot
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.3 Å26(1) 2A43|1|A
597NR_3.0_95023.1
Exact match
Escherichia coli
2A8V|1|D (2A8V)
  • 5'-R(P*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å3(1) 2A8V|1|D
598NR_3.0_73018.1
Exact match
2A8V|1|E (2A8V)
  • 5'-R(P*CP*CP*CP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.4 Å6(1) 2A8V|1|E
599NR_3.0_37298.1
Exact match
2ASB|1|B (2ASB)
  • ribosomal RNA (5'- GAACUCAAUAG -3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.5 Å11(1) 2ASB|1|B
600NR_3.0_21689.1
Exact match
2B3J|1|G (2B3J)
  • anticodon stem-loop of t-RNA-Arg2 (nucle[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.0 Å7(1) 2B3J|1|G
601NR_3.0_54448.1
Exact match
2BBV|1|N (2BBV)
  • RNA (5'-R(*UP*CP*UP*UP*AP*UP*AP*UP*CP*U)[...]
  • X-RAY DIFFRACTION
  • Chain(s): N; model(s): 1
2.8 Å10(1) 2BBV|1|N
602NR_3.0_00896.1
Exact match
2BX2|1|R (2BX2)
  • RNA (5'-R(*UP*UP*UP*AP*CP*AP*GP*UP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.9 Å14(1) 2BX2|1|R
603NR_3.0_83181.1
Exact match
2DLC|1|Y (2DLC)
  • T-RNA (76-MER)
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.4 Å64(1) 2DLC|1|Y
604NR_3.0_52699.1
Exact match
Bos taurus
2DR2|1|B (2DR2)
  • transfer RNA-Trp
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å75(1) 2DR2|1|B
605NR_3.0_10954.1
Exact match
2E9R|1|A+2E9R|1|B (2E9R)
  • 5'-R(*CP*AP*UP*GP*GP*GP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, H; model(s): 1
2.8 Å9(1) 2E9R|1|A+2E9R|1|B
606NR_3.0_62003.1
Exact match
2E9Z|1|B+2E9Z|1|C (2E9Z)
  • 5'-R(*CP*AP*UP*GP*GP*GP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, H; model(s): 1
3.0 Å9(1) 2E9Z|1|B+2E9Z|1|C
607NR_3.0_32676.1
Exact match
2F8K|1|B (2F8K)
  • 5'-R(*UP*AP*AP*UP*CP*UP*UP*UP*GP*AP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å16(1) 2F8K|1|B
608NR_3.0_59799.1
Exact match
2F8S|1|C+2F8S|1|D (2F8S)
  • 5'-R(P*AP*GP*AP*CP*AP*GP*CP*AP*UP*AP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, H; model(s): 1
3.0 Å22(1) 2F8S|1|C+2F8S|1|D
609NR_3.0_31791.1
Exact match
2FZ2|1|D (2FZ2)
  • 5'-R(*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.9 Å3(1) 2FZ2|1|D
610NR_3.0_26733.1
Exact match
2G4B|1|B (2G4B)
  • 5'-R(P*UP*UP*UP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å7(1) 2G4B|1|B
611NR_3.0_79446.1
Exact match
2G91|1|A+2G91|1|B (2G91)
  • 5'-R(*GP*GP*UP*GP*CP*GP*CP*(CBR)P*C-3'
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, H; model(s): 1
1.5 Å8(1) 2G91|1|A+2G91|1|B
612NR_3.0_39119.1
Exact match
2G92|1|A+2G92|1|B (2G92)
  • 5'-R(*CP*GP*CP*(NF2)P*AP*AP*UP*UP*AP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, H; model(s): 1
1.6 Å11(1) 2G92|1|A+2G92|1|B
613NR_3.0_53424.1
Exact match
2GUN|1|B (2GUN)
  • 5'-R(*GP*AP*AP*GP*AP*AP*GP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å10(1) 2GUN|1|B
614NR_3.0_76177.1
Exact match
2GXB|1|E+2GXB|1|F (2GXB)
  • 5'-R(P*(DU)P*CP*GP*CP*GP*CP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, H; model(s): 1
2.3 Å6(1) 2GXB|1|E+2GXB|1|F
615NR_3.0_99751.1
Exact match
2HVY|1|E (2HVY)
  • H/ACA RNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.3 Å61(1) 2HVY|1|E
616NR_3.0_96380.1
Exact match
2IX1|1|B (2IX1)
  • 5'-D(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP *AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å13(1) 2IX1|1|B
617NR_3.0_29524.1
Exact match
2J0S|1|E (2J0S)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP *UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.2 Å6(1) 2J0S|1|E
618NR_3.0_77683.1
Exact match
2JEA|1|C (2JEA)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.3 Å7(1) 2JEA|1|C
619NR_3.0_33835.1
Exact match
Escherichia coli
2JLT|1|A (2JLT)
  • R06
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å17(1) 2JLT|1|A
620NR_3.0_80987.1
Exact match
2NUE|1|C (2NUE)
  • 46-MER
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å46(1) 2NUE|1|C
621NR_3.0_26402.1
Exact match
2NUG|1|E+2NUG|1|F+2NUG|1|C+2NUG|1|D (2NUG)
  • 5'-R(P*AP*GP*UP*GP*GP*CP*CP*UP*UP*GP*C)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, H; model(s): 1
1.7 Å13(1) 2NUG|1|E+2NUG|1|F+2NUG|1|C+2NUG|1|D
622NR_3.0_34359.1
Exact match
synthetic construct
2NVQ|1|R (2NVQ)
  • 5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*GP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.9 Å10(1) 2NVQ|1|R
623NR_3.0_48589.1
Exact match
2O3V|1|A+2O3V|1|B (2O3V)
  • RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, H; model(s): 1
2.8 Å22(1) 2O3V|1|A+2O3V|1|B
624NR_3.0_73746.1
Exact match
2OE5|1|B+2OE5|1|A (2OE5)
  • RNA (5'-R(*GP*GP*UP*AP*CP*UP*AP*AP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, H; model(s): 1
1.5 Å17(1) 2OE5|1|B+2OE5|1|A
625NR_3.0_60142.1
Exact match
2OIU|1|P (2OIU)
  • L1 Ribozyme RNA Ligase
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.6 Å71(1) 2OIU|1|P
626NR_3.0_36247.1
Exact match
2OIU|1|Q (2OIU)
  • L1 Ribozyme RNA Ligase
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
2.6 Å71(1) 2OIU|1|Q
627NR_3.0_68957.1
Exact match
2PJP|1|B (2PJP)
  • SECIS RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å23(1) 2PJP|1|B
628NR_3.0_32733.1
Exact match
2PO1|1|C (2PO1)
  • 10-mer poly(A)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.9 Å7(1) 2PO1|1|C
629NR_3.0_23233.1
Exact match
2Q66|1|X (2Q66)
  • 5'-R(P*AP*AP*AP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
1.8 Å5(1) 2Q66|1|X
630NR_3.0_73487.1
Exact match
2QK9|1|B (2QK9)
  • 5'-R(*AP*GP*UP*GP*CP*GP*AP*CP*AP*CP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å18(1) 2QK9|1|B
631NR_3.0_99291.1
Exact match
2QKB|1|C (2QKB)
  • 5'-R(*GP*GP*AP*GP*UP*GP*CP*GP*AP*CP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.4 Å19(1) 2QKB|1|C
632NR_3.0_46386.1
Exact match
2R7T|1|X (2R7T)
  • RNA (5'-R(*UP*GP*UP*GP*AP*AP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.0 Å7(1) 2R7T|1|X
633NR_3.0_70523.1
Exact match
2R7V|1|X (2R7V)
  • RNA (5'-R(*G*GP*CP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.8 Å5(1) 2R7V|1|X
634NR_3.0_48282.1
Exact match
2RFK|1|E+2RFK|1|D+2RFK|1|F (2RFK)
  • guide RNA 2
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, H; model(s): 1
2.9 Å26(1) 2RFK|1|E+2RFK|1|D+2RFK|1|F
635NR_3.0_07184.1
Exact match
synthetic construct
2UXC|1|X+2UXC|1|Y (2UXC)
  • A-SITE MESSENGER RNA FRAGMENT CGGG
  • X-RAY DIFFRACTION
  • Chain(s): D, F, H, X, Y; model(s): 1
2.9 Å9(1) 2UXC|1|X+2UXC|1|Y
636NR_3.0_29312.1
Exact match
Escherichia coli
2V6W|1|A+2V6W|1|B (2V6W)
  • 5'-R(*GP*GP*AP*GP*AP*GP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
1.8 Å7(1) 2V6W|1|A+2V6W|1|B
637NR_3.0_65010.1
Exact match
Homo sapiens
2V7R|1|A+2V7R|1|B (2V7R)
  • HUMAN TRNAGLY MICROHELIX
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
1.2 Å7(1) 2V7R|1|A+2V7R|1|B
638NR_3.0_30422.1
Exact match
Saccharomyces cerevisiae
2VNU|1|B (2VNU)
  • 5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å10(1) 2VNU|1|B
639NR_3.0_49650.1
Exact match
Homo sapiens
2VOP|1|B (2VOP)
  • 5'-R(*AP*UP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å5(1) 2VOP|1|B
640NR_3.0_06107.1
Exact match
Homo sapiens
2VUQ|1|A+2VUQ|1|B (2VUQ)
  • 5'-R(*GP*CP*AP*UP*UP*GP*GP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
1.2 Å7(1) 2VUQ|1|A+2VUQ|1|B
641NR_3.0_45692.1
Exact match
2XBM|1|E+2XBM|1|F (2XBM)
  • 5'-(*G3AP*GP*AP*AP*CP*CP*UP*GP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, H; model(s): 1
2.9 Å8(1) 2XBM|1|E+2XBM|1|F
642NR_3.0_27904.1
Exact match
2XD0|1|W (2XD0)
  • TOXI
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
3.0 Å35(1) 2XD0|1|W
643NR_3.0_11258.1
Exact match
2XGJ|1|C (2XGJ)
  • RNA (5'-(*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å5(1) 2XGJ|1|C
644NR_3.0_74135.1
Exact match
2XGJ|1|D (2XGJ)
  • RNA (5'-(*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.9 Å5(1) 2XGJ|1|D
645NR_3.0_24558.1
Exact match
Saccharomyces cerevisiae
2XNR|1|C (2XNR)
  • 5'-R(*UP*UP*CP*UP*UP*AP*UP*UP*CP*UP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.6 Å5(1) 2XNR|1|C
646NR_3.0_00973.1
Exact match
Mus musculus
2XS2|1|B (2XS2)
  • 5'-R(*UP*UP*GP*UP*UP*CP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.4 Å7(1) 2XS2|1|B
647NR_3.0_12819.1
Exact match
Mus musculus
2XS7|1|B (2XS7)
  • 5'-R(*UP*UP*GP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.5 Å5(1) 2XS7|1|B
648NR_3.0_42835.3
Exact match
synthetic construct
2XZL|1|B (2XZL)
  • 5- R(*UP*UP*UP*UP*UP*UP*UP*UP*U) -3
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å9(1) 2XZL|1|B
649NR_3.0_75793.1
Exact match
synthetic construct
2XZO|1|D (2XZO)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å7(1) 2XZO|1|D
650NR_3.0_87252.1
Exact match
2Y8W|1|B (2Y8W)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å19(1) 2Y8W|1|B
651NR_3.0_78183.1
Exact match
2Y8Y|1|B (2Y8Y)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.4 Å18(1) 2Y8Y|1|B
652NR_3.0_42560.1
Exact match
2ZI0|1|C+2ZI0|1|D (2ZI0)
  • RNA (5'-D(P*AP*GP*AP*CP*AP*GP*CP*AP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, H; model(s): 1
2.8 Å20(1) 2ZI0|1|C+2ZI0|1|D
653NR_3.0_94226.1
Exact match
2ZKO|1|C+2ZKO|1|D (2ZKO)
  • RNA (5'-R(P*AP*GP*AP*CP*AP*GP*CP*AP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, H; model(s): 1
1.7 Å21(1) 2ZKO|1|C+2ZKO|1|D
654NR_3.0_78506.1
Exact match
2ZY6|1|A (2ZY6)
  • phenylalanyl transfer RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.8 Å38(1) 2ZY6|1|A
655NR_3.0_98075.1
Exact match
2ZZM|1|B (2ZZM)
  • RNA (84-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å84(1) 2ZZM|1|B
656NR_3.0_12322.1
Exact match
333D|1|A (333D)
  • RNA (5'-R(*CP*GP*CP*AP*IP*GP*CP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.5 Å7(1) 333D|1|A
657NR_3.0_99060.1
Exact match
353D|1|A+353D|1|B (353D)
  • RNA (5'-R(*AP*UP*CP*CP*CP*CP*CP*GP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
2.4 Å12(1) 353D|1|A+353D|1|B
658NR_3.0_63943.1
Exact match
Escherichia coli
354D|1|A+354D|1|B (354D)
  • RNA (5'-R(*CP*CP*GP*AP*UP*GP*GP*UP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
1.5 Å12(1) 354D|1|A+354D|1|B
659NR_3.0_73526.1
Exact match
361D|1|A (361D)
  • RNA (5'-R(*CP*UP*GP*GP*GP*CP*GP*GP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å20(1) 361D|1|A
660NR_3.0_70550.1
Exact match
361D|1|B (361D)
  • RNA (5'-R(*CP*UP*GP*GP*GP*CP*GP*GP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å20(1) 361D|1|B
661NR_3.0_34610.1
Exact match
Escherichia coli
364D|1|C+364D|1|B+364D|1|A (364D)
  • RNA (5'-R(*CP*CP*CP*CP*AP*UP*GP*CP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, H; model(s): 1
3.0 Å31(1) 364D|1|C+364D|1|B+364D|1|A
662NR_3.0_45442.1
Exact match
397D|1|A+397D|1|B (397D)
  • RNA (5'-R(*GP*GP*CP*CP*AP*GP*AP*UP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.3 Å15(1) 397D|1|A+397D|1|B
663NR_3.0_39323.1
Exact match
3ADL|1|B+3ADL|1|C (3ADL)
  • RNA (5'-R(P*CP*GP*CP*GP*CP*GP*CP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, H; model(s): 1
2.2 Å10(1) 3ADL|1|B+3ADL|1|C
664NR_3.0_65768.1
Exact match
3AEV|1|C (3AEV)
  • RNA (5'-R(*GP*GP*AP*UP*CP*AP*CP*CP*UP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å11(1) 3AEV|1|C
665NR_3.0_75304.1
Exact match
3AHU|1|X (3AHU)
  • 5'-R(*AP*GP*AP*GP*AP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.2 Å6(1) 3AHU|1|X
666NR_3.0_13919.1
Exact match
3AM1|1|B (3AM1)
  • ASL-truncated tRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å81(1) 3AM1|1|B
667NR_3.0_56041.1
Exact match
Archaeoglobus fulgidus
3AMT|1|B (3AMT)
  • RNA (78-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å78(1) 3AMT|1|B
668NR_3.0_75747.1
Exact match
3AVT|1|T (3AVT)
  • RNA (5'-R(*AP*UP*CP*GP*CP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.6 Å4(1) 3AVT|1|T
669NR_3.0_29245.1
Exact match
3AVU|1|T+3AVU|1|G (3AVU)
  • RNA (5'-R(*AP*UP*CP*GP*UP*GP*GP*AP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, G, H, T; model(s): 1
2.9 Å9(1) 3AVU|1|T+3AVU|1|G
670NR_3.0_55371.1
Exact match
3AVW|1|T+3AVW|1|G (3AVW)
  • RNA (5'-R(*AP*UP*CP*GP*UP*GP*GP*AP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, G, H, T; model(s): 1
2.6 Å12(1) 3AVW|1|T+3AVW|1|G
671NR_3.0_51980.1
Exact match
3AVX|1|T+3AVX|1|G (3AVX)
  • RNA (5'-R(*AP*AP*CP*GP*AP*UP*GP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, G, H, T; model(s): 1
2.4 Å13(1) 3AVX|1|T+3AVX|1|G
672NR_3.0_09827.1
Exact match
3AVY|1|T+3AVY|1|G (3AVY)
  • RNA (5'-R(*AP*AP*CP*GP*AP*UP*UP*UP*UP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, G, H, T; model(s): 1
2.6 Å14(1) 3AVY|1|T+3AVY|1|G
673NR_3.0_21191.1
Exact match
3BNT|1|A (3BNT)
  • A site of human mitochondrial ribosome
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å21(1) 3BNT|1|A
674NR_3.0_09764.1
Exact match
3BOY|1|D (3BOY)
  • 5'-R(*UP*UP*UP*AP*GP*UP*UP*UP*UP*UP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.7 Å22(1) 3BOY|1|D
675NR_3.0_76670.1
Exact match
3BSB|1|C (3BSB)
  • 5'-R(*UP*UP*UP*AP*AP*UP*GP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å9(1) 3BSB|1|C
676NR_3.0_17852.1
Exact match
3CGR|1|B+3CGR|1|A (3CGR)
  • RNA (5'-R(*CP*GP*CP*AP*CP*UP*AP*AP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
2.1 Å13(1) 3CGR|1|B+3CGR|1|A
677NR_3.0_46216.1
Exact match
3CGS|1|B+3CGS|1|A (3CGS)
  • RNA (5'-R(*CP*GP*CP*UP*AP*CP*UP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.7 Å13(1) 3CGS|1|B+3CGS|1|A
678NR_3.0_96160.1
Exact match
3CJZ|1|A+3CJZ|1|B (3CJZ)
  • RNA (5'-R(*GP*GP*AP*CP*GP*(M2G)P*AP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.8 Å12(1) 3CJZ|1|A+3CJZ|1|B
679NR_3.0_98916.1
Exact match
3CZW|1|X (3CZW)
  • RNA (5'-R(*G*UP*GP*GP*UP*CP*UP*GP*AP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
1.4 Å15(1) 3CZW|1|X
680NR_3.0_33763.1
Exact match
3D0M|1|X (3D0M)
  • RNA (5'-R(*GP*UP*GP*GP*UP*CP*UP*GP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.0 Å16(1) 3D0M|1|X
681NR_3.0_76733.1
Exact match
3DD2|1|B (3DD2)
  • RNA (26-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å15(1) 3DD2|1|B
682NR_3.0_39268.1
Exact match
3E2E|1|R (3E2E)
  • RNA (5'-R(*GP*GP*GP*AP*GP*UP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.0 Å7(1) 3E2E|1|R
683NR_3.0_30439.1
Exact match
3EGZ|1|B (3EGZ)
  • Tetracycline aptamer and artificial ribo[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å65(1) 3EGZ|1|B
684NR_3.0_62752.1
Exact match
3EQT|1|C+3EQT|1|D (3EQT)
  • 5'-R(*GP*CP*GP*CP*GP*CP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A, C, D, H; model(s): 1
2.0 Å8(1) 3EQT|1|C+3EQT|1|D
685NR_3.0_68503.1
Exact match
3F4H|1|Y+3F4H|1|X (3F4H)
  • FMN riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A, D, H, X, Y; model(s): 1
3.0 Å56(1) 3F4H|1|Y+3F4H|1|X
686NR_3.0_80904.1
Exact match
3FHT|1|C (3FHT)
  • RNA (5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.2 Å6(1) 3FHT|1|C
687NR_3.0_15144.1
Exact match
3FHT|1|D (3FHT)
  • RNA (5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.2 Å6(1) 3FHT|1|D
688NR_3.0_55153.1
Exact match
3FS0|1|B+3FS0|1|A (3FS0)
  • 5'-R(*CP*CP*AP*GP*UP*CP*GP*GP*AP*AP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
2.3 Å11(1) 3FS0|1|B+3FS0|1|A
689NR_3.0_55295.1
Exact match
3FTE|1|C+3FTE|1|D (3FTE)
  • 5'-R(P*AP*AP*CP*CP*GP*UP*AP*GP*GP*GP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, C, D, H; model(s): 1
3.0 Å22(1) 3FTE|1|C+3FTE|1|D
690NR_3.0_25813.1
Exact match
3FTF|1|C+3FTF|1|D (3FTF)
  • 5'-R(P*AP*AP*CP*CP*GP*UP*AP*GP*GP*GP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, C, D, H; model(s): 1
2.8 Å22(1) 3FTF|1|C+3FTF|1|D
691NR_3.0_69076.1
Exact match
3G0H|1|E (3G0H)
  • 5'-R(P*UP*UP*UP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.7 Å7(1) 3G0H|1|E
692NR_3.0_49451.1
Exact match
3G9Y|1|C (3G9Y)
  • RNA (5'-R(*AP*GP*GP*UP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.4 Å8(1) 3G9Y|1|C
693NR_3.0_82961.1
Exact match
3GIB|1|H (3GIB)
  • 5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.4 Å9(1) 3GIB|1|H
694NR_3.0_24791.1
Exact match
3GS5|1|A (3GS5)
  • RNA (25-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å27(1) 3GS5|1|A
695NR_3.0_24663.1
Exact match
3GS5|1|C (3GS5)
  • RNA (36-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å36(1) 3GS5|1|C
696NR_3.0_80567.1
Exact match
3GVN|1|A+3GVN|1|B (3GVN)
  • 5'-R(*GP*GP*UP*GP*AP*GP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.2 Å7(1) 3GVN|1|A+3GVN|1|B
697NR_3.0_34126.1
Exact match
3HAX|1|E (3HAX)
  • H/ACA RNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.1 Å60(1) 3HAX|1|E
698NR_3.0_57417.1
Exact match
3HO1|1|Y (3HO1)
  • 5'-R(P*CP*CP*UP*AP*CP*UP*AP*CP*CP*UP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.6 Å12(1) 3HO1|1|Y
699NR_3.0_23301.1
Exact match
3HSB|1|X (3HSB)
  • RNA (5'-R(*AP*GP*AP*GP*AP*GP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.2 Å7(1) 3HSB|1|X
700NR_3.0_01806.1
Exact match
3IAB|1|R (3IAB)
  • P3 domain of the RNA component of RNase [...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.7 Å46(1) 3IAB|1|R
701NR_3.0_07832.1
Exact match
3IBK|1|A (3IBK)
  • RNA (5'-R(*(5BU)P*AP*GP*GP*GP*UP*UP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.2 Å11(1) 3IBK|1|A
702NR_3.0_70081.1
Exact match
3IBK|1|B (3IBK)
  • RNA (5'-R(*(5BU)P*AP*GP*GP*GP*UP*UP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å11(1) 3IBK|1|B
703NR_3.0_78175.1
Exact match
3ICE|1|G (3ICE)
  • 5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.8 Å6(1) 3ICE|1|G
704NR_3.0_65401.1
Exact match
3IEV|1|D (3IEV)
  • 5'-R(P*AP*UP*CP*AP*CP*CP*UP*CP*CP*UP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.9 Å12(1) 3IEV|1|D
705NR_3.0_81791.1
Exact match
Leishmania donovani
3JCS|1|2 (3JCS)
  • 26S delta ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
2.8 Å1093(1) 3JCS|1|2
706NR_3.0_40535.1
Exact match
Leishmania donovani
3JCS|1|3 (3JCS)
  • 26S gamma ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 3; model(s): 1
2.8 Å184(1) 3JCS|1|3
707NR_3.0_35448.1
Exact match
Leishmania donovani
3JCS|1|5 (3JCS)
  • 26S epsilon ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 5; model(s): 1
2.8 Å80(1) 3JCS|1|5
708NR_3.0_03414.1
Exact match
Leishmania donovani
3JCS|1|6 (3JCS)
  • 26S zeta ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 6; model(s): 1
2.8 Å61(1) 3JCS|1|6
709NR_3.0_76204.1
Exact match
3K5Q|1|B (3K5Q)
  • 5'-R(P*UP*GP*UP*AP*CP*UP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å9(1) 3K5Q|1|B
710NR_3.0_26816.1
Exact match
3K5Z|1|B (3K5Z)
  • 5'-R(*UP*GP*UP*AP*CP*CP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å9(1) 3K5Z|1|B
711NR_3.0_14980.1
Exact match
3K61|1|B (3K61)
  • 5'-R(*UP*GP*UP*AP*AP*AP*AP*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å9(1) 3K61|1|B
712NR_3.0_85762.1
Exact match
3K62|1|B (3K62)
  • 5'-R(*UP*GP*UP*GP*UP*UP*AP*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å9(1) 3K62|1|B
713NR_3.0_52626.1
Exact match
3K64|1|B (3K64)
  • 5'-R(*UP*GP*UP*GP*UP*CP*AP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å9(1) 3K64|1|B
714NR_3.0_35816.1
Exact match
3KMQ|1|B+3KMQ|1|C (3KMQ)
  • RNA (5'-R(P*GP*GP*GP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, H; model(s): 1
2.1 Å5(1) 3KMQ|1|B+3KMQ|1|C
715NR_3.0_40545.1
Exact match
3KNC|1|B (3KNC)
  • 5'-R(*CP*GP*CP*UP*AP*CP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å8(1) 3KNC|1|B
716NR_3.0_60357.1
Exact match
3KOA|1|B+3KOA|1|C (3KOA)
  • RNA (5'-R(P*AP*UP*GP*GP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, H; model(s): 1
2.4 Å6(1) 3KOA|1|B+3KOA|1|C
717NR_3.0_01810.1
Exact match
3KS8|1|E+3KS8|1|F (3KS8)
  • 5'-R(*AP*GP*AP*AP*GP*GP*AP*GP*GP*GP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, E, F, H; model(s): 1
2.4 Å18(1) 3KS8|1|E+3KS8|1|F
718NR_3.0_63265.1
Exact match
Bacillus subtilis
3LA5|1|A (3LA5)
  • Adenosine RIboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.7 Å71(1) 3LA5|1|A
719NR_3.0_35088.1
Exact match
3LOA|1|B+3LOA|1|A (3LOA)
  • 5'-R(*GP*GP*GP*(5BU)P*GP*GP*UP*GP*AP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
2.3 Å22(1) 3LOA|1|B+3LOA|1|A
720NR_3.0_44340.1
Exact match
3LRR|1|C+3LRR|1|D (3LRR)
  • RNA (5'-R(*(ATP)P*UP*AP*UP*AP*UP*AP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, C, D, H; model(s): 1
2.2 Å11(1) 3LRR|1|C+3LRR|1|D
721NR_3.0_13395.1
Exact match
3MDG|1|C (3MDG)
  • RNA (5'-R(*UP*UP*GP*UP*AP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.2 Å6(1) 3MDG|1|C
722NR_3.0_33509.1
Exact match
3MDI|1|C (3MDI)
  • RNA (5'-R(*UP*GP*UP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.1 Å6(1) 3MDI|1|C
723NR_3.0_86272.1
Exact match
3MEI|1|A+3MEI|1|B (3MEI)
  • RNA (5'-R(*CP*CP*GP*CP*CP*GP*CP*GP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
2.0 Å22(1) 3MEI|1|A+3MEI|1|B
724NR_3.0_33458.1
Exact match
Homo sapiens
3MIJ|1|A (3MIJ)
  • RNA (5'-R(*UP*AP*GP*GP*GP*UP*UP*AP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.6 Å12(1) 3MIJ|1|A
725NR_3.0_38078.1
Exact match
3MJ0|1|B (3MJ0)
  • RNA (5'-R(*CP*GP*UP*UP*AP*CP*GP*CP*(OMU)[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å8(1) 3MJ0|1|B
726NR_3.0_88566.1
Exact match
Escherichia coli
3MOJ|1|A (3MOJ)
  • RNA (69-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å69(1) 3MOJ|1|A
727NR_3.0_96977.1
Exact match
3MQK|1|D+3MQK|1|E (3MQK)
  • RNA (5'-R(P*GP*UP*UP*CP*GP*AP*UP*CP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, E, H; model(s): 1
2.8 Å13(1) 3MQK|1|D+3MQK|1|E
728NR_3.0_42221.1
Exact match
3NCU|1|C+3NCU|1|D (3NCU)
  • 5'-R(*(GDP)P*AP*CP*GP*CP*UP*AP*GP*CP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, C, D, H; model(s): 1
2.6 Å11(1) 3NCU|1|C+3NCU|1|D
729NR_3.0_29649.1
Exact match
3ND3|1|A (3ND3)
  • 5'-R(*AP*GP*AP*GP*AP*AP*GP*AP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.4 Å16(1) 3ND3|1|A
730NR_3.0_82939.1
Exact match
3ND4|1|A (3ND4)
  • 5'-R(*AP*GP*AP*GP*AP*AP*GP*AP*UP*CP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.5 Å16(1) 3ND4|1|A
731NR_3.0_55424.1
Exact match
Homo sapiens
3NKB|1|B (3NKB)
  • The hepatitis delta virus ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å64(1) 3NKB|1|B
732NR_3.0_97629.1
Exact match
3NL0|1|B+3NL0|1|C (3NL0)
  • 5'-R(P*UP*GP*GP*GP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, H; model(s): 1
2.6 Å7(1) 3NL0|1|B+3NL0|1|C
733NR_3.0_72277.1
Exact match
3NMA|1|B+3NMA|1|C (3NMA)
  • 5'-R(*GP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, H; model(s): 1
2.6 Å3(1) 3NMA|1|B+3NMA|1|C
734NR_3.0_69142.1
Exact match
Homo sapiens
3NMR|1|B (3NMR)
  • RNA (5'-R(*GP*UP*UP*GP*UP*UP*UP*UP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å6(1) 3NMR|1|B
735NR_3.0_42633.1
Exact match
Homo sapiens
3NNA|1|B (3NNA)
  • RNA (5'-R(*GP*UP*UP*GP*UP*UP*UP*UP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å5(1) 3NNA|1|B
736NR_3.0_50067.1
Exact match
Homo sapiens
3NNC|1|B (3NNC)
  • RNA (5'-R(*UP*GP*UP*GP*UP*GP*UP*UP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å7(1) 3NNC|1|B
737NR_3.0_51631.1
Exact match
Homo sapiens
3NNH|1|E (3NNH)
  • RNA (5'-R(*GP*UP*UP*GP*UP*UP*UP*UP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.8 Å11(1) 3NNH|1|E
738NR_3.0_49747.1
Exact match
Homo sapiens
3NNH|1|F (3NNH)
  • RNA (5'-R(*GP*UP*UP*GP*UP*UP*UP*UP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.8 Å11(1) 3NNH|1|F
739NR_3.0_06254.1
Exact match
3P4C|1|A (3P4C)
  • 5'-R(*(CFZ)P*GP*(AF2)P*AP*(UFT)P*UP*(CFZ[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.2 Å6(1) 3P4C|1|A
740NR_3.0_56893.1
Exact match
3P59|1|E+3P59|1|A+3P59|1|C+3P59|1|G+3P59|1|B+3P59|1|D+3P59|1|F+3P59|1|H (3P59)
  • RNA (5'-R(*CP*CP*GP*GP*AP*GP*GP*AP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, E, F, G, H; model(s): 1
2.2 Å14(1) 3P59|1|E+3P59|1|A+3P59|1|C+3P59|1|G+3P59|1|B+3P59|1|D+3P59|1|F+3P59|1|H
741NR_3.0_15037.1
Exact match
3PF4|1|R (3PF4)
  • hexaribonucleotide (rGUCUUUA)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
1.4 Å8(1) 3PF4|1|R
742NR_3.0_85950.1
Exact match
3PTX|1|R (3PTX)
  • RNA (45-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.0 Å45(1) 3PTX|1|R
743NR_3.0_10913.1
Exact match
3Q0L|1|C (3Q0L)
  • 5'-R(UP*GP*UP*AP*AP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.5 Å8(1) 3Q0L|1|C
744NR_3.0_43560.1
Exact match
3Q0L|1|D (3Q0L)
  • 5'-R(UP*GP*UP*AP*AP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.5 Å8(1) 3Q0L|1|D
745NR_3.0_97666.1
Exact match
3Q0Q|1|B (3Q0Q)
  • 5'-R(UP*GP*UP*AP*AP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å8(1) 3Q0Q|1|B
746NR_3.0_56560.1
Exact match
3QJJ|1|Q (3QJJ)
  • RNA (5'-R(*GP*UP*UP*GP*AP*AP*AP*UP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
2.8 Å12(1) 3QJJ|1|Q
747NR_3.0_34353.1
Exact match
3QJJ|1|R (3QJJ)
  • RNA (5'-R(*GP*UP*UP*GP*AP*AP*AP*UP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.8 Å12(1) 3QJJ|1|R
748NR_3.0_68652.1
Exact match
3QRP|1|B+3QRP|1|C (3QRP)
  • RNA (5'-R(*GP*UP*CP*CP*CP*CP*AP*CP*(PGP)[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H; model(s): 1
2.4 Å8(1) 3QRP|1|B+3QRP|1|C
749NR_3.0_80680.1
Exact match
3R1D|1|E (3R1D)
  • RNA (5'-R(*GP*CP*(GRB)P*GP*CP*GP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.5 Å15(1) 3R1D|1|E
750NR_3.0_63209.1
Exact match
3R1E|1|A+3R1E|1|B (3R1E)
  • RNA (5'-R(*GP*CP*(GRB)P*GP*CP*GP*GP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
1.0 Å10(1) 3R1E|1|A+3R1E|1|B
751NR_3.0_12608.1
Exact match
Aquifex aeolicus
3R2D|1|R+3R2D|1|S (3R2D)
  • 5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, R, S; model(s): 1
2.2 Å12(1) 3R2D|1|R+3R2D|1|S
752NR_3.0_38781.1
Exact match
3R9W|1|B (3R9W)
  • RNA301
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.1 Å34(1) 3R9W|1|B
753NR_3.0_95874.1
Exact match
3R9X|1|C (3R9X)
  • RNA301
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å35(1) 3R9X|1|C
754NR_3.0_71379.1
Exact match
3RC8|1|E (3RC8)
  • RNA fragment
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.9 Å6(1) 3RC8|1|E
755NR_3.0_79804.1
Exact match
3RTJ|1|D (3RTJ)
  • RNA (5'-R(*AP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å2(1) 3RTJ|1|D
756NR_3.0_35883.1
Exact match
3RZO|1|R (3RZO)
  • RNA (5'-R(*GP*AP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.0 Å4(1) 3RZO|1|R
757NR_3.0_84359.1
Exact match
3S14|1|R (3S14)
  • RNA (5'-R(*GP*AP*GP*AP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.9 Å6(1) 3S14|1|R
758NR_3.0_62516.1
Exact match
3SJ2|1|A+3SJ2|1|B (3SJ2)
  • RNA (5'-R(*UP*UP*GP*GP*GP*CP*CP*GP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
1.4 Å19(1) 3SJ2|1|A+3SJ2|1|B
759NR_3.0_75875.1
Exact match
3SN2|1|B (3SN2)
  • transferrin receptor iron regulatory ele[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å29(1) 3SN2|1|B
760NR_3.0_17495.1
Exact match
3SSF|1|A (3SSF)
  • 5'-R(*UP*AP*AP*AP*AP*GP*AP*AP*AP*AP*GP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.6 Å21(1) 3SSF|1|A
761NR_3.0_86744.1
Exact match
3SZX|1|A+3SZX|1|B (3SZX)
  • RNA (5'-R(P*UP*UP*GP*GP*GP*CP*CP*UP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.2 Å19(1) 3SZX|1|A+3SZX|1|B
762NR_3.0_01981.1
Exact match
3T3O|1|B (3T3O)
  • O2'methyl-RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å1(1) 3T3O|1|B
763NR_3.0_92104.1
Exact match
Escherichia coli
3T5Q|1|C (3T5Q)
  • RNA (5'-R(P*UP*UP*AP*UP*CP*UP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.0 Å8(1) 3T5Q|1|C
764NR_3.0_18291.1
Exact match
Escherichia coli
3T5Q|1|D (3T5Q)
  • RNA (5'-R(P*UP*AP*UP*CP*UP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å7(1) 3T5Q|1|D
765NR_3.0_78848.1
Exact match
Escherichia coli
3T5Q|1|F (3T5Q)
  • RNA (5'-R(P*UP*UP*AP*UP*CP*UP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.0 Å8(1) 3T5Q|1|F
766NR_3.0_79660.1
Exact match
Escherichia coli
3T5Q|1|J (3T5Q)
  • RNA (5'-R(P*UP*UP*AP*UP*CP*UP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): J; model(s): 1
3.0 Å8(1) 3T5Q|1|J
767NR_3.0_52761.1
Exact match
3TD0|1|B+3TD0|1|A (3TD0)
  • RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
1.6 Å22(1) 3TD0|1|B+3TD0|1|A
768NR_3.0_21945.1
Exact match
3TS2|1|U (3TS2)
  • RNA (5'-R(*GP*GP*GP*GP*UP*CP*UP*AP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): U; model(s): 1
2.0 Å23(1) 3TS2|1|U
769NR_3.0_32675.1
Exact match
3TS2|1|V (3TS2)
  • RNA (5'-R(*GP*GP*GP*GP*UP*CP*UP*AP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): V; model(s): 1
2.0 Å23(1) 3TS2|1|V
770NR_3.0_83775.1
Exact match
Hepatitis C virus
3TZR|1|A+3TZR|1|B (3TZR)
  • 5'-R(*CP*GP*AP*GP*GP*AP*AP*CP*UP*AP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.2 Å20(1) 3TZR|1|A+3TZR|1|B
771NR_3.0_28506.1
Exact match
Caenorhabditis elegans
3V6Y|1|B (3V6Y)
  • RNA (5'-R(*UP*AP*CP*UP*GP*UP*GP*CP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å11(1) 3V6Y|1|B
772NR_3.0_97196.1
Exact match
Caenorhabditis elegans
3V71|1|B (3V71)
  • RNA (5'-R(*CP*UP*CP*UP*GP*UP*AP*UP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å7(1) 3V71|1|B
773NR_3.0_33378.1
Exact match
Caenorhabditis elegans
3V74|1|B (3V74)
  • RNA (5'-R(*UP*CP*AP*UP*GP*UP*GP*CP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å11(1) 3V74|1|B
774NR_3.0_65712.1
Exact match
3VNV|1|T+3VNV|1|G (3VNV)
  • RNA (5'-R(*GP*GP*GP*UP*AP*GP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, T; model(s): 1
2.6 Å8(1) 3VNV|1|T+3VNV|1|G
775NR_3.0_81333.1
Exact match
3WBM|1|X+3WBM|1|Y (3WBM)
  • RNA (25-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, X, Y; model(s): 1
2.0 Å25(1) 3WBM|1|X+3WBM|1|Y
776NR_3.0_84179.1
Exact match
3WZI|1|C (3WZI)
  • ssRNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å4(1) 3WZI|1|C
777NR_3.0_68262.1
Exact match
Pyrococcus furiosus
3X1L|1|I (3X1L)
  • RNA (32-MER)
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
2.1 Å32(1) 3X1L|1|I
778NR_3.0_12677.1
Exact match
402D|1|A+402D|1|B (402D)
  • RNA(5'-R(*CP*GP*CP*CP*AP*GP*CP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.3 Å8(1) 402D|1|A+402D|1|B
779NR_3.0_94840.1
Exact match
404D|1|A (404D)
  • 5'-R(*GP*AP*AP*GP*AP*GP*AP*AP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.5 Å10(1) 404D|1|A
780NR_3.0_58318.1
Exact match
406D|1|A+406D|1|E (406D)
  • RNA (5'-R(*CP*AP*CP*CP*GP*GP*AP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, E, F, G, H; model(s): 1
1.8 Å16(1) 406D|1|A+406D|1|E
781NR_3.0_90819.1
Exact match
413D|1|A (413D)
  • RNA (5'-R(*UP*GP*AP*GP*CP*UP*UP*CP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.8 Å14(1) 413D|1|A
782NR_3.0_12183.1
Exact match
421D|1|B (421D)
  • RNA (5'-R(*GP*AP*AP*GP*AP*AP*GP*AP*A)-3'[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å9(1) 421D|1|B
783NR_3.0_06457.1
Exact match
422D|1|A+422D|1|B (422D)
  • 5'-R(*GP*AP*UP*CP*AP*CP*UP*UP*CP*GP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.6 Å12(1) 422D|1|A+422D|1|B
784NR_3.0_99184.1
Exact match
433D|1|A+433D|1|B (433D)
  • 5'-R(*GP*GP*UP*AP*UP*UP*GP*CP*GP*GP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.1 Å14(1) 433D|1|A+433D|1|B
785NR_3.0_19513.1
Exact match
438D|1|A+438D|1|B (438D)
  • RNA (5'-R(*GP*GP*GP*CP*GP*CP*UP*CP*C)-3'[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.5 Å9(1) 438D|1|A+438D|1|B
786NR_3.0_27697.1
Exact match
439D|1|A+439D|1|B (439D)
  • RNA (5'-R(*CP*UP*GP*GP*GP*CP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
1.6 Å8(1) 439D|1|A+439D|1|B
787NR_3.0_02834.1
Exact match
472D|1|A+472D|1|B (472D)
  • RNA (5'-R(*GP*UP*GP*UP*UP*UP*AP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
1.9 Å8(1) 472D|1|A+472D|1|B
788NR_3.0_04638.1
Exact match
Caldanaerobacter subterraneus
4AOB|1|A (4AOB)
  • SAM-I RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å94(1) 4AOB|1|A
789NR_3.0_46564.1
Exact match
Bacillus thuringiensis
4ATO|1|G (4ATO)
  • TOXI
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.2 Å33(1) 4ATO|1|G
790NR_3.0_43251.1
Exact match
4AY2|1|C (4AY2)
  • 5'-R-PPP(GP*GP*CP*GP*CP*GP*GP*CP*UP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å19(1) 4AY2|1|C
791NR_3.0_08596.1
Exact match
4B3G|1|G (4B3G)
  • RNA (5'-(AP*AP*AP*AP*AP*AP*AP*AP*AP)-3')
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.9 Å9(1) 4B3G|1|G
792NR_3.0_14977.1
Exact match
4B3G|1|H (4B3G)
  • RNA (5'-(AP*AP*AP*AP*AP*AP*AP*AP*AP)-3')
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.9 Å8(1) 4B3G|1|H
793NR_3.0_94845.1
Exact match
Sulfolobus solfataricus
4BA2|1|R (4BA2)
  • 5'-R(*AP*AP*AP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.5 Å4(1) 4BA2|1|R
794NR_3.0_80476.1
Exact match
synthetic construct
4BOC|1|R (4BOC)
  • 5'-R(*AP*GP*UP*CP*UP*GP*CP*GP*GP*CP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.7 Å9(1) 4BOC|1|R
795NR_3.0_46866.1
Exact match
synthetic construct
4BWM|1|G (4BWM)
  • 5'-R(*AP*AP*AP*GP*GP*GP*CP*GP*CP*CP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
1.8 Å14(1) 4BWM|1|G
796NR_3.0_00810.1
Exact match
Escherichia coli
4C7O|1|E (4C7O)
  • SRP RNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.6 Å48(1) 4C7O|1|E
797NR_3.0_31288.1
Exact match
4C8Y|1|C (4C8Y)
  • R1 REPEAT RNA SUBSTRATE MIMIC
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.8 Å13(1) 4C8Y|1|C
798NR_3.0_91365.1
Exact match
Thermus thermophilus
4C8Z|1|C (4C8Z)
  • R1 REPEAT RNA CLEAVAGE PRODUCT
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.5 Å14(1) 4C8Z|1|C
799NR_3.0_13174.1
Exact match
4E58|1|D+4E58|1|C+4E58|1|E (4E58)
  • RNA duplex containing CCG repeats
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
2.0 Å7(1) 4E58|1|D+4E58|1|C+4E58|1|E
800NR_3.0_55926.1
Exact match
4E59|1|A+4E59|1|B (4E59)
  • RNA duplex containing CCG repeats
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
1.5 Å8(1) 4E59|1|A+4E59|1|B
801NR_3.0_70790.1
Exact match
4E5C|1|A+4E5C|1|B (4E5C)
  • 5'-R(P*GP*GP*CP*GP*GP*CP*GP*GP*CP*GP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
1.7 Å19(1) 4E5C|1|A+4E5C|1|B
802NR_3.0_53426.1
Exact match
4E6B|1|A+4E6B|1|B (4E6B)
  • 5'-R(P*CP*GP*GP*CP*GP*GP*CP*GP*GP*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
1.5 Å4(1) 4E6B|1|A+4E6B|1|B
803NR_3.0_33685.1
Exact match
4E6B|1|E+4E6B|1|F (4E6B)
  • 5'-R(P*CP*GP*GP*CP*GP*GP*CP*GP*GP*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H; model(s): 1
1.5 Å4(1) 4E6B|1|E+4E6B|1|F
804NR_3.0_52691.1
Exact match
4E78|1|P+4E78|1|T (4E78)
  • 5'-R(*U*AP*CP*CP*GP*(GDO))-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H, P, T; model(s): 1
2.9 Å4(1) 4E78|1|P+4E78|1|T
805NR_3.0_25893.1
Exact match
Tetrahymena thermophila
4ERD|1|C+4ERD|1|D (4ERD)
  • 5'-R(P*GP*GP*UP*CP*GP*AP*CP*AP*UP*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
2.6 Å22(1) 4ERD|1|C+4ERD|1|D
806NR_3.0_88847.1
Exact match
Homo sapiens
4F3T|1|R (4F3T)
  • RNA (5'-R(P*UP*AP*AP*AP*GP*UP*GP*CP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.3 Å14(1) 4F3T|1|R
807NR_3.0_62747.1
Exact match
Flock house virus
4FTB|1|R (4FTB)
  • Flock House virus genomic RNA
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.7 Å15(1) 4FTB|1|R
808NR_3.0_05128.1
Exact match
synthetic construct
4FVU|1|B+4FVU|1|C (4FVU)
  • RNA (5'-R(*GP*GP*AP*GP*GP*GP*AP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
2.9 Å8(1) 4FVU|1|B+4FVU|1|C
809NR_3.0_74729.1
Exact match
synthetic construct
4G0A|1|E (4G0A)
  • RNA (5'-R(P*GP*GP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.1 Å3(1) 4G0A|1|E
810NR_3.0_24630.1
Exact match
synthetic construct
4G0A|1|F (4G0A)
  • RNA (5'-R(P*GP*GP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.1 Å3(1) 4G0A|1|F
811NR_3.0_32785.1
Exact match
synthetic construct
4G0A|1|G (4G0A)
  • RNA (5'-R(P*GP*GP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.1 Å3(1) 4G0A|1|G
812NR_3.0_47227.1
Exact match
synthetic construct
4G0A|1|H (4G0A)
  • RNA (5'-R(P*GP*GP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.1 Å3(1) 4G0A|1|H
813NR_3.0_02089.1
Exact match
4G9Z|1|E+4G9Z|1|F (4G9Z)
  • RNA (5'-R(P*GP*CP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H; model(s): 1
2.0 Å4(1) 4G9Z|1|E+4G9Z|1|F
814NR_3.0_06970.1
Exact match
4GG4|1|H (4GG4)
  • RNA (5'-R(*AP*GP*AP*GP*AP*GP*AP*UP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.5 Å16(1) 4GG4|1|H
815NR_3.0_57733.1
Exact match
4H8K|1|C (4H8K)
  • RNA (5'-R(*CP*GP*AP*CP*AP*CP*CP*UP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.3 Å14(1) 4H8K|1|C
816NR_3.0_03341.1
Exact match
4HOR|1|X (4HOR)
  • RNA (5'-R(*(CTP)P*CP*CP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
1.9 Å5(1) 4HOR|1|X
817NR_3.0_65232.1
Exact match
4HOS|1|X (4HOS)
  • RNA (5'-R(*(UTP)P*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.0 Å3(1) 4HOS|1|X
818NR_3.0_43542.1
Exact match
4HOT|1|X (4HOT)
  • RNA (5'-R(*(ATP)P*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.5 Å3(1) 4HOT|1|X
819NR_3.0_12137.1
Exact match
4I67|1|B (4I67)
  • 5'-R(P*GP*GP*GP*(RPC))-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å3(1) 4I67|1|B
820NR_3.0_12719.1
Exact match
4IFD|1|R (4IFD)
  • RNA (45-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.8 Å30(1) 4IFD|1|R
821NR_3.0_30288.1
Exact match
4IG8|1|B+4IG8|1|C (4IG8)
  • RNA (5'-R(*GP*GP*CP*UP*UP*UP*UP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
2.7 Å18(1) 4IG8|1|B+4IG8|1|C
822NR_3.0_30547.1
Exact match
4II9|1|C (4II9)
  • RNA (5'-R(P*CP*CP*(A9Z))-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.7 Å2(1) 4II9|1|C
823NR_3.0_94888.1
Exact match
synthetic construct
4J7L|1|B (4J7L)
  • RNA (5'-R(P*UP*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å5(1) 4J7L|1|B
824NR_3.0_02412.1
Exact match
synthetic construct
4J7M|1|B (4J7M)
  • RNA (5'-R(P*UP*(U37)P*(U37)P*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.7 Å3(1) 4J7M|1|B
825NR_3.0_60906.1
Exact match
synthetic construct
4JAB|1|A+4JAB|1|B (4JAB)
  • RNA (5'-R(*GP*UP*GP*UP*AP*UP*AP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
2.2 Å8(1) 4JAB|1|A+4JAB|1|B
826NR_3.0_27306.1
Exact match
Lactobacillus rhamnosus
4JF2|1|A (4JF2)
  • PreQ1-II Riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å76(1) 4JF2|1|A
827NR_3.0_54538.1
Exact match
4JIY|1|A (4JIY)
  • 5'-(CGUACG)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.9 Å6(1) 4JIY|1|A
828NR_3.0_17580.1
Exact match
4JRT|1|A+4JRT|1|B (4JRT)
  • RNA (5'-R(P*GP*GP*GP*UP*GP*GP*UP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
2.6 Å12(1) 4JRT|1|A+4JRT|1|B
829NR_3.0_26582.1
Exact match
4K27|1|U (4K27)
  • Myotonic Dystrophy Type 2 RNA
  • X-RAY DIFFRACTION
  • Chain(s): U; model(s): 1
2.4 Å55(1) 4K27|1|U
830NR_3.0_77275.1
Exact match
4K31|1|B+4K31|1|C (4K31)
  • RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*UP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
1.4 Å22(1) 4K31|1|B+4K31|1|C
831NR_3.0_78931.1
Exact match
4KNQ|1|B (4KNQ)
  • 5'-R(P*CP*CP*GP*CP*CP*GP*CP*CP*GP*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å20(1) 4KNQ|1|B
832NR_3.0_55642.1
Exact match
4KQ0|1|B+4KQ0|1|E (4KQ0)
  • 5'-R(P*GP*GP*CP*GP*GP*CP*GP*GP*CP*GP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H; model(s): 1
2.1 Å19(1) 4KQ0|1|B+4KQ0|1|E
833NR_3.0_52747.1
Exact match
4KR6|1|C (4KR6)
  • RNA (39-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å39(1) 4KR6|1|C
834NR_3.0_53766.1
Exact match
4KR6|1|D (4KR6)
  • RNA (39-MER)
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.9 Å39(1) 4KR6|1|D
835NR_3.0_79645.1
Exact match
Spodoptera frugiperda
4KRE|1|R (4KRE)
  • RNA (5'-R(P*AP*AP*UP*AP*UP*UP*AP*AP*A*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
1.8 Å11(1) 4KRE|1|R
836NR_3.0_82818.1
Exact match
4KRF|1|R (4KRF)
  • RNA (5'-R(P*UP*GP*AP*GP*GP*UP*AP*GP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.1 Å12(1) 4KRF|1|R
837NR_3.0_24161.1
Exact match
Spodoptera frugiperda
4KXT|1|B (4KXT)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å12(1) 4KXT|1|B
838NR_3.0_41718.1
Exact match
4KYY|1|A+4KYY|1|B (4KYY)
  • RNA 17-mer
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
2.4 Å17(1) 4KYY|1|A+4KYY|1|B
839NR_3.0_12869.1
Exact match
4L81|1|A (4L81)
  • SAM-I/IV variant riboswitch aptamer doma[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å96(1) 4L81|1|A
840NR_3.0_60255.1
Exact match
4LMZ|1|B (4LMZ)
  • RNA (5'-R(*GP*CP*UP*GP*CP*GP*UP*AP*UP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å5(1) 4LMZ|1|B
841NR_3.0_52315.1
Exact match
4M4O|1|B (4M4O)
  • RNA (59-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å59(1) 4M4O|1|B
842NR_3.0_80423.1
Exact match
4MDX|1|C (4MDX)
  • RNA, mRNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.5 Å8(1) 4MDX|1|C
843NR_3.0_45527.1
Exact match
4N2Q|1|B (4N2Q)
  • RNA (5'-R(*AP*AP*GP*AP*AP*GP*AP*AP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å5(1) 4N2Q|1|B
844NR_3.0_29277.1
Exact match
4N2S|1|B (4N2S)
  • Zm1a-6 RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å4(1) 4N2S|1|B
845NR_3.0_35969.1
Exact match
4NGC|1|B (4NGC)
  • 5'-R(*GP*CP*GP*AP*AP*UP*UP*CP*GP*CP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.1 Å12(1) 4NGC|1|B
846NR_3.0_15462.1
Exact match
4NGG|1|B (4NGG)
  • 5'-R(*AP*GP*CP*GP*AP*AP*UP*UP*CP*GP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å13(1) 4NGG|1|B
847NR_3.0_73378.1
Exact match
4NH3|1|B (4NH3)
  • 5'-R(P*UP*GP*CP*GP*AP*AP*UP*UP*CP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å13(1) 4NH3|1|B
848NR_3.0_78685.1
Exact match
4NH5|1|B (4NH5)
  • 5'-R(P*UP*UP*GP*CP*GP*AP*AP*UP*UP*CP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å14(1) 4NH5|1|B
849NR_3.0_33125.1
Exact match
4NH6|1|B (4NH6)
  • 5'-R(P*UP*UP*UP*GP*CP*GP*AP*AP*UP*UP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å15(1) 4NH6|1|B
850NR_3.0_49228.1
Exact match
4OAV|1|A (4OAV)
  • RNA (5'-R(P*(PO4)P*(PO4)P*AP*AP*AP*AP*(P[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.1 Å4(1) 4OAV|1|A
851NR_3.0_16274.1
Exact match
4OAV|1|C (4OAV)
  • RNA (5'-R(P*(PO4)P*(PO4)P*AP*AP*AP*AP*(P[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.1 Å4(1) 4OAV|1|C
852NR_3.0_07579.1
Exact match
4OHZ|1|B (4OHZ)
  • RNA (5'-R(*GP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å4(1) 4OHZ|1|B
853NR_3.0_79951.1
Exact match
4OJI|1|A (4OJI)
  • RNA (52-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å53(1) 4OJI|1|A
854NR_3.0_91105.1
Exact match
4OOG|1|D (4OOG)
  • 34-mer RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.5 Å34(1) 4OOG|1|D
855NR_3.0_31561.1
Exact match
synthetic construct
4P3T|1|A+4P3T|1|B (4P3T)
  • 5'-D(*UP*UP*GP*CP*GP*UP*CP*CP*CP*GP*(5BU[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
1.6 Å22(1) 4P3T|1|A+4P3T|1|B
856NR_3.0_07169.1
Exact match
synthetic construct
4P3U|1|B+4P3U|1|A (4P3U)
  • 5'-R(*UP*UP*GP*CP*GP*UP*CP*UP*CP*GP*(5BU[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
3.0 Å21(1) 4P3U|1|B+4P3U|1|A
857NR_3.0_26059.1
Exact match
synthetic construct
4P3U|1|C+4P3U|1|D (4P3U)
  • 5'-R(*UP*UP*GP*CP*GP*UP*CP*UP*CP*GP*(5BU[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
3.0 Å21(1) 4P3U|1|C+4P3U|1|D
858NR_3.0_42932.1
Exact match
synthetic construct
4P43|1|B+4P43|1|A (4P43)
  • 5'-R(*UP*UP*GP*CP*GP*UP*CP*UP*CP*GP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
2.0 Å23(1) 4P43|1|B+4P43|1|A
859NR_3.0_02656.1
Exact match
Turnip yellow mosaic virus
4P5J|1|A (4P5J)
  • Turnip yellow mosaic virus mRNA for the [...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å83(1) 4P5J|1|A
860NR_3.0_18718.1
Exact match
synthetic construct
4PDB|1|I (4PDB)
  • SELEX RNA aptamer
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
2.6 Å38(1) 4PDB|1|I
861NR_3.0_06133.1
Exact match
synthetic construct
4PEH|1|Z (4PEH)
  • RNA (5'-R(*CP*UP*AP*(A2P)P*AP*CP*AP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
2.1 Å3(1) 4PEH|1|Z
862NR_3.0_24202.1
Exact match
Homo sapiens
4PKD|1|V (4PKD)
  • U1 snRNA stem-loops 1 and 2 (55-MER)
  • X-RAY DIFFRACTION
  • Chain(s): V; model(s): 1
2.5 Å54(1) 4PKD|1|V
863NR_3.0_72021.1
Exact match
Murray Valley encephalitis virus
4PQV|1|A (4PQV)
  • XRN1-resistant flaviviral RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.5 Å68(1) 4PQV|1|A
864NR_3.0_09431.1
Exact match
4PR6|1|B (4PR6)
  • HDV RIBOZYME SELF-CLEAVED
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å74(1) 4PR6|1|B
865NR_3.0_33669.1
Exact match
4PY5|1|B (4PY5)
  • 5'-R(*GP*AP*GP*UP*GP*CP*GP*AP*CP*AP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.1 Å19(1) 4PY5|1|B
866NR_3.0_65762.1
Exact match
4Q5S|1|I (4Q5S)
  • RNA (5'-R(P*CP*UP*CP*AP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
3.0 Å5(1) 4Q5S|1|I
867NR_3.0_19188.1
Exact match
Homo sapiens
4QEI|1|C (4QEI)
  • tRNA-Gly-CCC-2-2
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å68(1) 4QEI|1|C
868NR_3.0_13250.1
Exact match
4QIK|1|C+4QIK|1|D (4QIK)
  • 5'-R(*AP*C*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
1.9 Å18(1) 4QIK|1|C+4QIK|1|D
869NR_3.0_18913.1
Exact match
4QPX|1|P+4QPX|1|T (4QPX)
  • RNA (5'-R(*UP*GP*CP*CP*CP*GP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H, P, T; model(s): 1
1.9 Å8(1) 4QPX|1|P+4QPX|1|T
870NR_3.0_98920.1
Exact match
synthetic construct
4QU6|1|B (4QU6)
  • RNA 5'-(*AP*GP*GP*GP*UP*GP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å3(1) 4QU6|1|B
871NR_3.0_47084.1
Exact match
Escherichia coli
4QVC|1|G (4QVC)
  • RNA (5'-R(*AP*U*AP*AP*CP*UP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.0 Å4(1) 4QVC|1|G
872NR_3.0_78430.1
Exact match
Escherichia coli
4QVD|1|H (4QVD)
  • RNA (5'-R(*AP*AP*CP*UP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.0 Å4(1) 4QVD|1|H
873NR_3.0_37244.1
Exact match
synthetic construct
4R3I|0|B (4R3I)
  • RNA (5'-R(*GP*GP*(6MZ)P*CP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 0
1.8 Å4(1) 4R3I|0|B
874NR_3.0_50652.1
Exact match
synthetic construct
4RBY|1|A (4RBY)
  • 5'-R(*CP*GP*CP*(2SG)P*AP*AP*UP*UP*AP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.2 Å13(1) 4RBY|1|A
875NR_3.0_12687.1
Exact match
synthetic construct
4RBZ|1|A (4RBZ)
  • 5'-R(*CP*GP*CP*GP*(A2M)P*(ADS)P*UP*UP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.2 Å16(1) 4RBZ|1|A
876NR_3.0_47141.1
Exact match
synthetic construct
4RC0|1|A (4RC0)
  • 5'-R(*CP*GP*CP*GP*AP*AP*UP*UP*(A2M)P*(2S[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å16(1) 4RC0|1|A
877NR_3.0_80112.1
Exact match
synthetic construct
4RCJ|1|B (4RCJ)
  • RNA (5'-R(*GP*GP*(6MZ)P*CP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.6 Å4(1) 4RCJ|1|B
878NR_3.0_42401.1
Exact match
Thermus thermophilus
4RDX|1|C (4RDX)
  • tRNA(his)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.6 Å76(1) 4RDX|1|C
879NR_3.0_09702.1
Exact match
synthetic construct
4RJ1|1|B (4RJ1)
  • RNA (5'-R(*UP*GP*GP*GP*GP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
0.9 Å6(1) 4RJ1|1|B
880NR_3.0_88154.1
Exact match
synthetic construct
4RUM|1|A (4RUM)
  • NiCo riboswitch RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.6 Å92(1) 4RUM|1|A
881NR_3.0_37714.1
Exact match
Faecalibacterium prausnitzii
4RZD|1|A (4RZD)
  • PreQ1-III Riboswitch (Class 3)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å98(1) 4RZD|1|A
882NR_3.0_45210.1
Exact match
Saccharomyces cerevisiae
4TYW|1|B (4TYW)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å7(1) 4TYW|1|B
883NR_3.0_21747.1
Exact match
Saccharomyces cerevisiae
4TYY|1|B (4TYY)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å9(1) 4TYY|1|B
884NR_3.0_20784.1
Exact match
Saccharomyces cerevisiae
4TZ0|1|B (4TZ0)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å7(1) 4TZ0|1|B
885NR_3.0_50990.1
Exact match
synthetic construct
4U34|1|B+4U34|1|A (4U34)
  • RNA (5'-R(*GP*GP*AP*GP*CP*UP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
1.4 Å7(1) 4U34|1|B+4U34|1|A
886NR_3.0_61167.1
Exact match
synthetic construct
4U35|1|B+4U35|1|A (4U35)
  • RNA (5'-R(*GP*GP*UP*GP*CP*UP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
1.6 Å7(1) 4U35|1|B+4U35|1|A
887NR_3.0_83036.1
Exact match
synthetic construct
4W5N|1|B (4W5N)
  • RNA (5'-R(P*UP*UP*CP*AP*CP*AP*UP*UP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å18(1) 4W5N|1|B
888NR_3.0_27096.1
Exact match
Bacillus subtilis
4WFL|1|A (4WFL)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.5 Å105(1) 4WFL|1|A
889NR_3.0_74156.3
Exact match
Influenza B virus
4WRT|1|V+4WRT|1|R (4WRT)
  • Influenza virus polymerase vRNA promoter[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H, R, V; model(s): 1
2.7 Å14(1) 4WRT|1|V+4WRT|1|R
890NR_3.0_29002.1
Exact match
unidentified influenza virus
4WSB|1|V+4WSB|1|R (4WSB)
  • Influenza A polymerase vRNA promoter 5' [...]
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H, R, V; model(s): 1
2.7 Å16(1) 4WSB|1|V+4WSB|1|R
891NR_3.0_83415.1
Exact match
synthetic construct
4WTC|1|T+4WTC|1|P (4WTC)
  • RNA PRIMER TEMPLATE AGAAAUUU
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H, P, T; model(s): 1
2.8 Å8(1) 4WTC|1|T+4WTC|1|P
892NR_3.0_02402.1
Exact match
synthetic construct
4WTE|1|T+4WTE|1|P (4WTE)
  • RNA PRIMER TEMPLATE ACAAAUUU
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H, P, T; model(s): 1
2.9 Å8(1) 4WTE|1|T+4WTE|1|P
893NR_3.0_01782.1
Exact match
synthetic construct
4WTI|1|T+4WTI|1|P (4WTI)
  • RNA TEMPLATE ACGG
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H, P, T; model(s): 1
2.8 Å4(1) 4WTI|1|T+4WTI|1|P
894NR_3.0_98152.1
Exact match
synthetic construct
4WTJ|1|T+4WTJ|1|P (4WTJ)
  • RNA TEMPLATE AUCC
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H, P, T; model(s): 1
2.2 Å4(1) 4WTJ|1|T+4WTJ|1|P
895NR_3.0_61884.1
Exact match
synthetic construct
4WTK|1|T+4WTK|1|P (4WTK)
  • RNA TEMPLATE AGCC
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H, P, T; model(s): 1
2.5 Å4(1) 4WTK|1|T+4WTK|1|P
896NR_3.0_82735.1
Exact match
synthetic construct
4WTL|1|T+4WTL|1|P (4WTL)
  • RNA TEMPLATE UACC
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H, P, T; model(s): 1
2.0 Å4(1) 4WTL|1|T+4WTL|1|P
897NR_3.0_70063.1
Exact match
synthetic construct
4WTM|1|T+4WTM|1|P (4WTM)
  • RNA TEMPLATE UAGG
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H, P, T; model(s): 1
2.2 Å4(1) 4WTM|1|T+4WTM|1|P
898NR_3.0_39179.1
Exact match
synthetic construct
4WZM|1|B+4WZM|1|C (4WZM)
  • RNA template
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
2.5 Å8(1) 4WZM|1|B+4WZM|1|C
899NR_3.0_77778.1
Exact match
synthetic construct
4WZQ|1|B+4WZQ|1|C (4WZQ)
  • RNA template
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
2.8 Å8(1) 4WZQ|1|B+4WZQ|1|C
900NR_3.0_37566.1
Exact match
synthetic construct
4X2B|1|B+4X2B|1|C (4X2B)
  • RNA template
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
2.9 Å7(1) 4X2B|1|B+4X2B|1|C
901NR_3.0_33059.1
Exact match
Homo sapiens
4X4U|1|G (4X4U)
  • human MenBeta minihelix
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.7 Å18(1) 4X4U|1|G
902NR_3.0_36229.1
Exact match
Homo sapiens
4XBF|1|D (4XBF)
  • RNA (5'-R(*UP*UP*AP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.8 Å5(1) 4XBF|1|D
903NR_3.0_81309.1
Exact match
synthetic construct
4XK0|1|A (4XK0)
  • RNA (5'-(*UP*GP*GP*GP*GP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å6(1) 4XK0|1|A
904NR_3.0_70938.1
Exact match
Homo sapiens
4XW0|1|A+4XW0|1|B (4XW0)
  • RNA (5'-R(*GP*CP*CP*UP*(LCG)P*CP*CP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
1.8 Å9(1) 4XW0|1|A+4XW0|1|B
905NR_3.0_03183.1
Exact match
Homo sapiens
4XW1|1|C (4XW1)
  • RNA (5'-R(*GP*CP*CP*UP*(LCG)P*CP*CP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.3 Å8(1) 4XW1|1|C
906NR_3.0_09504.1
Exact match
synthetic construct
4XWW|1|D (4XWW)
  • RNA (5'-D(UP*UP*UP*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.7 Å7(1) 4XWW|1|D
907NR_3.0_64642.1
Exact match
synthetic construct
4XWW|1|E (4XWW)
  • RNA (5'-D(UP*UP*UP*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.7 Å7(1) 4XWW|1|E
908NR_3.0_51962.2
Exact match
Escherichia coli
4YCP|1|B (4YCP)
  • tRNATrp
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å62(1) 4YCP|1|B
909NR_3.0_45187.1
Exact match
synthetic construct
4YOE|1|E (4YOE)
  • RNA AGU
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.9 Å3(1) 4YOE|1|E
910NR_3.0_73713.1
Exact match
Homo sapiens
4Z31|1|C+4Z31|1|D (4Z31)
  • RNA (5'-R(*A)-D(P*UP*GP*UP*UP*CP*UP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
2.5 Å14(1) 4Z31|1|C+4Z31|1|D
911NR_3.0_10920.1
Exact match
Homo sapiens
4ZLD|1|B (4ZLD)
  • RNA (5'-R(*UP*AP*AP*CP*UP*UP*CP*UP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.6 Å17(1) 4ZLD|1|B
912NR_3.0_20306.1
Exact match
synthetic construct
4ZLR|1|C (4ZLR)
  • RNA (5'-R(*UP*UP*GP*UP*UP*GP*UP*UP*UP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.3 Å14(1) 4ZLR|1|C
913NR_3.0_66843.1
Exact match
California encephalitis orthobunyavirus
5AMQ|1|C (5AMQ)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.0 Å10(1) 5AMQ|1|C
914NR_3.0_51248.1
Exact match
Candida albicans
5BUD|1|D (5BUD)
  • RNA (5'-R(P*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.0 Å4(1) 5BUD|1|D
915NR_3.0_91461.1
Exact match
Candida albicans
5BUD|1|E (5BUD)
  • RNA (5'-R(P*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.0 Å5(1) 5BUD|1|E
916NR_3.0_08637.1
Exact match
synthetic construct
5BZ1|1|B (5BZ1)
  • RNA (5'-R(*UP*GP*UP*AP*UP*UP*UP*GP*UP*A)[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å11(1) 5BZ1|1|B
917NR_3.0_86160.1
Exact match
synthetic construct
5BZ5|1|B (5BZ5)
  • RNA (5'-R(*UP*GP*UP*AP*AP*CP*UP*UP*UP*A)[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å10(1) 5BZ5|1|B
918NR_3.0_85126.1
Exact match
synthetic construct
5BZU|1|B (5BZU)
  • UGUAAUA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å8(1) 5BZU|1|B
919NR_3.0_09580.1
Exact match
synthetic construct
5C0Y|1|C (5C0Y)
  • poly U RNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.1 Å5(1) 5C0Y|1|C
920NR_3.0_19677.1
Exact match
synthetic construct
5C0Y|1|D (5C0Y)
  • poly U RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.1 Å9(1) 5C0Y|1|D
921NR_3.0_09579.1
Exact match
5C5W|1|A (5C5W)
  • RNA (5'-R(P*CP*CP*UP*GP*AP*GP*UP*UP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.3 Å22(1) 5C5W|1|A
922NR_3.0_30196.1
Exact match
Tetrahymena thermophila
5C9H|1|C+5C9H|1|D (5C9H)
  • RNA (5'-R(P*UP*CP*AP*UP*UP*CP*AP*GP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
3.0 Å12(1) 5C9H|1|C+5C9H|1|D
923NR_3.0_77791.1
Exact match
Tetrahymena thermophila
5C9H|1|G+5C9H|1|E (5C9H)
  • RNA (5'-R(P*UP*CP*AP*UP*UP*CP*AP*GP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H; model(s): 1
3.0 Å11(1) 5C9H|1|G+5C9H|1|E
924NR_3.0_90823.1
Exact match
Escherichia coli
5D0B|1|F (5D0B)
  • RNA (5'-D(*GP*CP*AP*GP*AP*CP*UP*(56B)P*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.6 Å16(1) 5D0B|1|F
925NR_3.0_98593.1
Exact match
Methanocaldococcus jannaschii
5D8H|1|A (5D8H)
  • 23S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å74(1) 5D8H|1|A
926NR_3.0_89128.1
Exact match
Homo sapiens
5DET|1|P (5DET)
  • RNA (5'-R(*UP*CP*AP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.0 Å4(1) 5DET|1|P
927NR_3.0_45166.1
Exact match
Homo sapiens
5DET|1|Q (5DET)
  • RNA (5'-R(P*UP*CP*AP*CP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
2.0 Å5(1) 5DET|1|Q
928NR_3.0_63343.1
Exact match
Schizosaccharomyces pombe
5DNO|1|B (5DNO)
  • RNA (5'-R(*CP*UP*UP*AP*AP*AP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å7(1) 5DNO|1|B
929NR_3.0_38685.1
Exact match
Dengue virus
5DTO|1|B (5DTO)
  • RNA (5'-R(P*AP*GP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å4(1) 5DTO|1|B
930NR_3.0_43394.1
Exact match
synthetic construct
5E3H|1|B+5E3H|1|C (5E3H)
  • RNA (5'-R(*CP*GP*AP*CP*GP*CP*UP*AP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
2.7 Å12(1) 5E3H|1|B+5E3H|1|C
931NR_3.0_40750.1
Exact match
Mus musculus
5ELH|1|R (5ELH)
  • RNA (5'-R(*UP*UP*AP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
1.8 Å5(1) 5ELH|1|R
932NR_3.0_55334.1
Exact match
Mus musculus
5ELK|1|R (5ELK)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.3 Å6(1) 5ELK|1|R
933NR_3.0_98212.1
Exact match
synthetic construct
5ELR|1|B (5ELR)
  • RNA (5'-R(*AP*AP*UP*AP*AP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å5(1) 5ELR|1|B
934NR_3.0_51148.1
Exact match
synthetic construct
5ELS|1|H (5ELS)
  • RNA (5'-R(P*AP*AP*AP*UP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.9 Å6(1) 5ELS|1|H
935NR_3.0_26105.1
Exact match
synthetic construct
5ELS|1|I (5ELS)
  • RNA (5'-R(P*AP*AP*AP*UP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
2.9 Å6(1) 5ELS|1|I
936NR_3.0_54156.1
Exact match
Homo sapiens
5EME|1|A (5EME)
  • RNA (5'-R(*GP*CP*AP*GP*CP*AP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.2 Å18(1) 5EME|1|A
937NR_3.0_43988.1
Exact match
Homo sapiens
5EMF|1|A (5EMF)
  • RNA (5'-R(*GP*CP*UP*GP*CP*UP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å15(1) 5EMF|1|A
938NR_3.0_15161.1
Exact match
Homo sapiens
5EN1|1|B (5EN1)
  • RNA (5'-R(*AP*GP*GP*AP*CP*UP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å7(1) 5EN1|1|B
939NR_3.0_28023.1
Exact match
5EX7|1|B (5EX7)
  • RNA (5'-R(P*UP*UP*UP*GP*UP*UP*GP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å7(1) 5EX7|1|B
940NR_3.0_39506.1
Exact match
Mus musculus
5F5F|1|F (5F5F)
  • RNA (5'-R(P*UP*GP*AP*CP*UP*GP*CP*GP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.0 Å20(1) 5F5F|1|F
941NR_3.0_89230.1
Exact match
Mus musculus
5F5H|1|C (5F5H)
  • RNA (5'-R(P*CP*CP*AP*CP*AP*CP*CP*GP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.2 Å21(1) 5F5H|1|C
942NR_3.0_58991.1
Exact match
Mus musculus
5F5H|1|D (5F5H)
  • RNA (5'-R(P*CP*CP*AP*CP*AP*CP*CP*GP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.2 Å21(1) 5F5H|1|D
943NR_3.0_58041.1
Exact match
Escherichia coli
5F6C|1|E (5F6C)
  • RNA (5'-R(P*GP*UP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.0 Å3(1) 5F6C|1|E
944NR_3.0_16594.1
Exact match
Haloarcula marismortui
5G4T|1|A+5G4T|1|B (5G4T)
  • HMKT-7
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
2.8 Å11(1) 5G4T|1|A+5G4T|1|B
945NR_3.0_48507.1
Exact match
synthetic construct
5GJB|1|B (5GJB)
  • RNA (5'-R(*AP*GP*AP*UP*CP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.7 Å5(1) 5GJB|1|B
946NR_3.0_83946.1
Exact match
Bombyx mori
5GUH|1|B (5GUH)
  • RNA (28-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å7(1) 5GUH|1|B
947NR_3.0_05778.1
Exact match
Homo sapiens
5GXH|1|B (5GXH)
  • RNA (5'-R(*A*AP*UP*UP*UP*UP*UP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å7(1) 5GXH|1|B
948NR_3.0_24908.1
Exact match
Homo sapiens
5GXI|1|B (5GXI)
  • RNA (5'-R(*A*AP*UP*UP*UP*UP*UP*GP*AP*G)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å5(1) 5GXI|1|B
949NR_3.0_69774.1
Exact match
Homo sapiens
5H1K|1|C+5H1K|1|D (5H1K)
  • U4 snRNA (5'-R(*GP*CP*AP*AP*UP*UP*UP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
1.9 Å13(1) 5H1K|1|C+5H1K|1|D
950NR_3.0_67036.1
Exact match
Homo sapiens
5H1L|1|B (5H1L)
  • U4 snRNA (5'-R(*AP*UP*UP*UP*UP*UP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.1 Å7(1) 5H1L|1|B
951NR_3.0_20024.1
Exact match
Homo sapiens
5H3U|1|C (5H3U)
  • RNA (5'-R(*AP*AP*UP*UP*UP*UP*UP*GP*AP*C)[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.5 Å7(1) 5H3U|1|C
952NR_3.0_70313.2
Exact match
Escherichia coli
5H9F|1|L (5H9F)
  • crRNA (61-MER)
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
2.5 Å60(1) 5H9F|1|L
953NR_3.0_20856.1
Exact match
Mycobacterium tuberculosis
5HJZ|1|C (5HJZ)
  • RNA (5'-R(*CP*AP*UP*C)-D(P*U)-R(P*AP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.0 Å4(1) 5HJZ|1|C
954NR_3.0_84831.1
Exact match
Mycobacterium tuberculosis
5HKC|1|C (5HKC)
  • RNA (5'-R(*GP*UP*C)-D(P*U)-R(P*CP*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.7 Å1(1) 5HKC|1|C
955NR_3.0_14212.1
Exact match
synthetic construct
5HO4|1|B (5HO4)
  • RNA (5'-R(*AP*AP*GP*GP*AP*CP*UP*AP*GP*C)[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å10(1) 5HO4|1|B
956NR_3.0_38769.1
Exact match
synthetic construct
5I9D|1|B (5I9D)
  • RNA (5'-R(*GP*GP*GP*G*UP*UP*UP*UP*AP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å11(1) 5I9D|1|B
957NR_3.0_66760.1
Exact match
synthetic construct
5I9F|1|F (5I9F)
  • RNA (5'-R(*GP*GP*GP*GP*UP*UP*UP*UP*UP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.2 Å11(1) 5I9F|1|F
958NR_3.0_00518.1
Exact match
synthetic construct
5I9G|1|A (5I9G)
  • RNA (5'-R(*GP*GP*G*GP*UP*UP*UP*UP*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å12(1) 5I9G|1|A
959NR_3.0_36938.1
Exact match
synthetic construct
5I9H|1|B (5I9H)
  • RNA (5'-R(*GP*GP*GP*GP*UP*UP*UP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å11(1) 5I9H|1|B
960NR_3.0_61479.1
Exact match
Thermus thermophilus
5IBB|1|1L (5IBB)
  • tRNAVal
  • X-RAY DIFFRACTION
  • Chain(s): 1L; model(s): 1
3.0 Å67(1) 5IBB|1|1L
961NR_3.0_09192.1
Exact match
synthetic construct
5ID6|1|G (5ID6)
  • RNA (5'-R(P*AP*AP*UP*UP*UP*CP*UP*AP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.4 Å21(1) 5ID6|1|G
962NR_3.0_53856.1
Exact match
synthetic construct
5JBG|1|X (5JBG)
  • RNA (5'-R(*GPPP*GP*AP*GP*CP*GP*UP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.0 Å22(1) 5JBG|1|X
963NR_3.0_52870.1
Exact match
unidentified
5JC7|1|X+5JC7|1|Y (5JC7)
  • RNA (5'-R(P*GP*GP*AP*CP*GP*UP*CP*AP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H, X, Y; model(s): 1
2.8 Å24(1) 5JC7|1|X+5JC7|1|Y
964NR_3.0_16377.1
Exact match
unidentified
5JCF|1|Y+5JCF|1|X (5JCF)
  • RNA (5'-R(P*AP*GP*GP*UP*AP*CP*GP*UP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H, X, Y; model(s): 1
2.6 Å11(1) 5JCF|1|Y+5JCF|1|X
965NR_3.0_71119.1
Exact match
synthetic construct
5JEA|1|R (5JEA)
  • RNA (29-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.7 Å27(1) 5JEA|1|R
966NR_3.0_51249.1
Exact match
synthetic construct
5JJI|1|G (5JJI)
  • rU12: 5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.6 Å7(1) 5JJI|1|G
967NR_3.0_89476.1
Exact match
unidentified
5JRC|1|E (5JRC)
  • ssRNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.9 Å7(1) 5JRC|1|E
968NR_3.0_26975.1
Exact match
synthetic construct
5JS1|1|B (5JS1)
  • siRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å10(1) 5JS1|1|B
969NR_3.0_55504.1
Exact match
Foot-and-mouth disease virus
5JXS|1|B+5JXS|1|C (5JXS)
  • RNA Template
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
2.8 Å8(1) 5JXS|1|B+5JXS|1|C
970NR_3.0_46370.1
Exact match
synthetic construct
5K8H|1|A (5K8H)
  • RNA 7-mer
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å2(1) 5K8H|1|A
971NR_3.0_35200.1
Exact match
Homo sapiens
5KI6|1|B (5KI6)
  • miR-122
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å9(1) 5KI6|1|B
972NR_3.0_11837.1
Exact match
Drosophila melanogaster
5KLA|1|B (5KLA)
  • RNA (5'-R(*UP*GP*UP*AP*CP*AP*UP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.1 Å8(1) 5KLA|1|B
973NR_3.0_74174.1
Exact match
unidentified
5KPY|1|A (5KPY)
  • 5-hydroxytryptophan RNA aptamer
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å71(1) 5KPY|1|A
974NR_3.0_43598.1
Exact match
synthetic construct
5KVJ|1|A+5KVJ|1|B (5KVJ)
  • RNA (5'-R(P*CP*CP*AP*UP*CP*CP*UP*CP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
2.3 Å16(1) 5KVJ|1|A+5KVJ|1|B
975NR_3.0_30489.1
Exact match
Homo sapiens
5LQO|1|A+5LQO|1|B (5LQO)
  • RNA (5'-R(*GP*(CBV)P*CP*GP*GP*AP*CP*GP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
1.9 Å9(1) 5LQO|1|A+5LQO|1|B
976NR_3.0_49696.1
Exact match
Homo sapiens
5LQT|1|A+5LQT|1|B (5LQT)
  • RNA (5'-R(*GP*(CBV)P*CP*GP*GP*(6MZ)P*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
1.5 Å8(1) 5LQT|1|A+5LQT|1|B
977NR_3.0_72319.1
Exact match
Homo sapiens
5LR3|1|A+5LR3|1|B (5LR3)
  • RNA (5'-R(*GP*(CBV)P*CP*GP*GP*AP*UP*GP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
1.7 Å9(1) 5LR3|1|A+5LR3|1|B
978NR_3.0_08929.1
Exact match
synthetic construct
5LTA|1|E (5LTA)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.6 Å11(1) 5LTA|1|E
979NR_3.0_66328.1
Exact match
Saccharomyces cerevisiae
5M0H|1|A (5M0H)
  • ASH1 E3 (42 nt-TL/TLR)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å42(1) 5M0H|1|A
980NR_3.0_90603.1
Exact match
Saccharomyces cerevisiae
5M0I|1|E (5M0I)
  • ASH1-E3 element, RNA (28-MER)
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.4 Å28(1) 5M0I|1|E
981NR_3.0_86202.1
Exact match
Saccharomyces cerevisiae
5M0I|1|F (5M0I)
  • ASH1-E3 element, RNA (28-MER)
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.4 Å28(1) 5M0I|1|F
982NR_3.0_57646.1
Exact match
Saccharomyces cerevisiae
5M0J|1|E (5M0J)
  • ASH1 E3 (28 nt-loop)
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.8 Å28(1) 5M0J|1|E
983NR_3.0_78625.1
Exact match
Saccharomyces cerevisiae
5M0J|1|F (5M0J)
  • ASH1 E3 (28 nt-loop)
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.8 Å28(1) 5M0J|1|F
984NR_3.0_63925.1
Exact match
Influenza A virus
5M3H|1|V+5M3H|1|R (5M3H)
  • RNA 5'-pAGUAGUAACAAGAGGG
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H, R, V; model(s): 1
2.5 Å16(1) 5M3H|1|V+5M3H|1|R
985NR_3.0_38180.1
Exact match
Zika virus
5MFX|1|B (5MFX)
  • RNA (5'-R(P*AP*GP*AP*CP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.6 Å5(1) 5MFX|1|B
986NR_3.0_18854.1
Exact match
Francisella tularensis
5MGA|1|B (5MGA)
  • RNA (40-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å40(1) 5MGA|1|B
987NR_3.0_21041.1
Exact match
Homo sapiens
5MWI|1|A (5MWI)
  • RNA G(CUG)8C duplex
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.5 Å28(1) 5MWI|1|A
988NR_3.0_11028.1
Exact match
5O1Y|1|B (5O1Y)
  • RNA (5'-R(*GP*UP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å4(1) 5O1Y|1|B
989NR_3.0_85498.1
Exact match
Homo sapiens
5O3J|1|B (5O3J)
  • RNA (5'-R(P*UP*UP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å3(1) 5O3J|1|B
990NR_3.0_23975.1
Exact match
Shewanella putrefaciens
5O7H|1|A (5O7H)
  • crRNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å43(1) 5O7H|1|A
991NR_3.0_22466.1
Exact match
Leishmania donovani
5T2A|1|2 (5T2A)
  • 18S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
2.9 Å1814(1) 5T2A|1|2
992NR_3.0_29429.1
Exact match
Leishmania donovani
5T2A|1|B (5T2A)
  • LSU-beta
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
2.9 Å1064(1) 5T2A|1|B
993NR_3.0_17575.1
Exact match
Leishmania donovani
5T2A|1|E (5T2A)
  • srRNA1
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
2.9 Å169(1) 5T2A|1|E
994NR_3.0_51521.1
Exact match
Leishmania donovani
5T2A|1|F (5T2A)
  • srRNA3
  • ELECTRON MICROSCOPY
  • Chain(s): F; model(s): 1
2.9 Å71(1) 5T2A|1|F
995NR_3.0_59892.1
Exact match
Leishmania donovani
5T2A|1|H (5T2A)
  • srRNA4
  • ELECTRON MICROSCOPY
  • Chain(s): H; model(s): 1
2.9 Å93(1) 5T2A|1|H
996NR_3.0_25467.1
Exact match
Trypanosoma cruzi
5T5H|1|A+5T5H|1|C (5T5H)
  • RNA LARGE SUBUNIT ALPHA
  • ELECTRON MICROSCOPY
  • Chain(s): A, B, C, D, E, F, G, H; model(s): 1
2.5 Å1246(1) 5T5H|1|A+5T5H|1|C
997NR_3.0_97060.1
Exact match
Trypanosoma cruzi
5T5H|1|B (5T5H)
  • RNA LARGE SUBUNIT BETA,RNA LARGE SUBUNIT[...]
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
2.5 Å910(1) 5T5H|1|B
998NR_3.0_54575.1
Exact match
Trypanosoma cruzi
5T5H|1|D (5T5H)
  • 5S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
2.5 Å114(1) 5T5H|1|D
999NR_3.0_26892.1
Exact match
Trypanosoma cruzi
5T5H|1|E (5T5H)
  • srRNA1,srRNA1
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
2.5 Å146(1) 5T5H|1|E
1000NR_3.0_90150.1
Exact match
Trypanosoma cruzi
5T5H|1|G (5T5H)
  • srRNA2,srRNA2
  • ELECTRON MICROSCOPY
  • Chain(s): G; model(s): 1
2.5 Å120(1) 5T5H|1|G
1001NR_3.0_79575.1
Exact match
Trypanosoma cruzi
5T5H|1|H (5T5H)
  • srRNA4,srRNA4
  • ELECTRON MICROSCOPY
  • Chain(s): H; model(s): 1
2.5 Å91(1) 5T5H|1|H
1002NR_3.0_30259.1
Exact match
Mus musculus
5T7B|1|R (5T7B)
  • RNA (UVP)UAUAGAGCAAGAACACUGUU
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.5 Å10(1) 5T7B|1|R
1003NR_3.0_91539.1
Exact match
Sulfobacillus acidophilus
5T83|1|A (5T83)
  • RNA (95-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å90(1) 5T83|1|A
1004NR_3.0_01439.1
Exact match
Zika virus
5TPY|1|A (5TPY)
  • RNA (71-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å71(1) 5TPY|1|A
1005NR_3.0_34246.1
Exact match
Norwalk virus
5TSN|1|P+5TSN|1|T (5TSN)
  • RNA (5'-R(*UP*GP*CP*CP*CP*GP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H, P, T; model(s): 1
2.1 Å8(1) 5TSN|1|P+5TSN|1|T
1006NR_3.0_04754.1
Exact match
Dickeya dadantii
5U3G|1|B (5U3G)
  • ykkC riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å84(1) 5U3G|1|B
1007NR_3.0_68259.1
Exact match
Homo sapiens
5UNE|1|A+5UNE|1|B (5UNE)
  • RNA (47-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
2.9 Å47(1) 5UNE|1|A+5UNE|1|B
1008NR_3.0_30079.1
Exact match
synthetic construct
5V1K|1|A+5V1K|1|B (5V1K)
  • RNA (5'-R(*CP*GP*CP*GP*AP*AP*(5BU)P*(8RJ[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
1.2 Å10(1) 5V1K|1|A+5V1K|1|B
1009NR_3.0_74928.1
Exact match
Homo sapiens
5V7C|1|C (5V7C)
  • RNA (5'-R(*CP*UP*UP*UP*UP*CP*CP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.6 Å8(1) 5V7C|1|C
1010NR_3.0_19387.1
Exact match
synthetic construct
5W0O|1|C+5W0O|1|D (5W0O)
  • double-stranded RNA
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
2.5 Å15(1) 5W0O|1|C+5W0O|1|D
1011NR_3.0_80035.1
Exact match
Spodoptera frugiperda
5W6V|1|R (5W6V)
  • RNA (5'-R(P*AP*AP*UP*AP*UP*UP*AP*AP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.8 Å10(1) 5W6V|1|R
1012NR_3.0_90696.1
Exact match
Leptotrichia shahii
5WTK|1|B (5WTK)
  • RNA (58-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å40(1) 5WTK|1|B
1013NR_3.0_66547.1
Exact match
Saccharomyces cerevisiae
5WTY|1|C (5WTY)
  • RNA (5'-R(*AP*AP*AP*GP*GP*AP*AP*UP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å11(1) 5WTY|1|C
1014NR_3.0_63837.1
Exact match
Saccharomyces cerevisiae
5WTY|1|D (5WTY)
  • RNA (5'-R(*AP*AP*AP*GP*GP*AP*AP*UP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.8 Å11(1) 5WTY|1|D
1015NR_3.0_29370.1
Exact match
synthetic construct
5WWW|1|B (5WWW)
  • RNA (5'-R(*GP*UP*UP*UP*AP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å6(1) 5WWW|1|B
1016NR_3.0_14761.1
Exact match
synthetic construct
5WWX|1|C (5WWX)
  • RNA (5'-R(P*AP*GP*AP*GP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.0 Å5(1) 5WWX|1|C
1017NR_3.0_88000.1
Exact match
synthetic construct
5XOG|1|P (5XOG)
  • RNA (5'-R(*UP*UP*UP*UP*UP*UP*UP*AP*UP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.0 Å11(1) 5XOG|1|P
1018NR_3.0_31286.1
Exact match
6MSF|1|R (6MSF)
  • RNA (5'-R(*CP*CP*AP*CP*AP*GP*UP*CP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.8 Å14(1) 6MSF|1|R
1019NR_3.0_11942.1
Exact match
6MSF|1|S (6MSF)
  • RNA (5'-R(*CP*AP*GP*UP*CP*AP*CP*UP*GP*G)[...]
  • X-RAY DIFFRACTION
  • Chain(s): S; model(s): 1
2.8 Å10(1) 6MSF|1|S