#IFECompound(s)RNA source organismTitleMethodResolutionDate
11QWB|A (rep)NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12SOLUTION NMR2003-11-25

Release history



This classParent classesRelease idIntersectionAdded to this classOnly in parent


This class Descendant classesRelease idIntersectionOnly in this classAdded to child

Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. Instances are ordered to put similar structures near each other. The colorbar ranges from 0 to the maximum observed discrepancy, up to 0.5

#S - ordering by similarity (same as in the heat map).