Motif HL_42986.1 Version HL_42986.1 of this group appears in releases 3.99 to 4.7
| #S | Loop id | PDB | Disc | #Non-core | Chain(s) | Standardized name for chain | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 1-19 | 14-18 | |||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | HL_9CFN_003 | 9CFN | 0.0000 | 1 | B | RNA (59-MER) | C | 11 | A | 12 | A | 13 | G | 14 | C | 16 | C | 17 | U | 18 | A | 19 | C | 20 | A | 21 | G | 22 | G | 23 | U | 24 | U | 25 | G | 26 | G | 27 | A | 28 | A | 29 | G | 30 | cWW | tWH |
3D structures
Complete motif including flanking bases
| Sequence | Counts |
|---|---|
| CAAGCCCUACAGGUUGGAAG | 1 |
Non-Watson-Crick part of the motif
| Sequence | Counts |
|---|---|
| AAGCCCUACAGGUUGGAA | 1 |
Release history
| Release | 3.99 | 4.0 | 4.1 | 4.2 | 4.3 | 4.4 | 4.5 | 4.6 | 4.7 |
|---|---|---|---|---|---|---|---|---|---|
| Date | 2025-07-16 | 2025-08-13 | 2025-09-10 | 2025-10-08 | 2025-11-05 | 2025-12-03 | 2025-12-31 | 2026-01-28 | 2026-02-25 |
| Status | New id, no parents | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match |
Parent motifs
This motif has no parent motifs.
Children motifs
This motif has no children motifs.- Annotations
-
- (1)
- Basepair signature
- cWW-tSH-R-R
- Heat map statistics
- Min 0.00 | Avg 0.00 | Max 0.00
Coloring options: