Motif HL_52616.1 Version HL_52616.1 of this group appears in releases 4.0 to 4.0
| #S | Loop id | PDB | Disc | #Non-core | Chain(s) | Standardized name for chain | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 1-17 | 5-14 | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | HL_8P9A_224 | 8P9A | 0.0000 | 3 | sR | SSU rRNA | A | 1691 | G | 1692 | A | 1693 | A | 1694 | G | 1695 | G | 1696 | G | 1697 | G | 1698 | G | 1699 | C | 1703 | U | 1704 | C | 1705 | C | 1706 | A | 1707 | U | 1708 | C | 1709 | U | 1710 | cWW | ncSW |
3D structures
Complete motif including flanking bases
| Sequence | Counts |
|---|---|
| AGAAGGGGGCAACUCCAUCU | 1 |
Non-Watson-Crick part of the motif
| Sequence | Counts |
|---|---|
| GAAGGGGGCAACUCCAUC | 1 |
Release history
| Release | 4.0 |
|---|---|
| Date | 2025-08-13 |
| Status | New id, 1 parent |
Parent motifs
This motif has no parent motifs.
Children motifs
This motif has no children motifs.- Annotations
-
- (1)
- Basepair signature
- cWW-cWH-cHW-F-cWH-cHW-F-F-tHH-cWH-tWW-cWH-F-tWW-cWH-F-cWH
- Heat map statistics
- Min 0.00 | Avg 0.00 | Max 0.00
Coloring options: