#SLoop idPDBDisc#Non-coreChain(s)Standardized name for chain 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24break 25 26 27 281-283-185-166-159-1310-1122-2723-2624-25
1 IL_5TBW_0975TBW0.0000111 LSU rRNAA2529G2530C2531U2532G2533G2534A2535A2536U2537U2538U2541U2542U2543U2544C2545C2546A2547C2548G2555C2556A2557A2561A2562G2563*U2578G2579A2580U2581cWWncBWncWWncWWncwWntSWtHHtHScWW

3D structures

Complete motif including flanking bases
SequenceCounts
AGCUGGAAUUCAUUUUCCACGUUCUAGCAUUCAAG*UGAU1
Non-Watson-Crick part of the motif
SequenceCounts
GCUGGAAUUCAUUUUCCACGUUCUAGCAUUCAA*GA1

Release history

Release3.33.43.53.63.73.83.93.103.113.123.133.143.153.163.173.183.193.203.213.223.233.243.253.263.273.283.293.303.313.323.333.343.353.363.373.383.393.403.413.423.433.443.453.463.473.483.493.503.513.523.533.543.553.563.573.583.593.603.613.623.633.643.653.663.673.683.693.703.713.723.733.743.753.763.773.783.793.803.813.823.833.843.853.863.873.883.893.90
Date2018-03-082018-04-062018-05-042018-06-012018-06-292018-07-272018-08-242018-09-212018-10-192018-11-162018-12-142019-01-112019-02-082019-03-082019-04-052019-05-032019-05-312019-06-282019-07-262019-08-232019-09-192019-10-162019-11-132019-12-112020-01-082020-02-052020-03-042020-04-012020-04-292020-05-272020-06-242020-07-222020-08-192020-09-162020-10-142020-11-112020-12-092021-01-062021-02-032021-03-032021-03-312021-04-282021-05-262021-06-232021-07-212021-08-182021-09-152021-10-132021-11-102021-12-082022-01-052022-02-022022-03-022022-03-302022-04-272022-05-252022-06-222022-07-202022-08-172022-10-122022-11-092022-12-072023-01-042023-02-012023-03-012023-03-292023-04-262023-05-242023-06-212023-07-192023-08-162023-09-132023-10-112023-11-082023-12-062024-01-032024-01-032024-01-312024-02-282024-03-272024-04-242024-05-222024-06-192024-07-172024-08-142024-09-112024-10-092024-11-06
StatusNew id, no parentsExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact match

Parent motifs

This motif has no parent motifs.

Children motifs

This motif has no children motifs.
Annotations
  • (1)
  • Basepair signature
    cWW-L-tHH-L-tHS-L-cWW-L-L-L-L-R-L-R-tSW-R-R-L-R-L-R-L-R
    Heat map statistics
    Min 0.00 | Avg 0.00 | Max 0.00
    Help

    Coloring options:

    Copyright 2026 BGSU RNA group. Page generated in 0.1443 s