Motif HL_85461.1 Version HL_85461.1 of this group appears in releases 3.95 to 4.7
| #S | Loop id | PDB | Disc | #Non-core | Chain(s) | Standardized name for chain | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 1-15 | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | HL_8CRE_206 | 8CRE | 0.0000 | 5 | CM | SSU rRNA | G | 701 | G | 702 | U | 703 | A | 704 | G | 705 | C | 706 | C | 707 | A | 708 | U | 709 | U | 710 | G | 714 | G | 715 | C | 716 | A | 719 | C | 720 | cWW |
3D structures
Complete motif including flanking bases
| Sequence | Counts |
|---|---|
| GGUAGCCAUUUAUGGCGAAC | 1 |
Non-Watson-Crick part of the motif
| Sequence | Counts |
|---|---|
| GUAGCCAUUUAUGGCGAA | 1 |
Release history
| Release | 3.95 | 3.96 | 3.97 | 3.98 | 3.99 | 4.0 | 4.1 | 4.2 | 4.3 | 4.4 | 4.5 | 4.6 | 4.7 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Date | 2025-03-26 | 2025-04-23 | 2025-05-21 | 2025-06-18 | 2025-07-16 | 2025-08-13 | 2025-09-10 | 2025-10-08 | 2025-11-05 | 2025-12-03 | 2025-12-31 | 2026-01-28 | 2026-02-25 |
| Status | New id, no parents | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match |
Parent motifs
This motif has no parent motifs.
Children motifs
This motif has no children motifs.- Annotations
-
- (1)
- Basepair signature
- cWW-F-F-F-F-F-F-F-F-F-F-F-F-F
- Heat map statistics
- Min 0.00 | Avg 0.00 | Max 0.00
Coloring options: