Motif HL_56845.1 Version HL_56845.1 of this group appears in releases 3.80 to 3.87
#S | Loop id | PDB | Disc | #Non-core | Annotation | Chain(s) | Standardized name | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 1-14 | 1-16 | 2-16 | 3-6 | 3-7 | 3-12 | 9-11 | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | HL_8C3A_207 | 8C3A | 0.0000 | 4 | CM | SSU rRNA | G | 701 | G | 702 | U | 703 | A | 704 | G | 705 | C | 706 | C | 707 | A | 708 | U | 709 | U | 710 | G | 714 | G | 715 | C | 716 | A | 718 | A | 719 | C | 720 | ncHS | cWW | ncHW | ncWW | ntHH | ntHS | ntHW |
3D structures
Complete motif including flanking bases
Sequence | Counts |
---|---|
GGUAGCCAUUUAUGGCGAAC | 1 |
Non-Watson-Crick part of the motif
Sequence | Counts |
---|---|
GUAGCCAUUUAUGGCGAA | 1 |
Release history
Release | 3.80 | 3.81 | 3.82 | 3.83 | 3.84 | 3.85 | 3.86 | 3.87 |
---|---|---|---|---|---|---|---|---|
Date | 2024-01-31 | 2024-02-28 | 2024-03-27 | 2024-04-24 | 2024-05-22 | 2024-06-19 | 2024-07-17 | 2024-08-14 |
Status | New id, no parents | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match |
Parent motifs
This motif has no parent motifs.
Children motifs
This motif has no children motifs.- Annotations
- Basepair signature
- cWW-F-F-F-F-F-F-F-F-F-F-F-F-F-F
- Heat map statistics
- Min 0.00 | Avg 0.00 | Max 0.00
Coloring options: