Exact match 2248;

#Equivalence classRepresentativeResolutionNtsClass members
1NR_all_65795.26
Exact match
Thermus thermophilus
1FJG|1|A (1FJG)
  • 16S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å1507(400) 1FJG|1|A, 2UUA|1|A, 4OX9|1|A, 1J5E|1|A, 4YY3|1|A, 1IBL|1|A, 5DFE|1|XA, 1N32|1|A, 1HR0|1|A, 4B3M|1|A, 2UUC|1|A, 2UUB|1|A, 2UU9|1|A, 5DFE|1|QA, 1HNW|1|A, 4LF8|1|A, 4LF7|1|A, 2VQE|1|A, 4X64|1|A, 5J8B|1|a, 4W2I|1|AA, 4B3R|1|A, 5FDV|1|1a, 5J30|1|QA, 1HNX|1|A, 4W2I|1|CA, 5J4C|1|1a, 4LF6|1|A, 4X65|1|A, 4JI1|1|A, 4V9H|1|AA, 4Y4O|1|1a, 5J3C|1|QA, 2VQF|1|A, 5CZP|1|QA, 4Z8C|1|1a, 4B3T|1|A, 4Y4O|1|2a, 5FDU|1|1a, 1VY4|1|AA, 4LF9|1|A, 4W2G|1|AA, 5FDU|1|2a, 4LF4|1|A, 5J4B|1|1a, 1IBK|1|A, 4LFB|1|A, 4W2F|1|AA, 2UXC|1|A, 3T1Y|1|A, 4JI7|1|A, 1VY5|1|AA, 4W2E|1|a, 5J30|1|XA, 4ZSN|1|XA, 4X62|1|A, 4W2F|1|CA, 4WPO|1|DA, 4B3S|1|A, 5FDV|1|2a, 5CZP|1|XA, 5J3C|1|XA, 4W4G|1|XA, 5F8K|1|1a, 4Z3S|1|1a, 5BR8|1|A, 1VY5|1|CA, 5DOY|1|1a, 1HNZ|1|A, 1IBM|1|A, 4W2G|1|CA, 4AQY|1|A, 4WPO|1|BA, 5W4K|1|1a, 4Y4P|1|1a, 5DOY|1|2a, 5IWA|1|A, 4DV6|1|A, 4YZV|1|XA, 4KHP|1|A, 4GKJ|1|A, 4DR6|1|A, 1XMQ|1|A, 4X66|1|A, 1XNQ|1|A, 1XNR|1|A, 4DR2|1|A, 5HAU|1|2a, 4ZER|1|2a, 4ZER|1|1a, 4V8I|1|AA, 4TUA|1|QA, 5J4B|1|2a, 4Z8C|1|2a, 4L47|1|QA, 4TUD|1|QA, 5HCQ|1|1a, 4TUD|1|XA, 4GKK|1|A, 4LFC|1|A, 4YPB|1|XA, 5HCQ|1|2a, 5VP2|1|1a, 5HAU|1|1a, 4JYA|1|A, 4LNT|1|QA, 4TUE|1|QA, 4LT8|1|QA, 5W4K|1|2a, 5HD1|1|2a, 4V67|1|AA, 4DR5|1|A, 4P6F|1|QA, 4TUE|1|XA, 4Z3S|1|2a, 4W2H|1|CA, 4V5R|1|AA, 5F8K|1|2a, 5HCP|1|2a, 4W2H|1|AA, 4V8D|1|CA, 4V67|1|CA, 5J4C|1|2a, 2E5L|1|A, 4V63|1|AA, 4V8I|1|CA, 4V5R|1|CA, 2ZM6|1|A, 4V83|1|AA, 5HCR|1|2a, 4V63|1|CA, 4WQY|1|BA, 4DUY|1|A, 4LNT|1|XA, 5HCR|1|1a, 4DR3|1|A, 4V83|1|CA, 4JI3|1|A, 4LFA|1|A, 4V9R|1|CA, 4V5P|1|CA, 4K0K|1|A, 4TUC|1|QA, 4Y4P|1|2a, 4JV5|1|A, 2HHH|1|A, 1VY4|1|CA, 4WT8|1|Ab, 4TUA|1|XA, 1VY6|1|AA, 4WQF|1|BA, 4LT8|1|XA, 4TUC|1|XA, 4L47|1|XA, 4P6F|1|XA, 5HCP|1|1a, 5HD1|1|1a, 4V6F|1|CA, 4V8B|1|CA, 4V8C|1|DA, 4JI6|1|A, 4V9S|1|AA, 4V5P|1|AA, 4V9S|1|CA, 4V87|1|CA, 4JI5|1|A, 1XMO|1|A, 4JI8|1|A, 4TUB|1|QA, 4WQ1|1|1G, 4DV7|1|A, 2UXD|1|A, 3T1H|1|A, 4WT8|1|Bb, 1VY7|1|AA, 4V95|1|AA, 4W4G|1|QA, 4V9I|1|AA, 4V6F|1|BA, 4TUB|1|XA, 4LSK|1|XA, 4V7M|1|CA, 4V5S|1|CA, 4ZSN|1|QA, 4V5Q|1|AA, 4V7P|1|AA, 4V5S|1|AA, 4V7P|1|DA, 4WQU|1|BA, 4YZV|1|QA, 4V8D|1|AA, 5LMN|1|A, 4LEL|1|QA, 1N33|1|A, 4V95|1|CA, 4V9Q|1|DA, 5VP2|1|2a, 4V9Q|1|BA, 4V8U|1|CA, 4V9R|1|AA, 4WZD|1|1G, 1VY6|1|CA, 5IBB|1|1G, 4V87|1|BA, 4V5C|1|AA, 4V5L|1|AA, 4V7M|1|AA, 2UXB|1|A, 4LSK|1|QA, 4L71|1|QA, 4V8C|1|CA, 5IB7|1|13, 4V9J|1|AA, 4V9I|1|CA, 4V5C|1|CA, 4V8E|1|DA, 4V8U|1|AA, 4L71|1|XA, 4V8A|1|DA, 1VY7|1|CA, 4V8B|1|AA, 4V5F|1|AA, 4V5F|1|CA, 1I96|1|A, 4WQ1|1|13, 4V9L|1|CA, 5LMQ|1|A, 5IBB|1|13, 4WQY|1|DA, 4YPB|1|QA, 4WU1|1|1G, 5LMP|1|A, 4DV4|1|A, 4V8A|1|CA, 4V9J|1|CA, 4V8F|1|CA, 4WQF|1|DA, 4NXN|1|A, 4DR1|1|A, 4V8E|1|BA, 4V90|1|AA, 1VVJ|1|QA, 4DR4|1|A, 4V8J|1|CA, 4LF5|1|A, 4V8J|1|AA, 4V6G|1|AA, 4V6G|1|CA, 5E81|1|13, 4V9B|1|CA, 4V9M|1|CA, 4V7J|1|Aa, 4V9L|1|AA, 4V5M|1|AA, 4V5N|1|AA, 4V51|1|CA, 4V5D|1|CA, 4LEL|1|XA, 4WQU|1|DA, 4V9A|1|AA, 4V7J|1|Ba, 1VVJ|1|XA, 4V9M|1|AA, 4WZD|1|13, 4V6A|1|CA, 4V5J|1|AA, 4V5D|1|AA, 1I94|1|A, 5IB8|1|13, 5E81|1|1G, 4V97|1|AA, 4V51|1|AA, 5D8B|1|UC, 5D8B|1|YC, 4V9B|1|AA, 4V9K|1|AA, 4V68|1|AA, 4V5J|1|CA, 4LFZ|1|QA, 5DOX|1|1a, 5EL7|1|1G, 4DR7|1|A, 4V9K|1|CA, 4WRA|1|1G, 4DV0|1|A, 4NXM|1|A, 4V9A|1|CA, 4V9N|1|CA, 4JI2|1|A, 4P70|1|QA, 4WSD|1|13, 4V9N|1|AA, 5LMV|1|A, 4V5Q|1|CA, 4JI0|1|A, 5LMO|1|A, 4V8X|1|AA, 4V97|1|CA, 5LMT|1|A, 5EL7|1|13, 5DOX|1|2a, 5EL6|1|1G, 5LMR|1|A, 4WSD|1|1G, 4WSM|1|1G, 5EL6|1|13, 4XEJ|1|A16S, 4V8Q|1|BA, 4V8X|1|CA, 4WR6|1|1G, 4WRA|1|13, 5EL4|1|13, 4V8G|1|CA, 4WQR|1|1G, 4KVB|1|A, 4V7W|1|AA, 4P70|1|XA, 4DV3|1|A, 4V7K|1|Aa, 5IB8|1|1G, 5LMU|1|A, 4V7K|1|Ba, 5LMS|1|A, 4WR6|1|13, 4DV5|1|A, 5E7K|1|13, 4WU1|1|13, 4V7W|1|CA, 4WRO|1|1G, 5IB7|1|1G, 4WQR|1|13, 4WRO|1|13, 4V7X|1|AA, 4V5E|1|AA, 4WSM|1|13, 5EL4|1|1G, 4DUZ|1|A, 4V5E|1|CA, 4V7X|1|CA, 4V8F|1|BA, 4V8H|1|AA, 4V7Y|1|CA, 2F4V|1|A, 4DV1|1|A, 4V84|1|CA, 1I95|1|A, 4W29|1|AA, 4V7Y|1|AA, 4V84|1|AA, 4XEJ|1|B16S, 4V8H|1|CA, 5E7K|1|1G, 4LFZ|1|XA, 4V6A|1|AA, 4V8N|1|AA, 4JI4|1|A, 4WT1|1|13, 4V8N|1|CA, 5EL5|1|13, 4V5K|1|AA, 4WZO|1|13, 4W29|1|CA, 4V7Z|1|AA, 4WT1|1|1G, 3OTO|1|A, 4V7Z|1|CA, 4DV2|1|A, 4V8G|1|AA, 4WZO|1|1G, 4V8O|1|AA, 4V7L|1|CA, 4V7L|1|AA, 4V4J|1|y, 4V4R|1|AA, 4V5A|1|AA, 4V4T|1|AA, 4V5K|1|CA, 4V5A|1|CA, 5EL5|1|1G, 4V4S|1|AA, 4YHH|1|A, 4V5G|1|CA, 4V4I|1|y, 4V4X|1|AA, 4V5G|1|AA, 1N34|1|A, 4V4Z|1|AA, 4V4P|1|BA+4V4P|1|B1, 4V4Y|1|AA, 1N36|1|A, 5AA0|1|BA, 5A9Z|1|BA, 5IMQ|1|A, 1I97|1|A, 5IMR|1|A, 1FKA|1|A, 1JGP|1|A, 1JGQ|1|A, 1JGO|1|A, 4V42|1|AA
2NR_all_42622.22
Exact match
Thermus thermophilus
4V8C|1|AB (4V8C)
  • 5S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): AB; model(s): 1
3.3 Å122(294) 4V8C|1|AB, 5W4K|1|1B, 5J4D|1|C, 5J4D|1|HB, 4WU1|1|16, 5IB7|1|16, 4V8E|1|CB, 4Z3S|1|1B, 4Y4P|1|1B, 4WQF|1|AB, 4WQY|1|AB, 4V9R|1|BB, 4W2G|1|BB, 4V9S|1|BB, 1VY4|1|BB, 4TUE|1|RB, 4TUC|1|YB, 4P6F|1|YB, 4LT8|1|YB, 4TUE|1|YB, 4WZD|1|16, 5IB8|1|16, 5E81|1|16, 4WQ1|1|16, 4WRO|1|16, 4WQ1|1|1J, 4V87|1|AB, 4V6F|1|DB, 5HAU|1|1B, 5DOY|1|1B, 5FDV|1|1B, 5J4C|1|1B, 4ZER|1|1B, 5VP2|1|1B, 4WPO|1|AB, 5J8B|1|B, 1VY7|1|BB, 1VY6|1|BB, 4V8H|1|BB, 4W2H|1|DB, 4TUB|1|RB, 4TUD|1|RB, 4L71|1|RB, 5CZP|1|YB, 4L47|1|YB, 5DFE|1|YB, 5J3C|1|YB, 4TUB|1|YB, 5J30|1|YB, 4TUD|1|YB, 5FDU|1|1B, 4V5P|1|BB, 4V5P|1|DB, 4WSD|1|16, 5EL4|1|16, 5E81|1|1J, 5IBB|1|1J, 4V8E|1|AB, 4V8D|1|BB, 4V8C|1|BB, 4V8B|1|BB, 4V8D|1|DB, 4Y4O|1|1B, 5HCQ|1|1B, 4ZER|1|2B, 5FDV|1|2B, 4Z3S|1|2B, 4WQU|1|AB, 4W2E|1|B, 4W2I|1|BB, 4W2F|1|BB, 4V95|1|BB, 1VY5|1|BB, 4WQY|1|CB, 4WPO|1|CB, 4V9R|1|DB, 4L47|1|RB, 4P6F|1|RB, 4LT8|1|RB, 5CZP|1|RB, 4LNT|1|RB, 4P70|1|YB, 4TUA|1|YB, 4LNT|1|YB, 5D8B|1|AD, 4V9I|1|BB, 4V8J|1|BB, 4V5C|1|BB, 4WT8|1|Cs, 4V5C|1|DB, 4V9M|1|DB, 5D8B|1|WC, 5EL6|1|16, 4WSM|1|16, 5E7K|1|16, 4WRA|1|16, 4V8F|1|AB, 4V87|1|DB, 4Z8C|1|1B, 5HCP|1|1B, 5HD1|1|1B, 5DOX|1|1B, 5F8K|1|2B, 5HAU|1|2B, 4Y4O|1|2B, 5FDU|1|2B, 5HCQ|1|2B, 4W2H|1|BB, 4WQU|1|CB, 4WQF|1|CB, 4V6G|1|DB, 4V8H|1|DB, 4V9S|1|DB, 5J3C|1|RB, 4TUA|1|RB, 4P70|1|RB, 5DFE|1|RB, 5J30|1|RB, 4LFZ|1|YB, 4L71|1|YB, 4LEL|1|YB, 4V9Q|1|AB, 4V5E|1|BB, 4V9Q|1|CB, 4V97|1|DB, 4V5E|1|DB, 4V9I|1|DB, 4V8J|1|DB, 4WT8|1|Ds, 4WT1|1|16, 4WQR|1|16, 5EL7|1|16, 5EL5|1|16, 4WR6|1|16, 5EL6|1|1J, 4WSM|1|1J, 5IB7|1|1J, 4V9A|1|BB, 4V8F|1|DB, 4V8B|1|DB, 4W4G|1|YB, 5HCR|1|1B, 5J4B|1|1B, 5F8K|1|1B, 4V8I|1|BB, 1VY5|1|DB, 4W2G|1|DB, 4W2I|1|DB, 4LEL|1|RB, 4TUC|1|RB, 4LSK|1|YB, 4V67|1|BB, 4V6A|1|BB, 4V83|1|BB, 4V9K|1|BB, 4V5M|1|BB, 4V83|1|DB, 4V9L|1|DB, 4V5D|1|DB, 4V6A|1|DB, 4V67|1|DB, 4WZO|1|16, 5EL7|1|1J, 4WRA|1|1J, 5HCR|1|2B, 5DOX|1|2B, 4V8G|1|BB, 4V8I|1|DB, 1VVJ|1|RB, 4LSK|1|RB, 4LFZ|1|RB, 4V5D|1|BB, 4V5F|1|BB, 4V8U|1|BB, 4V5R|1|BB, 4V9N|1|BB, 4V97|1|BB, 4V7X|1|BB, 4V5J|1|BB, 4V63|1|DB, 4V8U|1|DB, 4V5F|1|DB, 4V5J|1|DB, 4V5R|1|DB, 4V9N|1|DB, 5IBB|1|16, 4WZD|1|1J, 5E7K|1|1J, 4ZSN|1|YB, 4YZV|1|YB, 4Z8C|1|2B, 4V8A|1|AB, 4V8A|1|BB, 4V8G|1|DB, 4V95|1|DB, 4W2F|1|DB, 4V7L|1|BB, 4V5Q|1|BB, 4V7M|1|BB, 4V5N|1|BB, 4V9L|1|BB, 4V9H|1|BB, 4V7P|1|BB, 4V63|1|BB, 4V9M|1|BB, 4V7Y|1|BB, 4V7P|1|CB, 4V7Y|1|DB, 4V7X|1|DB, 4V9K|1|DB, 4V84|1|DB, 4WR6|1|1J, 4V9B|1|BB, 4V9A|1|DB, 4V9B|1|DB, 4W4G|1|RB, 4YZV|1|RB, 5HD1|1|2B, 5DOY|1|2B, 1VY4|1|DB, 1VVJ|1|YB, 4V7J|1|AB, 4V51|1|BB, 4V68|1|BB, 4V90|1|BB, 4V84|1|BB, 4V7W|1|BB, 4V7J|1|BB, 4V51|1|DB, 4V5Q|1|DB, 4V7W|1|DB, 4WSD|1|1J, 4WQR|1|1J, 4WU1|1|1J, 4V6F|1|AB, 4ZSN|1|RB, 4YPB|1|YB, 5J4C|1|2B, 5HCP|1|2B, 5J4B|1|2B, 4V4J|1|x, 4V7L|1|DB, 4V8N|1|BB, 4W29|1|BB, 4V8N|1|DB, 4YPB|1|RB, 5W4K|1|2B, 1VY6|1|DB, 1VY7|1|DB, 4XEJ|1|A5S, 4V8Q|1|AB, 4V7K|1|AB, 4V7K|1|BB, 4V5S|1|BB, 4V9J|1|BB, 4V5S|1|DB, 4WZO|1|1J, 5EL4|1|1J, 5EL5|1|1J, 4Y4P|1|2B, 4XEJ|1|B5S, 4V5K|1|BB, 4V8X|1|BB, 4V5K|1|DB, 4V5A|1|DB, 4V8X|1|DB, 4V9J|1|DB, 4V6G|1|BB, 4V4I|1|x, 4WT1|1|1J, 5IB8|1|1J, 4V5G|1|BB, 4V5A|1|BB, 5VP2|1|2B, 4WRO|1|1J, 4V5G|1|DB, 4V8O|1|BB, 4V5L|1|BB, 4W29|1|DB, 4V4T|1|BB, 4V4S|1|BB, 4V4R|1|BB, 4V4Z|1|BB, 4V7Z|1|BB, 4V7Z|1|DB, 4V4X|1|BB, 5IMR|1|E, 5AA0|1|AB, 5A9Z|1|AB, 4V4Y|1|BB, 5IMQ|1|E, 4V7M|1|DB, 4V4P|1|AB, 4V42|1|BB
3NR_all_97519.22
Exact match
Thermus thermophilus
5FDU|1|1A (5FDU)
  • 23S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): 1A; model(s): 1
2.9 Å2861(294) 5FDU|1|1A, 5HCQ|1|1A, 5W4K|1|1A, 5HCR|1|1A, 5FDV|1|1A, 4Y4O|1|1A, 5HD1|1|1A, 4Z8C|1|1A, 5HCP|1|1A, 4V8I|1|DA, 4Y4P|1|1A, 4ZER|1|1A, 4V9R|1|BA, 5F8K|1|1A, 1VY4|1|BA, 4W2H|1|BA, 5VP2|1|1A, 4V9S|1|BA, 5DFE|1|YA, 4WPO|1|AA, 4W2F|1|BA, 5J4B|1|1A, 5DOY|1|1A, 4Z3S|1|1A, 5DFE|1|RA, 4W2G|1|BA, 5CZP|1|RA, 4W2I|1|BA, 5FDV|1|2A, 5J4C|1|1A, 4V8I|1|BA, 4Y4O|1|2A, 5J30|1|RA, 5CZP|1|YA, 4V9R|1|DA, 4V9S|1|DA, 4V95|1|BA, 5J30|1|YA, 1VY5|1|BA, 5J8B|1|A, 5FDU|1|2A, 5HCQ|1|2A, 4Z8C|1|2A, 5W4K|1|2A, 5F8K|1|2A, 5J3C|1|RA, 1VY4|1|DA, 1VY7|1|BA, 4W2H|1|DA, 4V8H|1|DA, 5HAU|1|1A, 4V8A|1|BA, 4V8G|1|DA, 4WQY|1|AA, 4W2F|1|DA, 4V8G|1|BA, 5J3C|1|YA, 4Z3S|1|2A, 4YZV|1|YA, 4W2I|1|DA, 4WQF|1|AA, 4WQU|1|AA, 1VY6|1|BA, 4V8A|1|AA, 5DOX|1|1A, 4V83|1|BA, 4V83|1|DA, 5HD1|1|2A, 4WPO|1|CA, 5HCR|1|2A, 4V8H|1|BA, 4W4G|1|YA, 4V95|1|DA, 4W2G|1|DA, 4YZV|1|RA, 1VY5|1|DA, 5J4B|1|2A, 4Y4P|1|2A, 4V9H|1|BA, 5HCP|1|2A, 1VY7|1|DA, 5HAU|1|2A, 4ZER|1|2A, 5J4C|1|2A, 4LNT|1|YA, 5DOY|1|2A, 4W4G|1|RA, 4V6F|1|DA, 5J4D|1|GB, 4LT8|1|YA, 4V84|1|DA, 4WQU|1|CA, 4W2E|1|A, 5J4D|1|B, 4ZSN|1|YA, 4ZSN|1|RA, 4V84|1|BA, 4V8B|1|BA, 4YPB|1|RA, 5DOX|1|2A, 4V9N|1|DA, 4WQY|1|CA, 4L47|1|RA, 4V5D|1|DA, 4YPB|1|YA, 4TUA|1|YA, 4V9N|1|BA, 4LT8|1|RA, 4V87|1|AA, 1VY6|1|DA, 4V5D|1|BA, 5VP2|1|2A, 4V9I|1|DA, 4WQF|1|CA, 4V9I|1|BA, 4V5E|1|BA, 4V8C|1|AA, 4V7P|1|BA, 4P6F|1|YA, 4V97|1|DA, 4V7P|1|CA, 4V9Q|1|AA, 4V5E|1|DA, 4TUE|1|YA, 4V9Q|1|CA, 4V8N|1|DA, 4V67|1|DA, 4V8B|1|DA, 4P6F|1|RA, 4TUD|1|RA, 4LNT|1|RA, 4TUE|1|RA, 4V8N|1|BA, 5IBB|1|1H, 4V5C|1|DA, 4V67|1|BA, 4V87|1|DA, 4V8D|1|BA, 4WT8|1|D1, 4L47|1|YA, 4V5C|1|BA, 4V6G|1|DA, 4V7Y|1|BA, 4V8J|1|BA, 4V8J|1|DA, 4TUA|1|RA, 4TUB|1|YA, 4TUD|1|YA, 4V6F|1|AA, 4V7X|1|BA, 4V7J|1|BA, 4LSK|1|YA, 4V7Y|1|DA, 4V7J|1|AA, 4V7X|1|DA, 4WQ1|1|1H, 4V8F|1|AA, 5IB7|1|1H, 4L71|1|RA, 4V7W|1|BA, 4TUC|1|YA, 4WT8|1|C1, 4V7M|1|BA, 4V7W|1|DA, 5IBB|1|14, 4L71|1|YA, 4V8E|1|AA, 4TUB|1|RA, 4V6A|1|BA, 1VVJ|1|YA, 4V90|1|BA, 4V9B|1|BA, 4V7K|1|AA, 4V7K|1|BA, 5E81|1|1H, 4V5K|1|DA, 4V8D|1|DA, 4LSK|1|RA, 4V8C|1|BA, 4V5K|1|BA, 4WZD|1|1H, 5IB8|1|1H, 4V5J|1|DA, 4V5J|1|BA, 1VVJ|1|RA, 4V97|1|BA, 5E7K|1|1H, 4V8X|1|BA, 4V63|1|BA, 4V8E|1|CA, 4V8X|1|DA, 4V63|1|DA, 4WRO|1|1H, 5EL6|1|1H, 4V6G|1|BA, 5E81|1|14, 4WQ1|1|14, 4TUC|1|RA, 4V51|1|BA, 5IB7|1|14, 4V51|1|DA, 4WSD|1|1H, 4LEL|1|YA, 4WRA|1|1H, 4V7M|1|DA, 4WZD|1|14, 4WR6|1|1H, 5IB8|1|14, 4WQR|1|1H, 5EL4|1|1H, 4V68|1|BA, 4WT1|1|1H, 4V9A|1|BA, 4LEL|1|RA, 4WU1|1|1H, 5EL7|1|1H, 4V8F|1|DA, 4V9M|1|BA, 4V9K|1|DA, 5EL5|1|1H, 4WSM|1|1H, 4V9L|1|BA, 4V7Z|1|DA, 4V7Z|1|BA, 5EL7|1|14, 4WU1|1|14, 4V9B|1|DA, 4V9M|1|DA, 4V6A|1|DA, 4V9L|1|DA, 5EL4|1|14, 4V5P|1|DA, 5EL6|1|14, 4V9A|1|DA, 5D8B|1|VC, 4V8U|1|BA, 4WSD|1|14, 4WR6|1|14, 5D8B|1|ZC, 4V5P|1|BA, 4V5F|1|BA, 4P70|1|YA, 4V5F|1|DA, 4V9K|1|BA, 4V8Q|1|AA, 4V5N|1|BA, 4V8U|1|DA, 4LFZ|1|YA, 4WRA|1|14, 4WRO|1|14, 4V5R|1|BA, 4V5R|1|DA, 5E7K|1|14, 4P70|1|RA, 4WQR|1|14, 5EL5|1|14, 4LFZ|1|RA, 4WZO|1|1H, 4V5M|1|BA, 4WSM|1|14, 4XEJ|1|A23S, 4V9J|1|BA, 4V5L|1|BA, 4XEJ|1|B23S, 4V7L|1|BA, 4V9J|1|DA, 4V5S|1|BA, 4WT1|1|14, 4V5Q|1|BA, 4V5S|1|DA, 4WZO|1|14, 4W29|1|BA, 4V5Q|1|DA, 4W29|1|DA, 4V5A|1|BA, 4V5A|1|DA, 4V4J|1|w, 4V7L|1|DA, 4V4I|1|w, 4V8O|1|BA, 4V5G|1|DA, 4V5G|1|BA, 4V4Z|1|BA, 4V4X|1|BA, 4V4Y|1|BA, 5A9Z|1|AA, 5AA0|1|AA, 4V4T|1|BA, 4V4R|1|BA, 4V4S|1|BA, 5IMQ|1|D, 4V4P|1|AA, 5IMR|1|D, 4V42|1|BA
4NR_all_35542.39
Exact match
Escherichia coli
4V9R|1|AX (4V9R)
  • P-site tRNA
  • X-RAY DIFFRACTION
  • Chain(s): AX; model(s): 1
3.0 Å76(293) 4V9R|1|AX, 4V9S|1|AX, 5J30|1|QV, 4TUD|1|QV, 5J3C|1|QV, 4TUA|1|QV, 5U9G|1|W, 4P70|1|XV, 3JBN|1|7, 4V7B|1|AV, 4V5F|1|AV, 4V9S|1|CX, 4V9R|1|CX, 3JCE|1|8, 4V7M|1|AX, 4V63|1|AY, 4V67|1|AY, 4V87|1|BC, 4V8F|1|CC, 4V9I|1|CV, 4V6A|1|CW, 4V63|1|CY, 4V67|1|CY, 4V8C|1|DC, 4YZV|1|QV, 4TUB|1|QV, 5UYM|1|W, 4TUB|1|XV, 5J30|1|XV, 4TUD|1|XV, 5J3C|1|XV, 5MDV|1|5, 5LZD|1|v, 4V5F|1|CV, 4Z3S|1|1x, 5DOY|1|2x, 5L4O|1|A, 5KPS|1|31, 5KPW|1|31, 5KPV|1|32, 5KPS|1|32, 4V8B|1|AC, 4V63|1|AZ, 4V67|1|AZ, 4V8E|1|BC, 4V8Q|1|BV, 4V6G|1|CC, 4V8B|1|CC, 4V8C|1|CC, 4V8J|1|CV, 4V63|1|CZ, 4V67|1|CZ, 4V8E|1|DC, 5D8B|1|ED, 5D8B|1|FD, 4TUC|1|QV, 4ZSN|1|QV, 4P70|1|QV, 4LT8|1|QV, 5UYK|1|W, 5UYP|1|W, 5U9F|1|W, 5UYL|1|X, 5CZP|1|XV, 4LNT|1|XV, 4W4G|1|XV, 4P6F|1|XV, 4LT8|1|XV, 4YZV|1|XV, 5DFE|1|XV, 5HCP|1|1x, 5HCQ|1|1x, 5HCR|1|1x, 4Y4P|1|1x, 4WRO|1|2K, 5W4K|1|2x, 4Y4P|1|2x, 5VP2|1|2x, 4Z8C|1|2x, 3CW5|1|A, 4W2I|1|AX, 4W2G|1|AX, 4W2F|1|AX, 1VY5|1|AX, 4W2H|1|AX, 4W2I|1|CX, 4W2G|1|CX, 4W2F|1|CX, 1VY5|1|CX, 5MDY|1|5, 5MDW|1|5, 5MDZ|1|5, 5LZC|1|v, 5LZB|1|v, 5H5U|1|5, 4V4Z|1|AC, 4V5C|1|AV, 5DOY|1|1x, 5IBB|1|2L, 4Z3S|1|2x, 1VY6|1|AX, 1VY4|1|AX, 1VY7|1|AX, 1VY6|1|CX, 4WPO|1|DX, 5KPX|1|31, 4V8D|1|AC, 4V9I|1|AV, 4V6A|1|AW, 4V87|1|CC, 4V7M|1|CX, 3J5S|1|E, 3J78|1|ET, 3J77|1|PT, 4LNT|1|QV, 4YPB|1|QV, 5DFE|1|QV, 4P6F|1|QV, 5UYL|1|W, 5UYK|1|X, 5UYP|1|X, 5UYQ|1|X, 5UYN|1|X, 4TUC|1|XV, 4ZSN|1|XV, 4TUA|1|XV, 4YPB|1|XV, 5U4I|1|y, 3JBO|1|7, 5HAU|1|1w, 5VP2|1|1x, 4Z8C|1|1x, 5J4B|1|1x, 4ZER|1|1x, 5HD1|1|1x, 5W4K|1|1x, 5IB7|1|2K, 5EL4|1|2K, 4WQR|1|2K, 4WT1|1|2K, 4WSD|1|2K, 5EL6|1|2K, 5EL7|1|2K, 5IBB|1|2K, 5HAU|1|2w, 5J4C|1|2x, 4ZER|1|2x, 5HCQ|1|2x, 5HD1|1|2x, 5HCP|1|2x, 5HCR|1|2x, 5J4B|1|2x, 5JB3|1|4, 3CW6|1|A, 4V6Y|1|A3, 4V73|1|A3, 4V6R|1|AD, 4WQY|1|BX, 5LZF|1|v, 5KPV|1|31, 5KPX|1|32, 4V8D|1|CC, 4V97|1|CV, 3J78|1|PT, 4L71|1|QV, 5CZP|1|QV, 4LEL|1|QV, 1VVJ|1|QV, 4W4G|1|QV, 4LFZ|1|QV, 4LSK|1|QV, 5UYQ|1|W, 5UYN|1|W, 4LFZ|1|XV, 4LEL|1|XV, 4LSK|1|XV, 4L71|1|XV, 1VVJ|1|XV, 4WR6|1|2K, 4WPO|1|BX, 4V6G|1|CB, 5F8K|1|1x, 5J4C|1|1x, 5EL5|1|2K, 4WQ1|1|2K, 5E7K|1|2K, 5IB8|1|2K, 4WQ1|1|2L, 4WSD|1|2L, 5EL6|1|2L, 5F8K|1|2x, 4V6Z|1|A3, 4V6O|1|AD, 4V6P|1|AD, 4W2H|1|CX, 4WQY|1|DX, 5LMV|1|Z, 4V69|1|AV, 4V51|1|AV, 3DEG|1|B, 4V51|1|CV, 4V5F|1|CW, 4WRA|1|2L, 4WZO|1|2L, 5JBH|1|4, 5J4D|1|IA, 5J4D|1|NC, 5LZA|1|v, 4V6G|1|AC, 4V5K|1|AV, 4V97|1|AV, 4V7P|1|AW, 4V7L|1|AX, 5D8B|1|BD, 4V7P|1|DW, 5D8B|1|XC, 5U4I|1|x, 1VY4|1|CX, 1VY7|1|CX, 4WZO|1|1K, 4WZO|1|2K, 5IB7|1|2L, 5E7K|1|2L, 5IB8|1|2L, 4V6V|1|A3, 4V72|1|A3, 4V74|1|A3, 4V71|1|A3, 4V70|1|A3, 4V6Q|1|AD, 4V6S|1|BC, 2FMT|1|C, 2FMT|1|D, 5LMS|1|Z, 5LMU|1|Z, 4V5C|1|CV, 4WRA|1|2K, 3J9Y|1|v, 5AFI|1|v, 5KPW|1|32, 4V8F|1|BC, 4V6G|1|CD, 5U9F|1|X, 5UYM|1|X, 5U9G|1|X, 5EL4|1|2L, 4WRO|1|2L, 5IQR|1|5, 4V78|1|A3, 4V77|1|A3, 4V79|1|A3, 5LMQ|1|Z, 4V4X|1|AC, 5J4D|1|D, 5J4D|1|IB, 5L3P|1|x, 4V8J|1|AV, 4V5K|1|CV, 3V11|1|D, 5EL5|1|2L, 4WT1|1|2L, 4WQR|1|2L, 5EL7|1|2L, 4V75|1|A3, 4YPB|1|QW, 4W4G|1|QW, 4W4G|1|XW, 4YPB|1|XW, 4WR6|1|2L, 4V76|1|A3, 5ME0|1|X, 5ME1|1|X, 3JCN|1|v, 3JCJ|1|v, 4V6G|1|AD, 4V7L|1|CX, 4V6N|1|BD, 4V5F|1|AW, 4V8Q|1|BW, 4V8O|1|AV, 4V6T|1|AX, 5U4J|1|x+5U4J|1|z, 4V8C|1|CD, 4V8B|1|AD, 4V87|1|CD, 4V8C|1|DD, 4V87|1|BD, 4V8B|1|CD, 5AFI|1|w, 3QSY|1|D, 4V5K|1|AW, 4V5K|1|CW, 1EG0|1|O
5NR_all_56726.29
Exact match
Escherichia coli
4V4Q|1|CA (4V4Q)
  • 16S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): CA; model(s): 1
3.5 Å1530(189) 4V4Q|1|CA, 4V4H|1|CA, 4V52|1|CA, 4V52|1|AA, 4V54|1|CA, 5MY1|1|A, 4A2I|1|A, 4V4Q|1|AA, 5LZD|1|a, 4V64|1|CA, 5NWY|1|0, 4V6C|1|AA, 4V54|1|AA, 5J8A|1|AA, 4V64|1|AA, 5H5U|1|h, 5IT8|1|AA, 4V53|1|CA, 5J91|1|BA, 5J5B|1|BA, 5IT8|1|BA, 5J91|1|AA, 5J5B|1|AA, 5UYM|1|A, 4V4H|1|AA, 4V5Y|1|CA, 5J7L|1|AA, 4V53|1|AA, 4V7V|1|AA, 5J8A|1|BA, 5JC9|1|AA, 4V7S|1|AA, 4V55|1|AA, 5JC9|1|BA, 4ADV|1|A, 4V5Y|1|AA, 4V57|1|CA, 4V55|1|CA, 4WWW|1|QA, 5J7L|1|BA, 5MDV|1|2, 4V57|1|AA, 4V7T|1|AA, 4V6D|1|AA, 5LZA|1|a, 5J88|1|AA, 4V56|1|CA, 4V9P|1|FA, 5MDZ|1|2, 5MDW|1|2, 4YBB|1|AA, 4V9O|1|FA, 5IQR|1|2, 4U1U|1|CA, 5LZE|1|a+5LZE|1|y+5LZE|1|v+5LZE|1|x, 4V50|1|AA, 5ME0|1|A, 5ME1|1|A, 4V9O|1|BA, 5J88|1|BA, 5KPW|1|26, 5AFI|1|a, 4V6E|1|AA, 4U20|1|AA, 4V50|1|CA, 5MDY|1|2, 4V9P|1|BA, 5KPS|1|27, 4V56|1|AA, 5LZF|1|a, 4U1U|1|AA, 5MGP|1|a, 4V6C|1|CA, 4U26|1|AA, 4U24|1|AA, 4YBB|1|BA, 5KPV|1|26, 5KPX|1|26, 4U20|1|CA, 3J9Y|1|a, 4V6E|1|CA, 4V7U|1|AA, 4U27|1|AA, 4V7B|1|AA, 5UYP|1|A, 5UYL|1|A, 4V6D|1|CA, 4WF1|1|AA, 5O2R|1|a, 4V9P|1|HA, 4U25|1|AA, 4V7T|1|CA, 4V9O|1|DA, 4U1V|1|CA, 4WOI|1|DA, 5UYQ|1|A, 5U9G|1|A, 4V6V|1|AA, 4V9P|1|DA, 4V7S|1|CA, 4WWW|1|XA, 4V9D|1|BA, 4WF1|1|CA, 4U27|1|CA, 4U1V|1|AA, 5KCR|1|1a, 5UYK|1|A, 5JTE|1|AA, 4V9D|1|AA, 5JU8|1|AA, 4V69|1|AA, 4V5H|1|AA, 4V6M|1|AA, 4V7V|1|CA, 5U9F|1|A, 5LZC|1|a, 5LZB|1|a, 5UYN|1|A, 4U25|1|CA, 4WOI|1|AA, 4V89|1|AA, 4V7A|1|AA, 3JCN|1|a, 4V85|1|AA, 4U26|1|CA, 4V76|1|AA, 4U24|1|CA, 4V6T|1|AA, 3J9Z|1|SA, 5NO4|1|A, 4V77|1|AA, 4V7U|1|CA, 4V6Y|1|AA, 3JCE|1|a, 5NO3|1|A, 3JCJ|1|g, 4V78|1|AA, 4V72|1|AA, 5NO2|1|A, 4V71|1|AA, 4V7I|1|BA, 4V6K|1|BA, 4V73|1|AA, 4V74|1|AA, 4V79|1|AA, 4V70|1|AA, 4V75|1|AA, 4V6Z|1|AA, 5KCS|1|1a, 5U4J|1|a, 5NP6|1|D, 4V6L|1|AA, 5U4I|1|a, 5L3P|1|a, 3JA1|1|SA, 4V9O|1|HA, 4V9C|1|CA, 4V6R|1|AA, 4V6N|1|BA, 4V6Q|1|AA, 4V6O|1|AA, 4V6P|1|AA, 4V9C|1|AA, 3J2H|1|N, 3J2G|1|N, 4V6S|1|BA, 4V7D|1|BA, 3J2B|1|N, 3J2D|1|N, 4V7C|1|AA, 3J2E|1|N, 3J28|1|N, 3J2F|1|N, 3J29|1|N, 3J2C|1|N, 3J2A|1|N, 3JBV|1|A, 3JCD|1|a, 4V4V|1|AA, 5UZ4|1|A, 2YKR|1|A, 4V4W|1|AA, 3JBU|1|A, 4V5B|1|BA, 4V5B|1|DA, 4V66|1|A1, 4V65|1|A1, 4V47|1|BA, 4V48|1|BA
6NR_all_83717.30
Exact match
Escherichia coli
5J7L|1|DA (5J7L)
  • 23S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): DA; model(s): 1
3.0 Å2886(186) 5J7L|1|DA, 4V54|1|DB, 5J5B|1|DA, 5J91|1|DA, 4V54|1|BB, 5J8A|1|DA, 4WWW|1|RA, 5NWY|1|N, 5IT8|1|DA, 4V7T|1|BA, 5J88|1|DA, 4V6C|1|BA, 4V52|1|DB, 5JC9|1|DA, 4YBB|1|DA, 4V7S|1|BA, 4V52|1|BB, 5KCR|1|1A, 2J28|1|B, 4V4Q|1|DB, 5MDV|1|1, 5MDZ|1|1, 4V7U|1|BA, 5J91|1|CA, 5J5B|1|CA, 5MDW|1|1, 4V4Q|1|BB, 4V50|1|DB, 4V53|1|DB, 3J5L|1|A, 5GAE|1|A, 4V9P|1|EA, 4V50|1|BB, 4V85|1|BA, 5H5U|1|A, 4V53|1|BB, 4V4H|1|DB, 5J8A|1|CA, 4V9O|1|EA, 4V4H|1|BB, 4V55|1|DB, 4V57|1|BB, 4V7V|1|BA, 5GAG|1|A, 4V64|1|BB, 4V57|1|DB, 5MDY|1|1, 4V64|1|DB, 4V5Y|1|DB, 5J7L|1|CA, 4V5Y|1|BB, 4V55|1|BB, 5JC9|1|CA, 5LZD|1|A, 4V89|1|BA, 4V6D|1|BA, 4V9D|1|CA, 5GAF|1|A, 5GAD|1|A, 5NCO|1|A, 5GAH|1|A, 4U27|1|BA, 5UYM|1|01, 4U25|1|BA, 5IQR|1|1, 4U24|1|BA, 4V6E|1|BA, 5IT8|1|CA, 4V9P|1|CA, 4V9P|1|AA, 4V9O|1|AA, 4WF1|1|BA, 4U1U|1|BA, 3J7Z|1|A, 4V9O|1|CA, 4V56|1|DB, 4UY8|1|A, 4U1V|1|BA, 4V56|1|BB, 4V6T|1|BA, 4V7B|1|BA, 4V9P|1|GA, 4U20|1|BA, 4U26|1|BA, 4YBB|1|CA, 4WOI|1|BA, 5MGP|1|A, 5J88|1|CA, 3J9Y|1|A, 5AFI|1|A, 4V9D|1|DA, 5AKA|1|B, 4U1U|1|DA, 4V6D|1|DA, 5JTE|1|BA, 5UYL|1|01, 5KPS|1|28, 4WOI|1|CA, 4U20|1|DA, 5KPW|1|27, 5JU8|1|BA, 5LZE|1|A, 5KPX|1|27, 5O2R|1|A, 5LZA|1|A, 5LZF|1|A, 5U9G|1|01, 4V6C|1|DA, 5U9F|1|01, 5LZC|1|A, 5UYP|1|01, 5UYQ|1|01, 5LZB|1|A, 4V9C|1|DA, 4V5H|1|BB, 4U1V|1|DA, 4V6V|1|BA, 4V69|1|BB, 5UYN|1|01, 5UYK|1|01, 5KPV|1|27, 3JCN|1|A, 4U25|1|DA, 4V6E|1|DA, 4V9O|1|GA, 4V6M|1|B8, 4U27|1|DA, 4V7S|1|DA, 4V7T|1|DA, 4V75|1|BA, 4V7V|1|DA, 3JCE|1|A, 4V6Y|1|BA, 4WF1|1|DA, 5U4I|1|A, 3J9Z|1|LA, 3JCJ|1|A, 4V7A|1|BA, 4V6Z|1|BA, 4V72|1|BA, 4V76|1|BA, 4CSU|1|B, 4V73|1|BA, 4WWW|1|YA, 4U24|1|DA, 4V70|1|BA, 4V7I|1|A8, 4U26|1|DA, 4V9C|1|BA, 4V74|1|BA, 4V77|1|BA, 4V78|1|BA, 5L3P|1|A, 4V6K|1|AB, 5KCS|1|1A, 4V71|1|BA, 4V79|1|BA, 3BBX|1|B, 3JBV|1|b, 4V7U|1|DA, 4V6L|1|BB, 3JA1|1|LA, 3JCD|1|A, 4V6N|1|AB, 4V7D|1|AA, 4V6O|1|BB, 5NP6|1|Y, 3J8G|1|B, 4V6R|1|BB, 4V6Q|1|BB, 4V6S|1|AB, 4V6P|1|BB, 4V7C|1|BA, 3JBU|1|b, 4V5B|1|AB, 4V5B|1|CB, 5ADY|1|B, 1C2W|1|B, 4V4V|1|B0, 4V4W|1|B0, 5U4J|1|A, 4V66|1|BB, 4V65|1|BB, 2RDO|1|B, 4V47|1|A0, 4V48|1|A0
7NR_all_10157.30
Exact match
Escherichia coli
4U26|1|BB (4U26)
  • 5S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): BB; model(s): 1
2.8 Å119(185) 4U26|1|BB, 4V6Z|1|BB, 4V6Y|1|BB, 4V79|1|BB, 4V73|1|BB, 5MDW|1|3, 3J9Y|1|B, 5AFI|1|B, 5J88|1|DB, 4U20|1|DB, 4WWW|1|RB, 4WF1|1|BB, 4U27|1|BB, 4U24|1|BB, 4V78|1|BB, 4V6E|1|DB, 4V6D|1|DB, 5KCR|1|1B, 5H5U|1|B, 5LZE|1|B, 5J8A|1|DB, 5J7L|1|DB, 4YBB|1|DB, 4V7T|1|BB, 4V7V|1|BB, 4V6D|1|BB, 5J88|1|CB, 4U1U|1|DB, 4U25|1|BB, 4U1U|1|BB, 4U1V|1|BB, 4V9C|1|DB, 4V56|1|BA, 4V70|1|BB, 4V72|1|BB, 4V71|1|BB, 4V56|1|DA, 4V6C|1|DB, 5MDY|1|3, 5LZB|1|B, 5GAG|1|B, 5MGP|1|B, 5J5B|1|DB, 5JC9|1|DB, 5IT8|1|DB, 5J91|1|DB, 5IQR|1|3, 5JU8|1|BB, 4V6C|1|BB, 4V7S|1|BB, 5J7L|1|CB, 5NWY|1|O, 4U20|1|BB, 4V6T|1|BB, 4V9D|1|CB, 4V7I|1|A7, 4V55|1|BA, 4V50|1|BA, 4V69|1|BA, 4V54|1|BA, 4V77|1|BB, 4V7A|1|BB, 4V76|1|BB, 4V54|1|DA, 4V50|1|DA, 4V55|1|DA, 4V7S|1|DB, 5UYM|1|02, 5KPX|1|28, 5MDZ|1|3, 5LZC|1|B, 5GAF|1|B, 5GAH|1|B, 5LZD|1|B, 5GAD|1|B, 5NCO|1|B, 4V6M|1|B7, 4V6V|1|Ba, 3J9Z|1|LB, 4V6E|1|BB, 4V7U|1|BB, 4V9P|1|CB, 5J8A|1|CB, 5IT8|1|CB, 5J91|1|CB, 4YBB|1|CB, 5J5B|1|CB, 4U27|1|DB, 4V9D|1|DB, 4WF1|1|DB, 4U25|1|DB, 3JCN|1|B, 4WOI|1|BB, 3J5L|1|B, 4V5Y|1|BA, 4V64|1|BA, 4V75|1|BB, 4V5Y|1|DA, 4V64|1|DA, 4V7T|1|DB, 5KPV|1|28, 5KPW|1|28, 5KPS|1|29, 5MDV|1|3, 5GAE|1|B, 4CSU|1|A, 4V5H|1|BA, 4V9O|1|AB, 3J7Z|1|B, 4UY8|1|B, 4V7B|1|BB, 5JTE|1|BB, 4WOI|1|CB, 5JC9|1|CB, 4U24|1|DB, 4U1V|1|DB, 2J28|1|A, 5AKA|1|A, 4V57|1|BA, 4V4Q|1|BA, 4V53|1|BA, 4V52|1|BA, 4V4H|1|BA, 4V4Q|1|DA, 4V4H|1|DA, 4V53|1|DA, 4V52|1|DA, 4V57|1|DA, 5UYQ|1|02, 5O2R|1|B, 5LZF|1|B, 3JA1|1|LB, 4V85|1|BB, 4V9O|1|CB, 4U26|1|DB, 3BBX|1|A, 4V74|1|BB, 4V7V|1|DB, 4WWW|1|YB, 4V6S|1|AA, 5LZA|1|B, 4V6Q|1|BA, 4V9P|1|AB, 4V9P|1|EB, 5U9G|1|02, 4V6K|1|AA, 4V6L|1|BA, 3JCJ|1|0, 3JCD|1|B, 4V9O|1|EB, 4V6P|1|BA, 4V6O|1|BA, 4V89|1|BB, 5U9F|1|02, 5UYL|1|02, 5UYK|1|02, 4V6R|1|BA, 5NP6|1|Z, 3J8G|1|A, 3JCE|1|B, 5U4I|1|B, 4V9O|1|GB, 4V9P|1|GB, 5UYN|1|02, 5UYP|1|02, 5KCS|1|1B, 4V7U|1|DB, 3JBV|1|a, 4V7D|1|AB, 5L3P|1|B, 3JBU|1|a, 4V7C|1|BB, 4V6N|1|AA, 5ADY|1|A, 1C2X|1|C, 4V9C|1|BB, 4V5B|1|AA, 4V5B|1|CA, 4V66|1|BA, 4V4V|1|B9, 4V65|1|BA, 4V4W|1|B9, 2RDO|1|A, 4V48|1|A9, 4V47|1|A9
8NR_all_19951.18
Exact match
Escherichia coli
4YCO|1|D (4YCO)
  • tRNAphe
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.1 Å74(185) 4YCO|1|D, 2ZXU|1|C, 2ZM5|1|C, 4YCO|1|E, 3FOZ|1|C, 3L0U|1|A, 4YCO|1|F, 4V5E|1|AV, 4V9D|1|BV, 3FOZ|1|D, 3JCE|1|6, 4V5D|1|AV, 4V5D|1|CV, 4V9C|1|AV, 4V5Q|1|AV, 4WOI|1|DW, 4V5P|1|AV, 4V5S|1|AV, 4V5L|1|AV, 4V5P|1|CV, 4Z3S|1|2w, 2ZM5|1|D, 4V6F|1|CC, 4V5J|1|CV, 5W4K|1|1w, 4W2F|1|AW, 5AFI|1|y, 4V5R|1|AV, 4V5E|1|CV, 4V5R|1|CV, 4V5Q|1|CV, 5DOY|1|1w, 5VP2|1|2y, 4V6L|1|AE, 2ZXU|1|D, 4V6F|1|BC, 4Z3S|1|1w, 5J4B|1|1w, 4Y4P|1|1w, 5IQR|1|6, 4V5S|1|CV, 5VP2|1|1w, 5W4K|1|2w, 5W4K|1|1y, 4W2E|1|w, 4V9H|1|AV, 1VY5|1|AW, 4V6K|1|BB, 4V6K|1|BE, 4WQU|1|BW, 4WQF|1|BW, 4WQU|1|DW, 4WQF|1|DW, 4V5J|1|AV, 5J4C|1|1w, 5DOY|1|1y, 4Z3S|1|1y, 5J4B|1|1y, 5DOY|1|2w, 5W4K|1|2y, 4W2I|1|AW, 1VY4|1|AY, 4W2E|1|x, 3JCD|1|8, 5UYM|1|Y, 5UYK|1|Y, 5UYL|1|Y, 5J4C|1|2y, 4Y4P|1|2y, 5J4B|1|2y, 5KPW|1|30, 5KPX|1|30, 4V69|1|AW, 4V7D|1|BW, 4P6F|1|XW, 5VP2|1|1y, 5J4C|1|1y, 4W2G|1|AW, 1VY5|1|CW, 4WPO|1|DW, 4Y4P|1|2w, 5VP2|1|2w, 4V6F|1|CB, 1VY4|1|AW, 4V4Y|1|AB, 4V9D|1|AV, 4V7C|1|AW, 4W2G|1|AY, 4W2F|1|AY, 4WQU|1|BY, 4WPO|1|BY, 4WQF|1|BY, 4V4I|1|z, 1VY4|1|CW, 5J4B|1|2w, 4W2G|1|CW, 4V6F|1|BB, 4V6F|1|BD, 4V6F|1|CD, 3J46|1|a, 4Z3S|1|2y, 5DOY|1|2y, 4W2F|1|CY, 1VY4|1|CY, 4W2G|1|CY, 4V5G|1|AV, 4V51|1|AW, 4V5G|1|CV, 4Y4P|1|1y, 4W2I|1|AY, 1VY5|1|AY, 4W2I|1|CW, 5KPV|1|30, 4V4Y|1|AD, 4V9I|1|AW, 4V5D|1|AW, 4V5C|1|CW, 4P6F|1|QW, 4V6L|1|AB, 4WPO|1|BW, 4W2I|1|CY, 4WQU|1|DY, 4WPO|1|DY, 4WQF|1|DY, 5J4C|1|2w, 4W2F|1|CW, 4V4Y|1|AC, 4V97|1|AW, 4V5D|1|CW, 4V51|1|CW, 1VY5|1|CY, 4WT1|1|3L, 4V8J|1|AW, 3JCD|1|9, 4V5C|1|AW, 3JBV|1|V, 4WSD|1|3L, 4V5Q|1|AW, 4V5E|1|CW, 4WSD|1|1L, 4WSD|1|3K, 4WT1|1|1K, 4WT1|1|1L, 4V7C|1|AV, 4V5R|1|AW, 4V5P|1|AW, 4V8J|1|CW, 4V5P|1|CW, 4V97|1|CW, 4V9I|1|CW, 4WRO|1|1L, 4V5D|1|AY, 4V5J|1|CW, 4V5D|1|CY, 5IQR|1|4, 4V5L|1|AW, 4V9C|1|CV, 4WQR|1|3K, 4WQR|1|3L, 3JCE|1|9, 4V5S|1|AW, 4WOI|1|AX, 4V7D|1|BV, 4V5R|1|CW, 4WQR|1|1K, 4V5C|1|CY, 4WSD|1|1K, 4V5G|1|AW, 4V5G|1|CW, 4WRO|1|1K, 4WRO|1|3K, 4WRO|1|3L, 4V5J|1|AW, 4WZO|1|3K, 4V5Q|1|CW, 4WQR|1|1L, 4WZO|1|3L, 4W2H|1|AY, 4WT1|1|3K, 4V5E|1|AW, 4V5C|1|AY, 4V5S|1|CW, 1VY7|1|AY, 1VY7|1|CY, 4W2H|1|CY
9NR_all_04268.1
Exact match
Panicum mosaic virus
4V99|1|Jw (4V99)
  • 5'-R(P*UP*UP*AP*AP*UP*AP*UP*UP*UP*UP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): Jw; model(s): 1
2.9 Å17(120) 4V99|1|Jw, 4V99|1|A2, 4V99|1|A7, 4V99|1|AD, 4V99|1|AI, 4V99|1|AN, 4V99|1|AS, 4V99|1|AX, 4V99|1|Ac, 4V99|1|Ah, 4V99|1|Am, 4V99|1|Ar, 4V99|1|Aw, 4V99|1|B2, 4V99|1|B7, 4V99|1|BD, 4V99|1|BI, 4V99|1|BN, 4V99|1|BS, 4V99|1|BX, 4V99|1|Bc, 4V99|1|Bh, 4V99|1|Bm, 4V99|1|Br, 4V99|1|Bw, 4V99|1|C2, 4V99|1|C7, 4V99|1|CD, 4V99|1|CI, 4V99|1|CN, 4V99|1|CS, 4V99|1|CX, 4V99|1|Cc, 4V99|1|Ch, 4V99|1|Cm, 4V99|1|Cr, 4V99|1|Cw, 4V99|1|D2, 4V99|1|D7, 4V99|1|DD, 4V99|1|DI, 4V99|1|DN, 4V99|1|DS, 4V99|1|DX, 4V99|1|Dc, 4V99|1|Dh, 4V99|1|Dm, 4V99|1|Dr, 4V99|1|Dw, 4V99|1|E2, 4V99|1|E7, 4V99|1|ED, 4V99|1|EI, 4V99|1|EN, 4V99|1|ES, 4V99|1|EX, 4V99|1|Ec, 4V99|1|Eh, 4V99|1|Em, 4V99|1|Er, 4V99|1|Ew, 4V99|1|F2, 4V99|1|F7, 4V99|1|FD, 4V99|1|FI, 4V99|1|FN, 4V99|1|FS, 4V99|1|FX, 4V99|1|Fc, 4V99|1|Fh, 4V99|1|Fm, 4V99|1|Fr, 4V99|1|Fw, 4V99|1|G2, 4V99|1|G7, 4V99|1|GD, 4V99|1|GI, 4V99|1|GN, 4V99|1|GS, 4V99|1|GX, 4V99|1|Gc, 4V99|1|Gh, 4V99|1|Gm, 4V99|1|Gr, 4V99|1|Gw, 4V99|1|H2, 4V99|1|H7, 4V99|1|HD, 4V99|1|HI, 4V99|1|HN, 4V99|1|HS, 4V99|1|HX, 4V99|1|Hc, 4V99|1|Hh, 4V99|1|Hm, 4V99|1|Hr, 4V99|1|Hw, 4V99|1|I2, 4V99|1|I7, 4V99|1|ID, 4V99|1|II, 4V99|1|IN, 4V99|1|IS, 4V99|1|IX, 4V99|1|Ic, 4V99|1|Ih, 4V99|1|Im, 4V99|1|Ir, 4V99|1|Iw, 4V99|1|J2, 4V99|1|J7, 4V99|1|JD, 4V99|1|JI, 4V99|1|JN, 4V99|1|JS, 4V99|1|JX, 4V99|1|Jc, 4V99|1|Jh, 4V99|1|Jm, 4V99|1|Jr
10NR_all_18586.17
Exact match
Saccharomyces cerevisiae
4U4U|1|7 (4U4U)
  • 5S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): 7; model(s): 1
3.0 Å121(89) 4U4U|1|7, 4U4N|1|7, 4U4R|1|7, 5FCJ|1|7, 4U4Q|1|7, 4U3M|1|7, 4U55|1|7, 5TBW|1|AS, 4U6F|1|3, 5DAT|1|7, 4U51|1|7, 4U3U|1|3, 4U4R|1|3, 4U52|1|3, 4U3N|1|3, 4U4Z|1|7, 5DGF|1|7, 4V8T|1|7, 4U3U|1|7, 4U50|1|7, 4U52|1|7, 5LYB|1|7, 5APO|1|7, 4U3N|1|7, 4V88|1|A3, 4V88|1|A7, 5MEI|1|AS, 4V8Z|1|B7, 4V8Y|1|B7, 5I4L|1|3, 5FCI|1|3, 5TBW|1|3, 4U4N|1|3, 5DAT|1|3, 4U4Z|1|3, 4U51|1|3, 5FCJ|1|3, 4U4Q|1|3, 4U53|1|3, 4U3M|1|3, 5MEI|1|3, 5LYB|1|3, 4U55|1|3, 4U4U|1|3, 5DGE|1|3, 5DGV|1|3, 5I4L|1|7, 4U6F|1|7, 5DC3|1|7, 4U4Y|1|7, 5TGA|1|7, 5TGM|1|3, 4U56|1|3, 5DC3|1|3, 4U4Y|1|3, 5TGA|1|3, 5TGM|1|7, 4U53|1|7, 5DGV|1|7, 5T6R|1|B, 5T62|1|B, 5JUP|1|D, 4U50|1|3, 4U4O|1|3, 3J78|1|5S, 4U56|1|7, 5APN|1|7, 5DGE|1|7, 5DGF|1|3, 5FCI|1|7, 5JUU|1|D, 5M1J|1|34, 3J6Y|1|5S, 4U4O|1|7, 5MC6|1|BR, 3JCT|1|3, 3J6X|1|5S, 3J77|1|5S, 5JUT|1|D, 5H4P|1|3, 5JUS|1|D, 4V6I|1|DC, 5GAK|1|3, 5JUO|1|D, 4V7R|1|D2, 4V7R|1|B2, 5FL8|1|z, 5JCS|1|z, 4V7F|1|3
11NR_all_90506.17
Exact match
Saccharomyces cerevisiae
4V88|1|A5+4V88|1|A8 (4V88)
  • 25S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): A5, A8; model(s): 1
3.0 Å3150(89) 4V88|1|A5+4V88|1|A8, 4V8T|1|5+4V8T|1|8, 4V88|1|A1+4V88|1|A4, 5TBW|1|AR+5TBW|1|AT, 4U4Q|1|5+4U4Q|1|8, 4U3U|1|1+4U3U|1|4, 4U4R|1|1+4U4R|1|4, 4U4R|1|5+4U4R|1|8, 4V8Y|1|B5+4V8Y|1|B8, 4V8Z|1|B5+4V8Z|1|B8, 4U52|1|5+4U52|1|8, 4U4U|1|1+4U4U|1|4, 5TBW|1|1+5TBW|1|4, 4U4Z|1|1+4U4Z|1|4, 5LYB|1|5+5LYB|1|8, 5DGV|1|5+5DGV|1|8, 4U4Q|1|1+4U4Q|1|4, 5I4L|1|5+5I4L|1|8, 4U3U|1|5+4U3U|1|8, 4U3M|1|1+4U3M|1|4, 4U55|1|1+4U55|1|4, 4U4N|1|1+4U4N|1|4, 4U4U|1|5+4U4U|1|8, 5FCJ|1|5+5FCJ|1|8, 5DGV|1|1+5DGV|1|4, 4U52|1|1+4U52|1|4, 5DC3|1|5+5DC3|1|8, 4U4Y|1|5+4U4Y|1|8, 5FCJ|1|1+5FCJ|1|4, 4U3N|1|5+4U3N|1|8, 5DAT|1|1+5DAT|1|4, 4U4N|1|5+4U4N|1|8, 5LYB|1|1+5LYB|1|4, 4U6F|1|1+4U6F|1|4, 4U50|1|5+4U50|1|8, 4U50|1|1+4U50|1|4, 4U55|1|5+4U55|1|8, 4U3M|1|5+4U3M|1|8, 5DGE|1|5+5DGE|1|8, 5I4L|1|1+5I4L|1|4, 4U4Z|1|5+4U4Z|1|8, 4U3N|1|1+4U3N|1|4, 4U53|1|5+4U53|1|8, 4U4Y|1|1+4U4Y|1|4, 5FCI|1|1+5FCI|1|4, 5APO|1|5+5APO|1|8, 5MEI|1|AR+5MEI|1|AT, 5DAT|1|5+5DAT|1|8, 5DGE|1|1+5DGE|1|4, 4U51|1|1+4U51|1|4, 5DC3|1|1+5DC3|1|4, 4U6F|1|5+4U6F|1|8, 4U51|1|5+4U51|1|8, 5MEI|1|1+5MEI|1|4, 5TGA|1|1+5TGA|1|4, 5DGF|1|5+5DGF|1|8, 5DGF|1|1+5DGF|1|4, 4U53|1|1+4U53|1|4, 5TGA|1|5+5TGA|1|8, 4U56|1|1+4U56|1|4, 5FCI|1|5+5FCI|1|8, 4U56|1|5+4U56|1|8, 5TGM|1|1+5TGM|1|4, 5APN|1|5+5APN|1|8, 5TGM|1|5+5TGM|1|8, 5T6R|1|A+5T6R|1|C, 5T62|1|A+5T62|1|C, 5MC6|1|BQ+5MC6|1|BS, 4U4O|1|5+4U4O|1|8, 5JUP|1|B+5JUP|1|C, 5M1J|1|14+5M1J|1|44, 4U4O|1|1+4U4O|1|4, 5H4P|1|1+5H4P|1|4, 3J77|1|2S+3J77|1|8S, 5JUU|1|B+5JUU|1|C, 3JCT|1|1+3JCT|1|2, 3J78|1|2S+3J78|1|8S, 5JUT|1|B+5JUT|1|C, 3J6Y|1|2S+3J6Y|1|8S, 3J6X|1|2S+3J6X|1|8S, 4V6I|1|DA+4V6I|1|DB, 5GAK|1|1+5GAK|1|4, 5JUO|1|B+5JUO|1|C, 5JUS|1|B+5JUS|1|C, 4V7R|1|B1+4V7R|1|B3, 4V7R|1|D1+4V7R|1|D3, 5JCS|1|x, 5FL8|1|x, 4V7F|1|1
12NR_all_03510.15
Exact match
Saccharomyces cerevisiae
4V88|1|A6 (4V88)
  • 18S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): A6; model(s): 1
3.0 Å1770(82) 4V88|1|A6, 4U4R|1|6, 4U50|1|6, 4U4Q|1|6, 5TBW|1|sR, 4U3U|1|6, 5LYB|1|6, 4U52|1|6, 4U4U|1|6, 4V88|1|A2, 4V8Z|1|B2, 4V8Y|1|B2, 4U4R|1|2, 5FCJ|1|6, 5I4L|1|6, 4U3U|1|2, 5FCI|1|6, 5DC3|1|6, 4U3N|1|6, 4U6F|1|6, 4U4N|1|6, 4U55|1|6, 5DAT|1|6, 4U4Y|1|6, 4U53|1|6, 4U4Q|1|2, 4U4U|1|2, 4U4Z|1|6, 4U4N|1|2, 4U52|1|2, 5TBW|1|A, 4U3M|1|6, 5MEI|1|6, 4U51|1|6, 5DGV|1|6, 4U3M|1|2, 4U55|1|2, 4U51|1|2, 4U4Z|1|2, 5I4L|1|2, 5TGA|1|6, 4U3N|1|2, 5DGV|1|2, 4U50|1|2, 4U56|1|6, 5DGF|1|6, 4U4Y|1|2, 5LYB|1|2, 4U53|1|2, 4U6F|1|2, 5TGA|1|2, 5MEI|1|A, 5TZS|1|1, 5TGM|1|6, 5DGE|1|6, 5DC3|1|2, 5FCJ|1|2, 5DAT|1|2, 5TGM|1|2, 5FCI|1|2, 5DGE|1|2, 4U56|1|2, 3J6Y|1|1S, 5JUU|1|A, 5DGF|1|2, 4U4O|1|6, 3J78|1|1S, 3J77|1|1S, 5M1J|1|22, 3J6X|1|1S, 5JUP|1|A, 5JUT|1|A, 5MC6|1|2, 5LL6|1|2, 5JUS|1|A, 4U4O|1|2, 5JUO|1|A, 5WYJ|1|SA+5WYJ|1|5A+5WYJ|1|3A, 5WYK|1|SA+5WYK|1|5A+5WYK|1|3A, 4V7R|1|C1, 4V7R|1|A1, 4V6I|1|CA
13NR_all_26150.1
Exact match
Haloarcula marismortui
4V9F|1|0 (4V9F)
  • 23S Ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): 0; model(s): 1
2.4 Å2803(69) 4V9F|1|0, 1S72|1|0, 1VQO|1|0, 3CC2|1|0, 1VQK|1|0, 1VQP|1|0, 3CCU|1|0, 1JJ2|1|0, 1K73|1|A, 1VQ6|1|0, 3CPW|1|0, 1VQM|1|0, 3CC4|1|0, 3G6E|1|0, 1VQ4|1|0, 1VQ8|1|0, 1QVF|1|0, 1VQL|1|0, 1M90|1|A, 3CCM|1|0, 1VQ9|1|0, 1YHQ|1|0, 1NJI|1|A, 1VQ7|1|0, 1VQN|1|0, 1YI2|1|0, 3CC7|1|0, 1KQS|1|0, 3CXC|1|0, 1KC8|1|A, 1K9M|1|A, 1VQ5|1|0, 3OW2|1|0, 3CCL|1|0, 3CMA|1|0, 1YIT|1|0, 3CCV|1|0, 3CCQ|1|0, 1YIJ|1|0, 1YJW|1|0, 3G71|1|0, 1M1K|1|A, 1N8R|1|A, 1Q86|1|A, 1YJN|1|0, 1Q82|1|A, 1FFK|1|0, 2OTL|1|0, 3CD6|1|0, 1Q81|1|A, 1K8A|1|A, 1YJ9|1|0, 3CCE|1|0, 1KD1|1|A, 3I55|1|0, 3I56|1|0, 1Q7Y|1|A, 1QVG|1|0, 2OTJ|1|0, 3CCS|1|0, 2QEX|1|0, 3CME|1|0, 3CCR|1|0, 1W2B|1|0, 3CCJ|1|0, 2QA4|1|0, 3G4S|1|0, 1FG0|1|A, 1FFZ|1|A
14NR_all_25303.1
Exact match
Haloarcula marismortui
1S72|1|9 (1S72)
  • 5S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): 9; model(s): 1
2.4 Å122(67) 1S72|1|9, 3CCE|1|9, 3CCQ|1|9, 1VQ5|1|9, 1VQ4|1|9, 1M90|1|B, 1KQS|1|9, 1VQO|1|9, 1VQP|1|9, 3CPW|1|9, 3CXC|1|9, 1VQ6|1|9, 1YIJ|1|9, 1VQM|1|9, 3CCV|1|9, 1YHQ|1|9, 1Q86|1|B, 1NJI|1|B, 1YI2|1|9, 1VQK|1|9, 1VQL|1|9, 1JJ2|1|9, 3CCU|1|9, 1VQ7|1|9, 1FFK|1|9, 2QEX|1|9, 3CC4|1|9, 3CCL|1|9, 2OTJ|1|9, 3CC7|1|9, 1YIT|1|9, 1VQ8|1|9, 3CCM|1|9, 1YJW|1|9, 1VQN|1|9, 4V9F|1|9, 1QVG|1|9, 3CC2|1|9, 1VQ9|1|9, 3G6E|1|9, 1KC8|1|B, 1Q82|1|B, 1K9M|1|B, 1K73|1|B, 1K8A|1|B, 3CMA|1|9, 1QVF|1|9, 2OTL|1|9, 3OW2|1|9, 2QA4|1|9, 1N8R|1|B, 1Q7Y|1|B, 1KD1|1|B, 1W2B|1|9, 3CME|1|9, 3CCJ|1|9, 1YJN|1|9, 3CD6|1|9, 1M1K|1|B, 3CCR|1|9, 3G71|1|9, 3G4S|1|9, 1Q81|1|B, 1YJ9|1|9, 3CCS|1|9, 3I55|1|9, 3I56|1|9
15NR_all_06843.2
Exact match
Escherichia coli
4V49|1|AW (4V49)
  • tRNA-Phe
  • X-RAY DIFFRACTION
  • Chain(s): AW; model(s): 1
8.7 Å76(47) 4V49|1|AW, 4V49|1|AV, 1ZO3|1|A, 1ZO3|1|B, 1ZO1|1|F, 4V65|1|AE, 3WC2|1|P, 4V65|1|AA, 3DEG|1|A, 4V42|1|AB, 1JGP|1|B, 1JGQ|1|B, 1JGO|1|B, 1MJ1|1|D, 1TTT|1|F, 4V4T|1|AW, 4V4R|1|AW, 4V4S|1|AW, 4V4W|1|AU, 4V4V|1|AU, 4V4V|1|AV, 4V4W|1|AW, 4V4V|1|AW, 4V69|1|AY, 1EVV|1|A, 4V42|1|AC, 1ML5|1|B, 1MJ1|1|C, 1JGP|1|C, 1JGQ|1|C, 1JGO|1|C, 1SZ1|1|E, 1TTT|1|E, 1SZ1|1|F, 4V66|1|AA, 4V4W|1|AV, 3WC2|1|Q, 4V66|1|AP, 1TTT|1|D, 4V66|1|AE, 4V65|1|AP, 4V4S|1|AV, 4V4T|1|AV, 4V4R|1|AV, 4V48|1|A6, 3EP2|1|Y, 3EQ3|1|Y
16NR_all_88987.5
Exact match
Deinococcus radiodurans
4IOA|1|X (4IOA)
  • 23S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.2 Å2686(44) 4IOA|1|X, 4IO9|1|X, 4IOC|1|X, 5DM6|1|X, 2ZJR|1|X, 3CF5|1|X, 5JVG|1|X, 5JVH|1|X, 2ZJP|1|X, 2ZJQ|1|X, 4U67|1|X, 4WFN|1|X, 3DLL|1|X, 5DM7|1|X, 2AAR|1|0, 2OGM|1|0, 3PIO|1|X, 3JQ4|1|A, 2D3O|1|0, 1Y69|1|0, 3PIP|1|X, 2OGO|1|0, 1JZY|1|A, 1K01|1|A, 1JZX|1|A, 1JZZ|1|A, 1J5A|1|A, 2O44|1|A, 2OGN|1|0, 1NWX|1|0, 1OND|1|0, 1NWY|1|0, 1NKW|1|0, 3FWO|1|A, 1NJO|1|0, 1P9X|1|0, 1NJP|1|0, 1NJM|1|0, 1NJN|1|0, 2O43|1|A, 1SM1|1|0, 1XBP|1|0, 1Z58|1|2, 2O45|1|A
17NR_all_20721.6
Exact match
Thermus thermophilus
4V9B|1|AC (4V9B)
  • TRNA-FMET
  • X-RAY DIFFRACTION
  • Chain(s): AC; model(s): 1
3.1 Å77(40) 4V9B|1|AC, 4V5M|1|AV, 4V95|1|AV, 4V8X|1|CV, 4V9A|1|AC, 4V5N|1|AV, 4V9N|1|AW, 4V9N|1|CW, 3J9Z|1|S6, 5J8B|1|x, 4V8X|1|AV, 4V7J|1|Av, 4V7J|1|Bv, 4V9B|1|CC, 4V95|1|CV, 5E81|1|2K, 5E81|1|2L, 5LMT|1|Z, 4V7K|1|Bv, 4WT8|1|C4, 4V9A|1|CC, 4L47|1|QV, 3JA1|1|S2, 4L47|1|XV, 5LMR|1|Z, 4V68|1|AV, 4V7K|1|Av, 4V8U|1|AW, 4V8U|1|CW, 4V4J|1|z, 4V9B|1|AD, 4V7K|1|Bw, 4V8X|1|CW, 4V5A|1|AW, 4V7K|1|Aw, 4V8X|1|AW, 4V7J|1|Bw, 4V7J|1|Aw, 4V5A|1|CW, 4V9B|1|CD
18NR_all_21736.3
Exact match
Tobacco virtovirus 1
4OQ9|1|z (4OQ9)
  • RNA (5'-R(P*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): z; model(s): 1
1.5 Å2(37) 4OQ9|1|z, 4NIA|1|1, 4OQ9|1|1, 4NIA|1|2, 4OQ9|1|2, 4NIA|1|3, 4OQ9|1|3, 4NIA|1|4, 4OQ9|1|4, 4NIA|1|5, 4OQ9|1|5, 4NIA|1|6, 4OQ9|1|6, 4NIA|1|7, 4OQ9|1|7, 4NIA|1|8, 4OQ9|1|8, 3ER9|1|D, 4OQ8|1|D, 2VRT|1|E, 1DDL|1|E, 2VRT|1|F, 5KAL|1|Y, 5KAL|1|Z, 4NIA|1|t, 4OQ9|1|t, 4NIA|1|u, 4OQ9|1|u, 4NIA|1|v, 4OQ9|1|v, 4NIA|1|w, 4OQ9|1|w, 4NIA|1|x, 4OQ9|1|x, 4NIA|1|y, 4OQ9|1|y, 4NIA|1|z
19NR_all_51266.1
Exact match
1ZDK|1|S (1ZDK)
  • RNA (5'-R(P*AP*CP*AP*UP*GP*AP*GP*GP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): S; model(s): 1
2.9 Å19(36) 1ZDK|1|S, 2C4Z|1|R, 2C4Y|1|R, 2C4Q|1|R, 2BU1|1|R, 2C4Q|1|S, 2BU1|1|S, 2C4Z|1|S, 2IZ9|1|R, 2BQ5|1|S, 2BNY|1|R, 2C51|1|R, 2C4Y|1|S, 2BQ5|1|R, 1ZDI|1|R, 2IZ8|1|R, 1AQ3|1|R, 1AQ4|1|R, 2B2G|1|R, 2B2E|1|R, 1ZDH|1|R, 2IZM|1|R, 1ZDI|1|S, 1ZDH|1|S, 2IZM|1|S, 2IZ8|1|S, 2BNY|1|S, 2C50|1|S, 2C51|1|S, 2C50|1|R, 1AQ4|1|S, 2IZ9|1|S, 2B2E|1|S, 2B2G|1|S, 1ZDK|1|R, 1AQ3|1|S
20NR_all_97151.1
Exact match
3TD1|1|B+3TD1|1|A (3TD1)
  • RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B; model(s): 1
2.1 Å22(34) 3TD1|1|B+3TD1|1|A, 3BNL|1|A+3BNL|1|B, 1MWL|1|A+1MWL|1|B, 5BWS|1|A+5BWS|1|B, 4PDQ|1|A+4PDQ|1|B, 2ESI|1|A+2ESI|1|B, 1YRJ|1|A+1YRJ|1|B, 2F4T|1|B+2F4T|1|A, 5BXK|1|C+5BXK|1|D, 5BWS|1|C+5BWS|1|D, 5BXK|1|A+5BXK|1|B, 4GPW|1|A+4GPW|1|B, 4WCP|1|A+4WCP|1|B+4WCP|1|C, 4GPY|1|A+4GPY|1|B, 4F8U|1|A+4F8U|1|B, 2BEE|1|A+2BEE|1|B, 4F8V|1|A+4F8V|1|B, 2ET4|1|A+2ET4|1|B, 2BE0|1|A+2BE0|1|B, 1LC4|1|A+1LC4|1|B, 4P20|1|A+4P20|1|B, 4GPX|1|A+4GPX|1|B, 3S4P|1|A+3S4P|1|B, 2ET5|1|A+2ET5|1|B, 4WCS|1|A+4WCS|1|B, 2PWT|1|A+2PWT|1|B, 4WCR|1|A+4WCR|1|B, 2ESJ|1|A+2ESJ|1|B, 3WRU|1|A+3WRU|1|B, 4K32|1|A+4K32|1|B, 2ET3|1|A+2ET3|1|B, 4WCQ|1|A+4WCQ|1|B, 1J7T|1|A+1J7T|1|B, 4P3S|1|B+4P3S|1|A
21NR_all_24132.2
Exact match
Tobacco virtovirus 1
4OQ9|1|d (4OQ9)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): d; model(s): 1
1.5 Å10(32) 4OQ9|1|d, 1A34|1|B+1A34|1|C, 4OQ8|1|B+4OQ8|1|C, 4OQ9|1|P+4OQ9|1|e, 4NIA|1|P+4NIA|1|e, 4NIA|1|Q, 4OQ9|1|Q, 4NIA|1|R+4NIA|1|g, 4OQ9|1|R+4OQ9|1|g, 4NIA|1|S+4NIA|1|h, 4OQ9|1|S+4OQ9|1|h, 4OQ9|1|T+4OQ9|1|i, 4NIA|1|T+4NIA|1|i, 4NIA|1|U, 4OQ9|1|U, 4NIA|1|V, 4OQ9|1|V, 4NIA|1|W, 4OQ9|1|W, 4OQ9|1|X+4OQ9|1|m, 4NIA|1|X+4NIA|1|m, 4NIA|1|Y+4NIA|1|n, 4OQ9|1|Y+4OQ9|1|n, 4OQ9|1|Z, 4NIA|1|Z, 4OQ9|1|a, 4NIA|1|a, 4OQ9|1|b, 4NIA|1|b, 4OQ9|1|c, 4NIA|1|c, 4NIA|1|d
22NR_all_89292.1
Exact match
4V8E|1|BB (4V8E)
  • TRNA-TYR
  • X-RAY DIFFRACTION
  • Chain(s): BB; model(s): 1
3.3 Å84(32) 4V8E|1|BB, 4V8D|1|AD, 4V8E|1|BD, 4V8E|1|DD, 4WQ1|1|3L, 4V8D|1|AB, 4V8E|1|DB, 4V8D|1|CD, 4WU1|1|3K, 4WQ1|1|3K, 4WR6|1|3K, 4WZD|1|3K, 4WZD|1|3L, 4V8F|1|BD, 4V8F|1|CD, 4WZD|1|2K, 4WU1|1|2K, 4WRA|1|3K, 4WU1|1|2L, 4V8F|1|BB, 4V8F|1|CB, 4V8D|1|CB, 4WQ1|1|1K, 4WRA|1|1K, 4WU1|1|3L, 4WZD|1|2L, 4WQ1|1|1L, 4WR6|1|1K, 4WRA|1|3L, 4WR6|1|1L, 4WR6|1|3L, 4WRA|1|1L
23NR_all_89429.2
Exact match
4FE5|1|B (4FE5)
  • xpt-pbuX guanine riboswitch aptamer doma[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.3 Å67(29) 4FE5|1|B, 3FO4|1|A, 3GOG|1|A, 2XNZ|1|A, 2EEV|1|A, 2G9C|1|A, 3FO6|1|A, 3GAO|1|A, 3GER|1|A, 2EET|1|A, 4FEN|1|B, 4FEO|1|B, 4FEP|1|B, 2EEW|1|A, 2EES|1|A, 2EEU|1|A, 3GES|1|A, 3DS7|1|A, 4FEJ|1|B, 5C7U|1|B, 3DS7|1|B, 4FEL|1|B, 2XO0|1|A, 2XNW|1|A, 2XO1|1|A, 3GOT|1|A, 3G4M|1|A, 2B57|1|A, 5C7W|1|C
24NR_all_94729.2
Exact match
1JBR|1|D (1JBR)
  • 31-mer SRD RNA analog
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.2 Å31(27) 1JBR|1|D, 3DEG|1|I, 1JBT|1|C, 1JBT|1|D, 480D|1|A, 4Y27|1|A, 4NLF|1|A, 1JBS|1|C, 1JBS|1|D, 3DW4|1|A, 1MSY|1|A, 3DW6|1|A, 5D99|1|A, 3DVZ|1|A, 3S7C|1|A, 4NXH|1|A, 5NQI|1|A, 3S8U|1|A, 1Q9A|1|A, 483D|1|A, 3DW5|1|A, 4NMG|1|A, 3DW7|1|A, 3EQ3|1|D, 3EP2|1|D, 3EQ4|1|D, 1EG0|1|M
25NR_all_35054.3
Exact match
Oceanobacillus iheyensis
5J01|1|A (5J01)
  • group II intron lariat
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.4 Å414(26) 5J01|1|A, 4FAW|1|A, 4FAU|1|A, 4Y1O|1|A, 5J02|1|A, 4Y1N|1|A, 3G78|1|A, 3IGI|1|A, 4Y1N|1|B, 4E8Q|1|A, 4E8N|1|A, 4E8K|1|A, 4FAR|1|A, 4Y1O|1|B, 4E8T|1|A, 4FB0|1|A, 4E8P|1|A, 4FAQ|1|A, 3BWP|1|A, 4E8R|1|A, 4DS6|1|A, 4E8M|1|A, 3EOH|1|A, 4FAX|1|A, 3EOG|1|A, 4E8V|1|A
26NR_all_98705.1
Exact match
2P7E|1|D+2P7E|1|C+2P7E|1|P (2P7E)
  • Ribozyme strand III
  • X-RAY DIFFRACTION
  • Chain(s): C, D, P; model(s): 1
2.1 Å19(25) 2P7E|1|D+2P7E|1|C+2P7E|1|P, 2D2K|1|D+2D2K|1|C+2D2K|1|A+2D2K|1|B, 3I2R|1|C, 3I2U|1|C, 3I2Q|1|C, 3CQS|1|C, 3CR1|1|C, 3I2S|1|C, 3GS8|1|D+3GS8|1|C+3GS8|1|A+3GS8|1|B, 1ZFV|1|D+1ZFV|1|C+1ZFV|1|A+1ZFV|1|B, 4G6R|1|D+4G6R|1|C+4G6R|1|A+4G6R|1|B, 2P7D|1|D+2P7D|1|C+2P7D|1|P, 1X9K|1|D+1X9K|1|C+1X9K|1|A+1X9K|1|B, 2NPZ|1|D+2NPZ|1|C+2NPZ|1|A+2NPZ|1|B, 1X9C|1|D+1X9C|1|C+1X9C|1|A+1X9C|1|B, 3GS1|1|D+3GS1|1|C+3GS1|1|A+3GS1|1|B, 2BCZ|1|D+2BCZ|1|C+2BCZ|1|A+2BCZ|1|B, 2NPY|1|D+2NPY|1|C+2NPY|1|A+2NPY|1|B, 2OUE|1|D+2OUE|1|C+2OUE|1|A+2OUE|1|B, 2BCY|1|D+2BCY|1|C+2BCY|1|A+2BCY|1|B, 1ZFT|1|D+1ZFT|1|C+1ZFT|1|A+1ZFT|1|B, 2FGP|1|D+2FGP|1|C+2FGP|1|A+2FGP|1|B, 1ZFX|1|D+1ZFX|1|C+1ZFX|1|A+1ZFX|1|B, 2P7F|1|D+2P7F|1|C+2P7F|1|A+2P7F|1|B, 2D2L|1|D+2D2L|1|C+2D2L|1|A+2D2L|1|B
27NR_all_08692.1
Exact match
2NZ4|1|Q (2NZ4)
  • GlmS ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
2.5 Å140(24) 2NZ4|1|Q, 3G9C|1|S, 3G96|1|Q, 2NZ4|1|R, 3L3C|1|R, 3L3C|1|Q, 3G96|1|R, 3G8T|1|P, 3G8S|1|R, 2NZ4|1|P, 3G8T|1|R, 3G9C|1|Q, 3G96|1|S, 3G96|1|P, 3G8T|1|Q, 3L3C|1|P, 3G8S|1|Q, 2NZ4|1|S, 3G9C|1|P, 3G8T|1|S, 3L3C|1|S, 3G8S|1|P, 3G9C|1|R, 3G8S|1|S
28NR_all_17405.5
Exact match
Deinococcus radiodurans
5DM6|1|Y (5DM6)
  • 5S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.9 Å122(24) 5DM6|1|Y, 4IOA|1|Y, 4IO9|1|Y, 2ZJR|1|Y, 2ZJP|1|Z, 2ZJQ|1|Y, 3CF5|1|Z, 3DLL|1|Z, 4IOC|1|Y, 5DM7|1|Y, 3FWO|1|B, 1Y69|1|9, 3JQ4|1|B, 5JVG|1|Y, 5JVH|1|Y, 1XBP|1|9, 4U67|1|Y, 3PIP|1|Y, 1SM1|1|9, 1NWX|1|9, 1NKW|1|9, 1NWY|1|9, 3PIO|1|Y, 4WFN|1|Y
29NR_all_31819.2
Exact match
Escherichia coli
1QRS|1|B (1QRS)
  • TRNAGLN2
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å74(23) 1QRS|1|B, 1O0C|1|B, 1QTQ|1|B, 1QRT|1|B, 1GTR|1|B, 1GTS|1|B, 1QRU|1|B, 1O0B|1|B, 1EUY|1|B, 4JXX|1|B, 1EXD|1|B, 2RE8|1|B, 5NWY|1|M, 2RD2|1|B, 1ZJW|1|B, 4V7L|1|AW, 1EUQ|1|B, 4V7M|1|AW, 4V7M|1|CW, 4V7L|1|CW, 4V7L|1|CY, 4V7L|1|AY, 1GSG|1|T
30NR_all_21280.1
Exact match
Oryctolagus cuniculus
4KZY|1|i (4KZY)
  • 18S Ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): i; model(s): 1
7.0 Å1840(23) 4KZY|1|i, 5LZT|1|9, 5LZV|1|9, 5LZX|1|9, 5LZU|1|9, 5LZY|1|9, 5LZZ|1|9, 5LZW|1|9, 5LZS|1|9, 3JAG|1|9, 3JAH|1|9, 3JAI|1|9, 5FLX|1|1, 5K0Y|1|A, 4KZZ|1|i, 4KZX|1|i, 3JAN|1|S2, 3JAJ|1|S2, 4UJC|1|C1, 4UJD|1|C1, 4D61|1|1, 4D5L|1|1, 4UJE|1|B1
31NR_all_66387.1
Exact match
3OK4|1|Z (3OK4)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
1.2 Å10(22) 3OK4|1|Z, 3OK4|1|2, 3OK4|1|4, 3OK4|1|B, 3OK2|1|B, 3OK4|1|D, 3OK2|1|D, 2BJ6|1|E, 3OK4|1|F, 3OK2|1|F, 2BJ6|1|F, 2BJ6|1|G, 3OK4|1|H, 2BJ6|1|H, 3OK4|1|J, 3OK4|1|L, 3OK4|1|N, 3OK4|1|P, 3OK4|1|R, 3OK4|1|T, 3OK4|1|V, 3OK4|1|X
32NR_all_89906.2
Exact match
Thermotoga maritima
3WFS|1|A (3WFS)
  • RNA (74-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.3 Å74(22) 3WFS|1|A, 3WFS|1|B, 5HC9|1|D, 5HC9|1|C, 3WFR|1|C, 3WFR|1|D, 3WFQ|1|D, 3WFR|1|B, 3WFQ|1|C, 4WC5|1|B, 3WFR|1|A, 4WC6|1|B, 4WC2|1|B, 3WFQ|1|A, 3WFQ|1|B, 4WC4|1|B, 4WC7|1|B, 4WC3|1|B, 4X0A|1|B, 4X0B|1|B, 1VFG|1|C, 1VFG|1|D
33NR_all_29423.1
Exact match
4V4F|1|BZ (4V4F)
  • 5'-R(*UP*AP*GP*AP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): BZ; model(s): 1
1.9 Å3(22) 4V4F|1|BZ, 4V4F|1|A3, 4V4F|1|A5, 4V4F|1|B0, 4V4F|1|B6, 4V4F|1|A0, 4V4F|1|A1, 4V4F|1|A2, 4V4F|1|A4, 4V4F|1|A7, 4V4F|1|A8, 4V4F|1|A9, 4V4F|1|AZ, 4V4F|1|B1, 4V4F|1|B4, 4V4F|1|B5, 4V4F|1|B7, 4V4F|1|B8, 4V4F|1|B9, 4V4F|1|A6, 4V4F|1|B2, 4V4F|1|B3
34NR_all_73187.1
Exact match
Escherichia coli
2WJ8|1|t (2WJ8)
  • RNA (5'-R(*CP*CP*CP*CP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): t; model(s): 1
3.3 Å7(20) 2WJ8|1|t, 2WJ8|1|a, 2WJ8|1|b, 2WJ8|1|c, 2WJ8|1|d, 2WJ8|1|e, 2WJ8|1|f, 2WJ8|1|g, 2WJ8|1|h, 2WJ8|1|i, 2WJ8|1|j, 2WJ8|1|k, 2WJ8|1|l, 2WJ8|1|m, 2WJ8|1|n, 2WJ8|1|o, 2WJ8|1|p, 2WJ8|1|q, 2WJ8|1|r, 2WJ8|1|s
35NR_all_74924.4
Exact match
3PEY|1|B (3PEY)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.4 Å6(20) 3PEY|1|B, 3PF5|1|R, 5ELX|1|B, 3PEW|1|B, 4ALP|1|E, 2HYI|1|F, 3EX7|1|F, 3EX7|1|J, 2HYI|1|L, 4Y91|1|N, 4Y91|1|O, 4NL3|1|R, 4NL3|1|Z, 3O8R|1|C, 3O8C|1|C, 5BTE|1|C, 5BTE|1|D, 1N34|1|Z, 5SZE|1|C, 3PF5|1|S
36NR_all_10255.1
Exact match
Oryctolagus cuniculus
3J92|1|7 (3J92)
  • 5S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 7; model(s): 1
3.6 Å120(19) 3J92|1|7, 3JAG|1|7, 3JAH|1|7, 5LZZ|1|7, 3JAI|1|7, 5LZS|1|7, 5LZY|1|7, 5LZW|1|7, 5LZT|1|7, 5LZX|1|7, 5LZU|1|7, 5LZV|1|7, 3JAN|1|7, 3JAJ|1|7, 4D67|1|4, 4D5Y|1|4, 4UJC|1|A4, 4UJD|1|A4, 4UJE|1|A4
37NR_all_76703.4
Exact match
Escherichia coli
5E7K|1|1K (5E7K)
  • tRNALys
  • X-RAY DIFFRACTION
  • Chain(s): 1K; model(s): 1
3.2 Å66(19) 5E7K|1|1K, 5JTE|1|AW, 5UYQ|1|Y, 5UYN|1|Y, 5UYP|1|Y, 5IB7|1|1L, 5IB7|1|1K, 5E81|1|1K, 5IB8|1|1K, 5EL6|1|1L, 5E7K|1|1L, 5EL7|1|1L, 5EL4|1|1K, 5EL7|1|1K, 5E81|1|1L, 5EL4|1|1L, 5EL6|1|1K, 5EL5|1|1L, 5EL5|1|1K
38NR_all_06650.1
Exact match
Oryctolagus cuniculus
5LZS|1|5+5LZS|1|8 (5LZS)
  • 28S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 5, 8, P; model(s): 1
3.3 Å3543(19) 5LZS|1|5+5LZS|1|8, 5LZZ|1|5+5LZZ|1|8, 5LZX|1|5+5LZX|1|8, 5LZU|1|5+5LZU|1|8, 5LZW|1|5+5LZW|1|8, 5LZT|1|5+5LZT|1|8, 5LZY|1|5+5LZY|1|8, 5LZV|1|5+5LZV|1|8, 3J92|1|5+3J92|1|8, 3JAI|1|5+3JAI|1|8, 3JAG|1|5+3JAG|1|8, 3JAH|1|5+3JAH|1|8, 3JAJ|1|5+3JAJ|1|8, 3JAN|1|5+3JAN|1|8, 4D67|1|2+4D67|1|3, 4D5Y|1|2+4D5Y|1|3, 4UJC|1|A2+4UJC|1|A3, 4UJE|1|A2+4UJE|1|A3, 4UJD|1|A2+4UJD|1|A3
39NR_all_09128.1
Exact match
1XPU|1|M (1XPU)
  • 5'-R(*CP*UP*CP*UP*CP*UP*CP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
3.1 Å2(18) 1XPU|1|M, 1XPR|1|G, 1XPU|1|G, 1XPO|1|G, 1XPR|1|H, 1XPU|1|H, 1XPO|1|H, 1XPR|1|J, 1XPU|1|J, 1XPO|1|J, 1XPR|1|K, 1XPU|1|K, 1XPO|1|K, 1XPR|1|L, 1XPU|1|L, 1XPO|1|L, 1XPR|1|M, 1XPO|1|M
40NR_all_66108.1
Exact match
2DR8|1|B (2DR8)
  • tRNA (33-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å33(18) 2DR8|1|B, 2ZHA|1|B, 2DR7|1|B, 2ZH1|1|B, 2ZH9|1|B, 2ZH7|1|B, 2ZH5|1|B, 2ZH8|1|B, 2ZH4|1|B, 2ZHB|1|B, 2DR9|1|B, 2ZH6|1|B, 2DVI|1|B, 2ZH3|1|B, 2ZH2|1|B, 2DRA|1|B, 2DRB|1|B, 2DR5|1|B
41NR_all_32185.1
Exact match
3OX0|1|A (3OX0)
  • Domain II of glycine riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å86(18) 3OX0|1|A, 3OWZ|1|B, 3OXJ|1|A, 3OXE|1|A, 3OWZ|1|A, 3OWW|1|A, 3OXM|1|A, 3OWW|1|B, 3OWI|1|B, 3OXE|1|B, 3OXM|1|B, 3OX0|1|B, 3OXJ|1|B, 3OWI|1|A, 3OXB|1|A, 3OXD|1|A, 3OXD|1|B, 3OXB|1|B
42NR_all_51111.1
Exact match
Tobacco virtovirus 1
4OQ9|1|s (4OQ9)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): s; model(s): 1
1.5 Å10(18) 4OQ9|1|s, 4OQ9|1|f, 4NIA|1|f, 4OQ9|1|j, 4NIA|1|j, 4OQ9|1|k, 4NIA|1|k, 4OQ9|1|l, 4NIA|1|l, 4OQ9|1|o, 4NIA|1|o, 4NIA|1|p, 4OQ9|1|p, 4OQ9|1|q, 4NIA|1|q, 4OQ9|1|r, 4NIA|1|r, 4NIA|1|s
43NR_all_51503.1
Exact match
Homo sapiens
4X4O|1|D (4X4O)
  • G70A tRNA minihelix
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.2 Å34(18) 4X4O|1|D, 4X4T|1|D, 4X4O|1|B, 4X4S|1|B, 4X4R|1|B, 4X4Q|1|B, 4X4T|1|B, 4X4N|1|D, 4X4N|1|B, 4X4P|1|D, 4X4Q|1|D, 4X4P|1|H, 4X4P|1|B, 4X4S|1|D, 4X4R|1|D, 4X4P|1|F, 4X4T|1|G, 4X4N|1|G
44NR_all_30153.3
Exact match
Saccharomyces cerevisiae
5AXM|1|P (5AXM)
  • RNA (75-MER)
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.2 Å72(18) 5AXM|1|P, 1I9V|1|A, 1EHZ|1|A, 4TRA|1|A, 1TRA|1|A, 6TNA|1|A, 1FCW|1|A, 1FCW|1|B, 1FCW|1|C, 1FCW|1|D, 1FCW|1|E, 5AXN|1|P, 1OB2|1|B, 1TN1|1|A, 4TNA|1|A, 1TN2|1|A, 5M1J|1|A3, 1LS2|1|B
45NR_all_67726.2
Exact match
synthetic construct
5F9F|1|L (5F9F)
  • RNA (5'-R(*GP*AP*AP*UP*AP*UP*AP*AP*UP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
2.6 Å24(18) 5F9F|1|L, 5F98|1|B, 5F9F|1|B, 5F98|1|D, 5F9F|1|D, 5F98|1|F, 5F9F|1|F, 5F9F|1|H, 5F98|1|H, 5F98|1|J, 5F9F|1|J, 5F98|1|L, 5F9H|1|B, 5F9H|1|D, 5F9H|1|F, 5F9H|1|H, 5F9H|1|J, 5F9H|1|L
46NR_all_78706.1
Exact match
1XPE|1|A+1XPE|1|B (1XPE)
  • 5'-R(*CP*UP*UP*GP*CP*UP*GP*AP*AP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, P; model(s): 1
1.9 Å23(17) 1XPE|1|A+1XPE|1|B, 2B8S|1|A+2B8S|1|B, 1XP7|1|A+1XP7|1|B, 2B8R|1|A+2B8R|1|B, 1XPF|1|A+1XPF|1|B, 2FCY|1|A+2FCY|1|B, 2FCX|1|A+2FCX|1|B, 1ZCI|1|A+1ZCI|1|B, 2FD0|1|A+2FD0|1|B, 1Y3S|1|A+1Y3S|1|B, 1Y3O|1|A+1Y3O|1|B, 2FCZ|1|A+2FCZ|1|B, 1YXP|1|A+1YXP|1|B, 1ZCI|1|C+1ZCI|1|D, 2FCZ|1|C+2FCZ|1|D, 1K9W|1|B, 1K9W|1|D
47NR_all_60167.3
Exact match
2OIY|1|A+2OIY|1|B (2OIY)
  • 5'-R(*CP*UP*UP*GP*CP*UP*GP*AP*AP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, P; model(s): 1
1.6 Å23(17) 2OIY|1|A+2OIY|1|B, 1Y99|1|A+1Y99|1|B, 1O3Z|1|B+1O3Z|1|A, 1Y73|1|B+1Y73|1|A, 1Y95|1|B+1Y95|1|A, 462D|1|B+462D|1|A, 1NLC|1|B+1NLC|1|A, 1WVD|1|B+1WVD|1|A, 1Y6S|1|B+1Y6S|1|A, 1Y6T|1|B+1Y6T|1|A, 1Y90|1|B+1Y90|1|A, 2OIJ|1|A+2OIJ|1|B, 2QEK|1|A+2QEK|1|B, 3FAR|1|A+3FAR|1|B, 2OJ0|1|A+2OJ0|1|B, 3C44|1|A+3C44|1|B, 3DVV|1|A+3DVV|1|B
48NR_all_09880.4
Exact match
3ULD|1|B (3ULD)
  • RNA (5'-R(*UP*CP*GP*AP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.6 Å6(17) 3ULD|1|B, 2G8K|1|B, 2R7Y|1|B, 5USE|1|B, 2G8F|1|B, 5USA|1|B, 2G8U|1|B, 5W7N|1|B, 5W7O|1|B, 2G8I|1|B, 5USG|1|B, 5US2|1|B, 5WJR|1|B, 2G8H|1|B, 3TWH|1|B, 2G8V|1|B, 2G8W|1|B
49NR_all_69813.2
Exact match
Escherichia coli
5IBB|1|3L (5IBB)
  • tRNAVal
  • X-RAY DIFFRACTION
  • Chain(s): 3L; model(s): 1
3.0 Å71(17) 5IBB|1|3L, 4V70|1|A1, 2K4C|1|A, 4V7A|1|A1, 4V79|1|A1, 4V73|1|A1, 4V76|1|A1, 4V78|1|A1, 4V77|1|A1, 4V6Y|1|A1, 4V71|1|A1, 4V72|1|A1, 4V75|1|A1, 4V74|1|A1, 4V6Z|1|A1, 5IBB|1|1K, 5IBB|1|3K
50NR_all_95556.5
Exact match
Thermus thermophilus
4V8U|1|CV (4V8U)
  • MRNA
  • X-RAY DIFFRACTION
  • Chain(s): CV; model(s): 1
3.7 Å76(16) 4V8U|1|CV, 4V8U|1|AV, 5J8B|1|w, 5J8B|1|y, 4V90|1|AV, 3BBV|1|z, 4V68|1|AW, 4WT8|1|D3, 5AA0|1|BE, 5AA0|1|BC, 3J9Z|1|S7, 4V5A|1|AV+4V5A|1|AX, 4V5A|1|CV+4V5A|1|CX, 4WT8|1|C3, 4WT8|1|C2, 5AA0|1|BD
51NR_all_35133.1
Exact match
2GCS|1|B (2GCS)
  • glmS ribozyme RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.1 Å122(15) 2GCS|1|B, 2HO7|1|B, 2H0X|1|B, 2Z75|1|B, 2HO6|1|B, 3B4B|1|B, 2GCV|1|B, 2H0W|1|B, 2H0S|1|B, 2Z74|1|B, 3B4A|1|B, 4MEG|1|B, 2H0Z|1|B, 3B4C|1|B, 4MEH|1|B
52NR_all_88517.2
Exact match
4JNG|1|L (4JNG)
  • RNA (42-MER)
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
2.1 Å42(15) 4JNG|1|L, 4J1G|1|E, 3PU4|1|R, 2WYY|1|R, 2GIC|1|R, 3HHZ|1|R, 5UKB|1|R, 2WYY|1|S, 5UK4|1|u, 5UK4|1|v, 5UK4|1|w, 5UK4|1|x, 3ZLA|1|I, 3ZLA|1|J, 4BHH|1|R
53NR_all_51962.2
Exact match
Escherichia coli
4YCP|1|B (4YCP)
  • tRNATrp
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å62(15) 4YCP|1|B, 4V5R|1|AY, 4V5L|1|AY, 4V5R|1|CY, 4V6P|1|AB, 4V6O|1|AB, 4V5Q|1|AY, 4V5S|1|AY, 4V5P|1|AY, 4V5Q|1|CY, 4V5S|1|CY, 4V5P|1|CY, 4V6R|1|AB, 4V6N|1|BB, 4V6Q|1|AB
54NR_all_96683.1
Exact match
Homo sapiens
5GMF|1|H (5GMF)
  • RNA (5'-R(P*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.5 Å4(15) 5GMF|1|H, 3S4G|1|C+3S4G|1|B, 5GMG|1|C, 5GMG|1|D, 3IE1|1|E, 1NB7|1|E, 5GMF|1|E, 3IE1|1|F, 1NB7|1|F, 5GMF|1|F, 5GMF|1|G, 3IE1|1|H, 2QQP|1|R, 4DR7|1|V, 3IE1|1|G
55NR_all_31074.1
Exact match
1J8G|1|D (1J8G)
  • 5'-R(*UP*GP*GP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
0.6 Å6(14) 1J8G|1|D, 4RKV|1|A, 4RNE|1|A, 4RNE|1|F, 1J8G|1|A, 4RJ1|1|A, 4RNE|1|B, 1J8G|1|C, 4XK0|1|C, 4RNE|1|C, 4RNE|1|D, 4RNE|1|E, 4RNE|1|G, 4RNE|1|H
56NR_all_29085.1
Exact match
2CV1|1|D (2CV1)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å75(14) 2CV1|1|D, 2CV2|1|C, 1N77|1|C, 2CV1|1|C, 2CV0|1|C, 2DXI|1|C, 1N78|1|C, 1G59|1|D, 2DXI|1|D, 1G59|1|B, 1N77|1|D, 1N78|1|D, 2CV2|1|D, 2CV0|1|D
57NR_all_42241.1
Exact match
2GDI|1|Y (2GDI)
  • TPP riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.1 Å78(14) 2GDI|1|Y, 4NYA|1|A, 2GDI|1|X, 2HOJ|1|A, 4NYB|1|A, 2HOK|1|A, 4NYD|1|A, 2HOL|1|A, 4NYC|1|A, 2HOM|1|A, 2HOO|1|A, 4NYA|1|B, 4NYG|1|A, 2HOP|1|A
58NR_all_27023.1
Exact match
Escherichia coli
2PXV|1|B (2PXV)
  • 4.5 S RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å49(14) 2PXV|1|B, 2PXT|1|B, 2PXQ|1|B, 2PXP|1|B, 2PXB|1|B, 2PXE|1|B, 2PXD|1|B, 2PXK|1|B, 1HQ1|1|B, 3LQX|1|B, 1DUL|1|B, 2PXU|1|B, 2PXF|1|B, 2PXL|1|B
59NR_all_07733.2
Exact match
Escherichia coli
5EL4|1|3L (5EL4)
  • tRNA-Lys
  • X-RAY DIFFRACTION
  • Chain(s): 3L; model(s): 1
3.2 Å73(14) 5EL4|1|3L, 5E7K|1|3L, 5IB8|1|3L, 5EL6|1|3L, 5IB7|1|3L, 5E7K|1|3K, 5EL6|1|3K, 5EL5|1|3K, 5IB7|1|3K, 5IB8|1|3K, 5EL5|1|3L, 5EL7|1|3K, 5EL4|1|3K, 5EL7|1|3L
60NR_all_46995.2
Exact match
Homo sapiens
5VYC|1|i4 (5VYC)
  • Human 18S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): i4; model(s): 1
6.0 Å1742(14) 5VYC|1|i4, 5A2Q|1|2, 5OA3|1|2, 5AJ0|1|B1, 4V6X|1|B2, 5VYC|1|i1, 4UG0|1|S2, 5VYC|1|i6, 5VYC|1|i3, 5VYC|1|i2, 5VYC|1|i5, 5A8L|1|B, 5LKS|1|S2, 5T2C|1|AA
61NR_all_73165.1
Exact match
1VBY|1|B (1VBY)
  • Hepatitis Delta virus ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å73(13) 1VBY|1|B, 1VC5|1|B, 4PRF|1|B, 2OIH|1|B, 1VC0|1|B, 1VBZ|1|B, 1VBX|1|B, 1SJ4|1|R, 1SJ3|1|R, 1SJF|1|B, 1DRZ|1|B, 1VC6|1|B, 2OJ3|1|B
62NR_all_39627.1
Exact match
1X8W|1|A (1X8W)
  • Tetrahymena ribozyme RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.8 Å242(13) 1X8W|1|A, 1GID|1|B, 1HR2|1|B, 1GID|1|A, 2R8S|1|R, 1HR2|1|A, 1L8V|1|A, 1L8V|1|B, 1X8W|1|B, 1X8W|1|D, 1X8W|1|C, 1GRZ|1|A, 1GRZ|1|B
63NR_all_52453.1
Exact match
3OL9|1|J+3OL9|1|N+3OL9|1|K+3OL9|1|O+3OL9|1|L+3OL9|1|P (3OL9)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): J, K, L, N, O, P; model(s): 1
2.3 Å19(13) 3OL9|1|J+3OL9|1|N+3OL9|1|K+3OL9|1|O+3OL9|1|L+3OL9|1|P, 3OL6|1|J+3OL6|1|N+3OL6|1|K+3OL6|1|O+3OL6|1|L+3OL6|1|P, 3OLB|1|J+3OLB|1|N+3OLB|1|K+3OLB|1|O+3OLB|1|L+3OLB|1|P, 3OLB|1|B+3OLB|1|F+3OLB|1|C+3OLB|1|G+3OLB|1|D+3OLB|1|H, 3OL7|1|B+3OL7|1|F+3OL7|1|C+3OL7|1|G+3OL7|1|D+3OL7|1|H, 3OL9|1|B+3OL9|1|F+3OL9|1|C+3OL9|1|G+3OL9|1|D+3OL9|1|H, 3OL6|1|B+3OL6|1|F+3OL6|1|C+3OL6|1|G+3OL6|1|D+3OL6|1|H, 3OLA|1|J+3OLA|1|N+3OLA|1|K+3OLA|1|O+3OLA|1|L+3OLA|1|P, 3OL8|1|B+3OL8|1|F+3OL8|1|C+3OL8|1|G+3OL8|1|D+3OL8|1|H, 3OLA|1|B+3OLA|1|D, 3OLA|1|F+3OLA|1|H, 3OL8|1|J+3OL8|1|N+3OL8|1|K+3OL8|1|O+3OL8|1|L+3OL8|1|P, 3OL7|1|J+3OL7|1|N+3OL7|1|K+3OL7|1|O+3OL7|1|L+3OL7|1|P
64NR_all_02615.1
Exact match
Escherichia coli
4AQ7|1|B (4AQ7)
  • E. COLI TRNALEU UAA ISOACCEPTOR
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å79(13) 4AQ7|1|B, 3ZGZ|1|E, 4AQ7|1|E, 4ARI|1|B, 4CQN|1|B, 3ZGZ|1|B, 3ZJV|1|B, 3ZJU|1|B, 4AS1|1|B, 4ARC|1|B, 4CQN|1|E, 3ZJT|1|B, 2NQP|1|F
65NR_all_31222.1
Exact match
Caldanaerobacter subterraneus
5FJC|1|A (5FJC)
  • SAM-I RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.7 Å96(13) 5FJC|1|A, 5FK4|1|A, 5FKE|1|A, 4B5R|1|A, 5FK2|1|A, 5FK3|1|A, 5FK1|1|A, 5FK5|1|A, 5FKF|1|A, 5FKD|1|A, 5FKG|1|A, 5FKH|1|A, 5FK6|1|A
66NR_all_19539.1
Exact match
synthetic construct
5HNJ|1|E+5HNJ|1|F (5HNJ)
  • RNA (5'-R(*GP*UP*AP*(OFC)P*GP*UP*AP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): E, F, K, L, O, P; model(s): 1
1.2 Å7(13) 5HNJ|1|E+5HNJ|1|F, 5HN2|1|B+5HN2|1|A, 5HNJ|1|A+5HNJ|1|B, 5HNQ|1|A+5HNQ|1|B, 5HNQ|1|C+5HNQ|1|D, 5HNJ|1|C+5HNJ|1|D, 5HN2|1|C+5HN2|1|D, 5HNQ|1|E+5HNQ|1|F, 5HN2|1|E+5HN2|1|F, 5HNQ|1|G+5HNQ|1|H, 5HNQ|1|I+5HNQ|1|J, 5HNQ|1|K+5HNQ|1|L, 5HNQ|1|M
67NR_all_29848.1
Exact match
3DIR|1|A (3DIR)
  • RNA (174-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å172(12) 3DIR|1|A, 3DJ0|1|A, 3DIL|1|A, 3DIQ|1|A, 3DJ2|1|A, 3DIX|1|A, 3DIS|1|A, 3DIM|1|A, 3DIG|1|X, 3DIY|1|A, 3DIZ|1|A, 3DIO|1|X
68NR_all_68467.1
Exact match
Oryctolagus cuniculus
3JAH|1|2 (3JAH)
  • tRNA(Val)
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
3.5 Å76(12) 3JAH|1|2, 3JAI|1|2, 3JAG|1|2, 5LZW|1|2, 5LZZ|1|2, 5LZT|1|2, 5LZX|1|2, 5LZS|1|2, 5LZV|1|2, 5LZU|1|2, 3JAJ|1|3, 3JAN|1|3
69NR_all_36481.1
Exact match
synthetic construct
4CSF|1|w (4CSF)
  • RNA (5'-R(*UP*GP*UP*GP*UP*UP*UP*CP*UP)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): w; model(s): 1
2.6 Å9(12) 4CSF|1|w, 4CSF|1|a, 4CSF|1|c, 4CSF|1|g, 4CSF|1|i, 4CSF|1|k, 4CSF|1|m, 4CSF|1|q, 4CSF|1|s, 4CSF|1|u, 4CSF|1|e, 4CSF|1|o
70NR_all_83891.8
Exact match
Staphylococcus aureus
4WFA|1|Y (4WFA)
  • 5S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
3.4 Å114(12) 4WFA|1|Y, 5ND8|1|B, 5ND9|1|B, 5HKV|1|Y, 4WCE|1|Y, 4WFB|1|Y, 5HL7|1|Y, 5LI0|1|B, 4WF9|1|Y, 5NRG|1|Y, 5TCU|1|C, 5T7V|1|C
71NR_all_72500.1
Exact match
Homo sapiens
4WZJ|1|YYYY (4WZJ)
  • U4 small nuclear RNA variant: Native seq[...]
  • X-RAY DIFFRACTION
  • Chain(s): YYYY; model(s): 1
3.6 Å68(12) 4WZJ|1|YYYY, 4WZJ|1|V, 4WZJ|1|VV, 4WZJ|1|VVV, 4WZJ|1|VVVV, 4WZJ|1|X, 4WZJ|1|XX, 4WZJ|1|XXX, 4WZJ|1|XXXX, 4WZJ|1|Y, 4WZJ|1|YY, 4WZJ|1|YYY
72NR_all_90633.8
Exact match
Staphylococcus aureus
5HL7|1|X (5HL7)
  • 23S ribosomal RNA
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.6 Å2705(12) 5HL7|1|X, 4WCE|1|X, 4WF9|1|X, 4WFB|1|X, 4WFA|1|X, 5NRG|1|X, 5HKV|1|X, 5ND8|1|A, 5LI0|1|A, 5ND9|1|A, 5T7V|1|B, 5TCU|1|B
73NR_all_36843.1
Exact match
Oryctolagus cuniculus
5LZY|1|2 (5LZY)
  • tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
4.0 Å75(12) 5LZY|1|2, 5LZU|1|3, 5LZS|1|3, 5LZW|1|3, 5LZV|1|3, 5LZZ|1|3, 5LZY|1|3, 5LZT|1|3, 5LZX|1|3, 3JAI|1|3, 3JAH|1|3, 3JAG|1|3
74NR_all_62528.1
Exact match
1GTF|1|W (1GTF)
  • (GAGUU)10GAG 53-NUCLEOTIDE RNA
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
1.8 Å44(11) 1GTF|1|W, 5EEY|1|W, 5EF2|1|W, 5EF3|1|W, 5EEZ|1|W, 5EEW|1|W, 5EEV|1|W, 5EF1|1|W, 5EEU|1|W, 5EF0|1|W, 5EEX|1|W
75NR_all_24819.1
Exact match
Saccharomyces cerevisiae
1IL2|1|C (1IL2)
  • ASPARTYL TRANSFER RNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.6 Å67(11) 1IL2|1|C, 1IL2|1|D, 3TRA|1|A, 1VTQ|1|A, 1ASZ|1|R, 1ASY|1|R, 1ASZ|1|S, 1ASY|1|S, 2TRA|1|A, 4V6I|1|CB, 3J16|1|L
76NR_all_82809.4
Exact match
3GX5|1|A (3GX5)
  • RNA (94-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.4 Å94(11) 3GX5|1|A, 2GIS|1|A, 2YGH|1|A, 3GX6|1|A, 3IQR|1|A, 3IQP|1|A, 3GX2|1|A, 3IQN|1|A, 2YDH|1|A, 3GX7|1|A, 3GX3|1|A
77NR_all_12260.3
Exact match
3UCZ|1|R (3UCZ)
  • RNA (92-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.8 Å91(11) 3UCZ|1|R, 3UD3|1|R, 3UCU|1|R, 3MXH|1|R, 3MUR|1|R, 3MUV|1|R, 4YB1|1|R, 3UD4|1|R, 3MUM|1|R, 3IRW|1|R, 3MUT|1|R
78NR_all_54592.1
Exact match
466D|1|C+466D|1|D (466D)
  • RNA (5'-R(*UP*AP*GP*CP*UP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C, D, K, L, O, P; model(s): 1
1.2 Å7(11) 466D|1|C+466D|1|D, 4U38|1|A+4U38|1|B, 466D|1|A+466D|1|B, 4U37|1|A+4U37|1|B, 464D|1|A+464D|1|B, 434D|1|A+434D|1|B, 4U38|1|C+4U38|1|D, 434D|1|C+434D|1|D, 464D|1|C+464D|1|D, 4U38|1|E+4U38|1|F, 4U38|1|G+4U38|1|H
79NR_all_40540.1
Exact match
4V8C|1|CB (4V8C)
  • TRNA-LEU
  • X-RAY DIFFRACTION
  • Chain(s): CB; model(s): 1
3.3 Å87(11) 4V8C|1|CB, 5KCR|1|1x, 4V8B|1|AB, 4V8C|1|DB, 4WSM|1|2K, 4WSM|1|2L, 4V8B|1|CB, 4V87|1|BB, 4WSM|1|1L, 4WSM|1|1K, 4V87|1|CB
80NR_all_78233.1
Exact match
Escherichia coli
4V9L|1|AW (4V9L)
  • transfer RNA
  • X-RAY DIFFRACTION
  • Chain(s): AW; model(s): 1
3.5 Å77(11) 4V9L|1|AW, 4V9M|1|AW, 4V9M|1|CW, 4V9L|1|CW, 4V9J|1|AW, 4V9K|1|AW, 4V7B|1|AW, 4V9K|1|CW, 4V9J|1|CW, 4W29|1|AW, 4W29|1|CW
81NR_all_25585.2
Exact match
synthetic construct
4Z4D|1|B+4Z4D|1|D (4Z4D)
  • RNA (5'-R(P*UP*UP*CP*AP*CP*AP*UP*UP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, D, K, L, O, P; model(s): 1
1.6 Å20(11) 4Z4D|1|B+4Z4D|1|D, 4W5O|1|B+4W5O|1|D, 4Z4H|1|B+4Z4H|1|D, 4Z4G|1|B+4Z4G|1|D, 4Z4I|1|B+4Z4I|1|D, 4Z4C|1|B+4Z4C|1|D, 4Z4E|1|B+4Z4E|1|D, 4W5Q|1|B+4W5Q|1|D, 4Z4F|1|B+4Z4F|1|D, 4W5T|1|B+4W5T|1|D, 4W5R|1|B+4W5R|1|D
82NR_all_30457.5
Exact match
Saccharomyces cerevisiae
5NRL|1|5 (5NRL)
  • Saccharomyces cerevisiae strain HB_C_OMA[...]
  • ELECTRON MICROSCOPY
  • Chain(s): 5; model(s): 1
7.2 Å170(11) 5NRL|1|5, 5LJ3|1|U, 5GAN|1|U, 5LJ5|1|U, 5MPS|1|5, 5MQ0|1|5, 5GAM|1|U, 5GMK|1|D, 5LQW|1|5, 5WSG|1|D, 3JCM|1|F
83NR_all_65028.2
Exact match
1NYI|1|B+1NYI|1|A (1NYI)
  • 5'-R(*GP*CP*CP*GP*AP*AP*AP*CP*UP*CP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, K, L, O, P; model(s): 1
2.9 Å24(10) 1NYI|1|B+1NYI|1|A, 1Q29|1|B+1Q29|1|A, 1MME|1|B+1MME|1|A, 299D|1|B+299D|1|A, 301D|1|B+301D|1|A, 359D|1|B+359D|1|A, 300D|1|B+300D|1|A, 1MME|1|D+1MME|1|C, 488D|1|D+488D|1|B+488D|1|A+488D|1|C, 379D|1|B+379D|1|A
84NR_all_16130.1
Exact match
1UTD|1|Z (1UTD)
  • 5'-R(*GP*UP*UP*UP*GP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
2.1 Å4(10) 1UTD|1|Z, 1UTD|1|0, 1UTD|1|2, 1UTD|1|3, 1UTD|1|4, 1UTD|1|5, 1UTD|1|6, 1UTD|1|7, 1UTD|1|8, 1UTD|1|9
85NR_all_09332.1
Exact match
2JLV|1|D (2JLV)
  • 5'-R(*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.9 Å7(10) 2JLV|1|D, 2JLX|1|C, 2JLX|1|D, 2JLU|1|C, 2JLV|1|C, 2JLZ|1|C, 2JLY|1|C, 2JLU|1|D, 2JLY|1|D, 2JLZ|1|D
86NR_all_33592.3
Exact match
2TMV|1|R (2TMV)
  • RNA (5'-R(P*GP*AP*A)-3')
  • FIBER DIFFRACTION
  • Chain(s): R; model(s): 1
2.9 Å3(10) 2TMV|1|R, 1RMV|1|B, 1CGM|1|I, 5A79|1|R, 1VTM|1|R, 4UDV|1|R, 2OM3|1|R, 3PDM|1|R, 5A7A|1|R, 2XEA|1|R
87NR_all_02086.1
Exact match
3B5S|1|B+3B5S|1|C+3B5S|1|A (3B5S)
  • 29-mer Loop A and Loop B Ribozyme strand
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, L, O, P; model(s): 1
2.3 Å29(10) 3B5S|1|B+3B5S|1|C+3B5S|1|A, 3B5F|1|B+3B5F|1|C+3B5F|1|A, 3BBM|1|B+3BBM|1|C+3BBM|1|A, 3B91|1|B+3B91|1|C+3B91|1|A, 4G6S|1|B+4G6S|1|C+4G6S|1|A, 3BBI|1|B+3BBI|1|C+3BBI|1|A, 3B58|1|B+3B58|1|C+3B58|1|A, 3B5A|1|B+3B5A|1|C+3B5A|1|A, 3BBK|1|B+3BBK|1|C+3BBK|1|A, 4G6P|1|B+4G6P|1|C+4G6P|1|A
88NR_all_22323.1
Exact match
Oryctolagus cuniculus
3J0O|1|V (3J0O)
  • tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): V; model(s): 1
9.0 Å75(10) 3J0O|1|V, 3J0L|1|V, 4UJC|1|AA, 4UJD|1|BA, 4UJE|1|AV, 3J0L|1|W, 3J0O|1|W, 3J0O|1|Y, 3J0L|1|Y, 3J0P|1|Y
89NR_all_51862.1
Exact match
Oceanobacillus iheyensis
4LCK|1|E (4LCK)
  • tRNA-Gly
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.2 Å75(10) 4LCK|1|E, 4TZV|1|B, 4TZZ|1|H, 4TZZ|1|K, 4TZZ|1|B, 4LCK|1|B, 4TZZ|1|E, 4TZP|1|E, 4TZW|1|B, 4TZP|1|B
90NR_all_25521.1
Exact match
synthetic construct
4PEI|1|Z (4PEI)
  • RNA (5'-R(*UP*AP*AP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
2.0 Å3(10) 4PEI|1|Z, 5K77|1|V, 5K77|1|W, 5K77|1|X, 5K77|1|Y, 5K77|1|Z, 4PEI|1|V, 4PEI|1|W, 4PEI|1|X, 4PEI|1|Y
91NR_all_26576.1
Exact match
Oceanobacillus iheyensis
4TZZ|1|I (4TZZ)
  • T-box Stem I RNA
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
3.6 Å102(10) 4TZZ|1|I, 4TZZ|1|C, 4TZV|1|C, 4TZW|1|C, 4TZZ|1|L, 4LCK|1|C, 4TZZ|1|F, 4TZP|1|C, 4LCK|1|F, 4TZP|1|F
92NR_all_78372.2
Exact match
1B2M|1|E (1B2M)
  • 5'-R(*GP*(U34))-3'
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.0 Å1(9) 1B2M|1|E, 5F6C|1|C, 5K77|1|v, 5K77|1|w, 5K77|1|x, 5K77|1|y, 5K77|1|z, 1B2M|1|C, 1B2M|1|D
93NR_all_88496.1
Exact match
1ET4|1|E (1ET4)
  • RNA APTAMER, 35-MER
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.3 Å35(9) 1ET4|1|E, 1ET4|1|A, 1ET4|1|B, 1ET4|1|D, 1DDY|1|E, 1DDY|1|G, 1DDY|1|A, 1ET4|1|C, 1DDY|1|C
94NR_all_27949.4
Exact match
1I5L|1|Y (1I5L)
  • 5'-R(*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.8 Å3(9) 1I5L|1|Y, 1MVR|1|1, 5MQ0|1|3, 4V68|1|A0, 5IP2|1|D, 5IP2|1|F, 1I5L|1|U, 4DR7|1|b, 4DR6|1|b
95NR_all_60049.1
Exact match
1VQO|1|4 (1VQO)
  • 5'-R(*CP*CP*(PPU))-3'
  • X-RAY DIFFRACTION
  • Chain(s): 4; model(s): 1
2.2 Å2(9) 1VQO|1|4, 1QVG|1|3, 3CMA|1|5, 5LZD|1|w, 5LZC|1|w, 5LZB|1|w, 5LZE|1|w, 3CD6|1|4, 3CME|1|5
96NR_all_34359.1
Exact match
synthetic construct
2NVQ|1|R (2NVQ)
  • 5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*GP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.9 Å10(9) 2NVQ|1|R, 1R9T|1|R, 2YU9|1|R, 2NVZ|1|R, 2E2H|1|R, 1R9S|1|R, 2NVX|1|R, 2E2I|1|R, 1SFO|1|R
97NR_all_38950.2
Exact match
2XD0|1|V (2XD0)
  • TOXI
  • X-RAY DIFFRACTION
  • Chain(s): V; model(s): 1
3.0 Å35(9) 2XD0|1|V, 2XDD|1|F, 2XDB|1|G, 2XDD|1|H, 2XD0|1|H, 2XDD|1|G, 2XD0|1|G, 2XD0|1|I, 2XD0|1|U
98NR_all_65533.1
Exact match
3OVA|1|C (3OVA)
  • RNA (34-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.0 Å34(9) 3OVA|1|C, 3OV7|1|C, 3OVS|1|C, 3OVB|1|C, 3OVS|1|D, 3OUY|1|C, 3OVB|1|D, 3OV7|1|D, 3OUY|1|D
99NR_all_17782.1
Exact match
3R1C|1|a+3R1C|1|b (3R1C)
  • RNA (5'-R(*GP*CP*GP*GP*CP*GP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, L, O, P, a, b; model(s): 1
2.1 Å8(9) 3R1C|1|a+3R1C|1|b, 3R1C|1|G+3R1C|1|H, 3R1C|1|A+3R1C|1|B, 3R1C|1|M+3R1C|1|N, 3R1C|1|O+3R1C|1|P, 3R1C|1|Q+3R1C|1|R, 3R1C|1|S+3R1C|1|Y, 3R1C|1|T+3R1C|1|U, 3R1C|1|V+3R1C|1|Z
100NR_all_26836.2
Exact match
Haloarcula marismortui
4BW0|1|A (4BW0)
  • HMKT-7
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å26(9) 4BW0|1|A, 5FJ1|1|A, 5FJ1|1|B, 5FJ1|1|C, 5FJ1|1|D, 5FJ1|1|E, 5FJ1|1|F, 5FJ1|1|G, 5FJ1|1|H
101NR_all_95963.2
Exact match
synthetic construct
5IPL|1|3 (5IPL)
  • nascent RNA 4-mer
  • X-RAY DIFFRACTION
  • Chain(s): 3; model(s): 1
3.6 Å3(9) 5IPL|1|3, 5IPM|1|3, 5IPN|1|3, 4YLO|1|3, 4YLN|1|3, 4YLN|1|6, 4YLO|1|6, 4YLO|1|9, 4YLN|1|9
102NR_all_71520.1
Exact match
Escherichia virus T7
1H38|1|O (1H38)
  • 5'-R(*AP*AP*CP*UP*GP*CP*GP*GP*CP*GP *AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): O; model(s): 1
2.9 Å8(8) 1H38|1|O, 1S0V|1|F, 1H38|1|F, 1S0V|1|I, 1H38|1|I, 1S0V|1|L, 1H38|1|L, 1S0V|1|O
103NR_all_14947.1
Exact match
1KOG|1|P (1KOG)
  • Threonyl-tRNA synthetase mRNA
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.5 Å37(8) 1KOG|1|P, 1KOG|1|I, 1KOG|1|J, 1KOG|1|L, 1KOG|1|M, 1KOG|1|N, 1KOG|1|O, 1KOG|1|K
104NR_all_75326.1
Exact match
1M5K|1|E (1M5K)
  • RNA HAIRPIN RIBOZYME
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.4 Å91(8) 1M5K|1|E, 1M5K|1|B, 1M5P|1|B, 1M5O|1|B, 1M5V|1|E, 1M5O|1|E, 1M5V|1|B, 1M5P|1|E
105NR_all_57955.2
Exact match
1Q93|1|B (1Q93)
  • Sarcin/Ricin 28S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å27(8) 1Q93|1|B, 1Q93|1|A, 1Q96|1|A, 1C04|1|F, 1Q96|1|B, 1Q93|1|C, 1Q96|1|C, 430D|1|A
106NR_all_84537.1
Exact match
2AWE|1|H (2AWE)
  • 5'-R(*UP*(BGM)P*GP*UP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.1 Å5(8) 2AWE|1|H, 2AWE|1|A, 2AWE|1|B, 2AWE|1|C, 2AWE|1|D, 2AWE|1|E, 2AWE|1|F, 2AWE|1|G
107NR_all_52425.1
Exact match
2EZ6|1|D (2EZ6)
  • 28-MER
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.1 Å28(8) 2EZ6|1|D, 2NUF|1|C, 2EZ6|1|C, 2NUF|1|D, 4M30|1|C, 4M2Z|1|C, 4M30|1|D, 4M2Z|1|D
108NR_all_58299.1
Exact match
2GRB|1|H (2GRB)
  • 5'-R(*(U33)P*GP*IP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
1.4 Å4(8) 2GRB|1|H, 2GRB|1|A, 2GRB|1|B, 2GRB|1|C, 2GRB|1|D, 2GRB|1|E, 2GRB|1|F, 2GRB|1|G
109NR_all_27756.1
Exact match
Arabidopsis thaliana
3D2V|1|A (3D2V)
  • TPP-specific riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å77(8) 3D2V|1|A, 3D2G|1|A, 3D2X|1|A, 3D2V|1|B, 3D2G|1|B, 3D2X|1|B, 2CKY|1|A, 2CKY|1|B
110NR_all_45040.1
Exact match
3EPK|1|E (3EPK)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.2 Å69(8) 3EPK|1|E, 3EPJ|1|E, 3EPH|1|E, 3EPL|1|F, 3EPL|1|E, 3EPJ|1|F, 3EPH|1|F, 3EPK|1|F
111NR_all_26629.1
Exact match
3HK2|1|F (3HK2)
  • 5'-R(*UP*AP*UP*AP*CP*AP*AP*CP*CP*UP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.8 Å15(8) 3HK2|1|F, 3HK2|1|D, 3HM9|1|Y, 3HVR|1|D, 3F73|1|H, 3F73|1|Y, 3HVR|1|N, 3HXM|1|Y
112NR_all_72076.2
Exact match
Kluyveromyces lactis
3JAM|1|2 (3JAM)
  • 18S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
3.5 Å1780(8) 3JAM|1|2, 5IT7|1|2, 5IT9|1|2, 3JAQ|1|2, 3JAP|1|2, 3J80|1|2, 3J81|1|2, 4V92|1|A2
113NR_all_21705.1
Exact match
3SKI|1|A (3SKI)
  • RNA (68-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å66(8) 3SKI|1|A, 3SKZ|1|A, 3SLQ|1|A, 3SLM|1|A, 3SKZ|1|B, 3SLQ|1|B, 3SLM|1|B, 3SKI|1|B
114NR_all_47330.1
Exact match
3SKL|1|A (3SKL)
  • RNA (66-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å64(8) 3SKL|1|A, 3SKT|1|B, 3SKR|1|B, 3SKT|1|A, 3SKR|1|A, 3SKL|1|B, 3SKW|1|A, 3SKW|1|B
115NR_all_61644.1
Exact match
3T1Y|1|X+3T1Y|1|W (3T1Y)
  • tRNA ASL human Lys3
  • X-RAY DIFFRACTION
  • Chain(s): A, L, O, P, W, X; model(s): 1
2.8 Å8(8) 3T1Y|1|X+3T1Y|1|W, 1XMO|1|X+1XMO|1|W, 1XMQ|1|X+1XMQ|1|W, 3T1H|1|X+3T1H|1|W, 4X66|1|b+4X66|1|a, 4X64|1|b+4X64|1|a, 4X65|1|b+4X65|1|a, 4X62|1|b+4X62|1|a
116NR_all_91231.1
Exact match
3VYX|1|B+3VYX|1|C (3VYX)
  • RNA (5'-R(P*GP*CP*GP*CP*GP*CP*GP*CP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, L, O, P; model(s): 1
2.3 Å10(8) 3VYX|1|B+3VYX|1|C, 3ZD7|1|C+3ZD7|1|D, 4BPB|1|C+4BPB|1|D, 3ZD6|1|C+3ZD6|1|D, 2YKG|1|C+2YKG|1|D, 3VYY|1|C+3VYY|1|D, 3VYY|1|E+3VYY|1|F, 3VYY|1|G
117NR_all_89612.3
Exact match
synthetic construct
4AFY|1|D (4AFY)
  • 5'-R(*GP*GP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.0 Å2(8) 4AFY|1|D, 4AFY|1|C, 3U2E|1|C, 5UEF|1|C, 3U2E|1|D, 5UEF|1|D, 4X4U|1|H, 4LQ3|1|R
118NR_all_41594.1
Exact match
4ILM|1|R (4ILM)
  • RNA (5'-R(*GP*CP*UP*AP*AP*UP*CP*UP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.1 Å16(8) 4ILM|1|R, 4ILM|1|C, 4ILM|1|G, 4ILM|1|K, 4ILM|1|M, 4ILM|1|E, 4ILM|1|I, 4ILM|1|O
119NR_all_81203.2
Exact match
4K4Z|1|N+4K4Z|1|O+4K4Z|1|P (4K4Z)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): L, N, O, P; model(s): 1
2.2 Å17(8) 4K4Z|1|N+4K4Z|1|O+4K4Z|1|P, 4K4Z|1|F+4K4Z|1|G+4K4Z|1|H, 4K4Z|1|J+4K4Z|1|K+4K4Z|1|L, 4K4Z|1|B+4K4Z|1|C+4K4Z|1|D, 4K4X|1|B+4K4X|1|C+4K4X|1|D, 4K4X|1|F+4K4X|1|G+4K4X|1|H, 4K4X|1|J+4K4X|1|K+4K4X|1|L, 4K4X|1|N+4K4X|1|O+4K4X|1|P
120NR_all_51487.1
Exact match
4L8H|1|R (4L8H)
  • RNA operator hairpin
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.4 Å20(8) 4L8H|1|R, 2BS1|1|S, 1ZSE|1|R, 2B2D|1|R, 2BS0|1|S, 2BS0|1|R, 2BS1|1|R, 2B2D|1|S
121NR_all_87052.1
Exact match
4MSR|1|A+4MSR|1|B (4MSR)
  • RNA 10mer duplex with six 2'-5'-linkages
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
1.2 Å12(8) 4MSR|1|A+4MSR|1|B, 5TDJ|1|A, 4MS9|1|A, 4MSB|1|A+4MSB|1|B, 5TDK|1|A+5TDK|1|B, 5TDJ|1|B, 4MSB|1|C+4MSB|1|D, 4MSB|1|E+4MSB|1|F
122NR_all_48149.1
Exact match
synthetic construct
4RMO|1|P (4RMO)
  • RNA (45-MER)
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.2 Å44(8) 4RMO|1|P, 4RMO|1|B, 4RMO|1|D, 4RMO|1|F, 4RMO|1|H, 4RMO|1|J, 4RMO|1|L, 4RMO|1|N
123NR_all_68446.1
Exact match
synthetic construct
4U6K|1|C (4U6K)
  • RNA (5'-R(*GP*AP*AP*GP*AP*AP*GP*AP*G)-3'[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.5 Å9(8) 4U6K|1|C, 4U6M|1|A, 4U6L|1|A, 4U6K|1|A, 2DQP|1|B, 479D|1|B, 2DQO|1|B, 2DQQ|1|B
124NR_all_04935.1
Exact match
Thermotoga maritima
4YVI|1|C (4YVI)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.0 Å71(8) 4YVI|1|C, 4YVJ|1|C, 4YVK|1|C, 3AL0|1|E, 3AKZ|1|G, 3AKZ|1|H, 3AKZ|1|F, 3AKZ|1|E
125NR_all_10054.2
Exact match
synthetic construct
5EAQ|1|A (5EAQ)
  • RNA (48-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.2 Å48(8) 5EAQ|1|A, 5DQK|1|A, 5EAO|1|A, 5DH6|1|A, 5DI2|1|A, 5DH8|1|A, 5DH7|1|A, 5DI4|1|A
126NR_all_92081.5
Exact match
synthetic construct
5FW3|1|A (5FW3)
  • SGRNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å81(8) 5FW3|1|A, 5VW1|1|C, 4UN5|1|A, 5FQ5|1|A, 5FW1|1|A, 4UN3|1|A, 5FW2|1|A, 4UN4|1|A
127NR_all_49785.2
Exact match
Homo sapiens
5M73|1|A (5M73)
  • Human gene for small cytoplasmic 7SL RNA[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.4 Å144(8) 5M73|1|A, 1MFQ|1|A, 1RY1|1|A, 3KTV|1|C, 5M73|1|E, 4P3E|1|A, 1L9A|1|B, 3KTV|1|A
128NR_all_88047.3
Exact match
unidentified
5UDI|1|B (5UDI)
  • RNA (5'-D(*(GTA))-R(P*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.6 Å3(8) 5UDI|1|B, 5W5H|1|B, 5W5I|1|B, 5UDK|1|B, 5UDL|1|B, 5UDJ|1|B, 5W5H|1|D, 5W5I|1|D
129NR_all_90795.4
Exact match
synthetic construct
5VI5|1|Q (5VI5)
  • RNA (5'-R(*UP*CP*GP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
3.2 Å4(8) 5VI5|1|Q, 5UH8|1|I, 5I2D|1|K, 4XLR|1|Q, 4XLN|1|Q, 4XLR|1|T, 4XLN|1|T, 5I2D|1|V
130NR_all_27657.1
Exact match
Pseudomonas aeruginosa
5VJ9|1|D (5VJ9)
  • RNA (5'-R(*GP*CP*GP*GP*GP*GP*AP*CP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.6 Å16(8) 5VJ9|1|D, 5VJ9|1|A, 5VJ9|1|B, 5VJ9|1|C, 5VJB|1|A, 5VJB|1|B, 5VJB|1|C, 5VJB|1|D
131NR_all_25852.1
Exact match
1M8V|1|U (1M8V)
  • 5'-R(P*UP*UP*UP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): U; model(s): 1
2.6 Å6(7) 1M8V|1|U, 1M8V|1|O, 1M8V|1|P, 1M8V|1|Q, 1M8V|1|R, 1M8V|1|S, 1M8V|1|T
132NR_all_74849.1
Exact match
1MMS|1|D (1MMS)
  • 23S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.6 Å58(7) 1MMS|1|D, 1OLN|1|C, 1MMS|1|C, 2JQ7|3|B, 1R2X|1|C, 1R2W|1|C, 1EG0|1|L
133NR_all_64047.1
Exact match
1PVO|1|L (1PVO)
  • 5'-R(P*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
3.0 Å2(7) 1PVO|1|L, 1PVO|1|G, 1PVO|1|H, 1PVO|1|J, 2HT1|1|J, 1PVO|1|K, 2HT1|1|K
134NR_all_95614.1
Exact match
1QA6|1|D (1QA6)
  • 58 NUCLEOTIDE RIBOSOMAL RNA DOMAIN
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.8 Å58(7) 1QA6|1|D, 1QA6|1|C, 1C04|1|E, 1HC8|1|C, 1Y39|1|C, 1HC8|1|D, 1Y39|1|D
135NR_all_36362.1
Exact match
Escherichia coli
2CD6|1|A (2CD6)
  • 5'-R(*GP*GP*AP*AP*GP*UP*UP*CP*CP*GP *UP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(7) 2CD6|1|A, 1F79|1|A, 1XSU|1|A, 1XSH|1|A, 2CD3|1|A, 1F6Z|1|A, 1F7I|2|A
136NR_all_04852.2
Exact match
Moorella thermoacetica
2UWM|1|D (2UWM)
  • 5'-R(*GP*GP*CP*GP*UP*UP*GP*CP*CP*GP *GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.3 Å23(7) 2UWM|1|D, 2PLY|1|C, 2PLY|1|E, 1WSU|1|E, 1WSU|1|F, 2UWM|1|C, 1WSU|1|G
137NR_all_90840.2
Exact match
3A3A|1|A (3A3A)
  • selenocysteine tRNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å86(7) 3A3A|1|A, 4RQF|1|C, 4RQE|1|B, 4RQE|1|D, 4ZDO|1|E, 4ZDP|1|E, 3HL2|1|E
138NR_all_08831.2
Exact match
Methanocaldococcus jannaschii
3NDB|1|M (3NDB)
  • SRP RNA
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
3.0 Å136(7) 3NDB|1|M, 4XCO|1|E, 4XCO|1|M, 2V3C|1|N, 1LNG|1|B, 2V3C|1|M, 1Z43|1|A
139NR_all_28980.1
Exact match
3P4C|1|B (3P4C)
  • 5'-R(*(CFZ)P*GP*(AF2)P*AP*(UFT)P*UP*(CFZ[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.2 Å4(7) 3P4C|1|B, 3P4B|1|A, 3P4B|1|B, 3P4B|1|C, 3P4B|1|D, 3P4B|1|E, 3P4B|1|F
140NR_all_35293.2
Exact match
3P6Y|1|W (3P6Y)
  • 5'-R(*UP*GP*UP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
2.9 Å1(7) 3P6Y|1|W, 3P6Y|1|R, 3P6Y|1|S, 3P6Y|1|T, 3P6Y|1|U, 3P6Y|1|V, 3P6Y|1|Q
141NR_all_64404.1
Exact match
Thermus thermophilus
3TUP|1|T (3TUP)
  • Thermus thermophilus tRNAPhe
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
3.1 Å74(7) 3TUP|1|T, 1EIY|1|C, 4V4X|1|AD, 2IY5|1|T, 4V4Z|1|AD, 3B0V|1|A, 3B0V|1|B
142NR_all_04288.1
Exact match
4G7O|1|S (4G7O)
  • 5'-R(*GP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): S; model(s): 1
3.0 Å2(7) 4G7O|1|S, 4G7O|1|I, 5X22|1|I, 5UH6|1|I, 5UH9|1|I, 5X21|1|I, 5X22|1|S
143NR_all_57733.1
Exact match
4H8K|1|C (4H8K)
  • RNA (5'-R(*CP*GP*AP*CP*AP*CP*CP*UP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.3 Å14(7) 4H8K|1|C, 2QKK|1|C, 2QKK|1|G, 2QKK|1|K, 2QKK|1|O, 2QKK|1|T, 2QKK|1|X
144NR_all_78797.1
Exact match
4LVZ|1|A (4LVZ)
  • THF riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.8 Å89(7) 4LVZ|1|A, 3SD3|1|A, 4LVX|1|A, 4LVW|1|A, 4LVY|1|A, 4LVV|1|A, 4LW0|1|A
145NR_all_10487.1
Exact match
4NFQ|1|B+4NFQ|1|C (4NFQ)
  • GCAG(7AT)CUUAAGUCUGC
  • X-RAY DIFFRACTION
  • Chain(s): B, C, L, O, P; model(s): 1
1.7 Å15(7) 4NFQ|1|B+4NFQ|1|C, 4NFO|1|A, 4NFO|1|B+4NFO|1|C, 4NFQ|1|A, 4NFP|1|A, 4NFP|1|B+4NFP|1|C, 1YZD|1|C
146NR_all_19502.2
Exact match
synthetic construct
4RGE|1|B (4RGE)
  • env22 twister ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å55(7) 4RGE|1|B, 4RGE|1|C, 4RGE|1|A, 5DUN|1|A, 4RGF|1|A, 4RGF|1|B, 4RGF|1|C
147NR_all_99969.1
Exact match
Taura syndrome virus
5JUP|1|EC (5JUP)
  • IRES
  • ELECTRON MICROSCOPY
  • Chain(s): EC; model(s): 1
3.5 Å198(7) 5JUP|1|EC, 5JUT|1|EC, 5JUO|1|EC, 5JUU|1|EC, 5JUS|1|EC, 3J6X|1|IR, 3J6Y|1|IR
148NR_all_20305.4
Exact match
Spinacia oleracea
5MMI|1|A (5MMI)
  • 23S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.2 Å2798(7) 5MMI|1|A, 5MMM|1|A, 5X8P|1|A, 5X8T|1|A, 5MLC|1|A, 5H1S|1|A, 4V61|1|BA
149NR_all_50314.4
Exact match
Spinacia oleracea
5MMI|1|B (5MMI)
  • 5S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
3.2 Å121(7) 5MMI|1|B, 5MMM|1|B, 5X8T|1|B, 5X8P|1|B, 5MLC|1|B, 5H1S|1|B, 4V61|1|BB
150NR_all_05530.4
Exact match
Spinacia oleracea
5MMM|1|W (5MMM)
  • 4.5S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): W; model(s): 1
3.4 Å106(7) 5MMM|1|W, 5MLC|1|C, 5MMI|1|W, 5X8T|1|W, 5X8P|1|W, 5H1S|1|C, 4V61|1|BC
151NR_all_78670.1
Exact match
1CVJ|1|T (1CVJ)
  • 5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.6 Å7(6) 1CVJ|1|T, 1CVJ|1|N, 1CVJ|1|O, 1CVJ|1|S, 1CVJ|1|P, 1CVJ|1|R
152NR_all_31741.1
Exact match
1IBL|1|X (1IBL)
  • P-SITE MESSENGER RNA FRAGMENT
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.1 Å6(6) 1IBL|1|X, 1IBM|1|X, 1HR0|1|X, 1HNZ|1|X, 1HNW|1|X, 1IBK|1|X
153NR_all_30944.1
Exact match
1U6B|1|B (1U6B)
  • 197-MER
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.1 Å195(6) 1U6B|1|B, 3BO2|1|B, 3IIN|1|B, 3BO3|1|B, 3BO4|1|B, 1ZZN|1|B
154NR_all_90215.1
Exact match
1YKV|1|D (1YKV)
  • Diels-Alder ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.3 Å38(6) 1YKV|1|D, 1YLS|1|B, 1YLS|1|D, 1YKQ|1|B, 1YKQ|1|D, 1YKV|1|B
155NR_all_51779.3
Exact match
1Z7F|1|A (1Z7F)
  • 5'-R(*GP*CP*AP*GP*AP*CP*UP*UP*AP*AP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.1 Å16(6) 1Z7F|1|A, 405D|1|A+405D|1|B, 1Z79|1|A+1Z79|1|B, 1YY0|1|A+1YY0|1|B, 1Z79|1|C, 1YY0|1|C
156NR_all_23989.1
Exact match
Thermus thermophilus
2BTE|1|E (2BTE)
  • TRNALEU TRANSCRIPT WITH ANTICODON CAG
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.9 Å78(6) 2BTE|1|E, 2V0G|1|F, 2BTE|1|B, 2BYT|1|B, 2BYT|1|E, 2V0G|1|B
157NR_all_92683.1
Exact match
2G3S|1|I+2G3S|1|J (2G3S)
  • 5'-R(*GP*GP*CP*GP*UP*GP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): I, J, L, O, P; model(s): 1
1.5 Å8(6) 2G3S|1|I+2G3S|1|J, 1EKD|1|A+1EKD|1|B, 2G3S|1|A+2G3S|1|B, 2G3S|1|C+2G3S|1|D, 2G3S|1|E+2G3S|1|F, 2G3S|1|G+2G3S|1|H
158NR_all_50005.1
Exact match
2I7Z|1|B (2I7Z)
  • 43-MER
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
43(6) 2I7Z|1|B, 2I7E|1|A, 2I7Z|1|A, 2ADT|1|A, 2I7E|1|B, 2ADT|1|B
159NR_all_18337.2
Exact match
2MEQ|1|A (2MEQ)
  • RNA_(5'-R(P*GP*GP*CP*CP*GP*UP*AP*AP*CP*U[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
19(6) 2MEQ|1|A, 2MER|1|A, 3J0E|1|A, 3J0D|1|B, 1QZC|1|B, 1MVR|1|C
160NR_all_35629.1
Exact match
2O5I|1|Y (2O5I)
  • 5'-R(P*GP*AP*GP*UP*CP*UP*GP*CP*GP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.5 Å16(6) 2O5I|1|Y, 2O5J|1|H, 2O5I|1|H, 2PPB|1|H, 2PPB|1|Y, 2O5J|1|Y
161NR_all_02858.1
Exact match
2QUX|1|R (2QUX)
  • RNA (25-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.4 Å25(6) 2QUX|1|R, 2QUX|1|C, 2QUX|1|F, 2QUX|1|I, 2QUX|1|L, 2QUX|1|O
162NR_all_92749.1
Exact match
2RU7|3|B (2RU7)
  • RNA_(5'-R(*GP*GP*AP*GP*GP*AP*GP*GP*AP*GP[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 3
12(6) 2RU7|3|B, 2RU7|3|A, 2RQJ|6|A, 2RQJ|6|B, 2RSK|8|A, 2RSK|8|B
163NR_all_63789.1
Exact match
Methanopyrus kandleri
3ADD|1|C (3ADD)
  • selenocysteine tRNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.4 Å88(6) 3ADD|1|C, 3ADD|1|D, 3ADC|1|C, 3ADB|1|C, 3ADB|1|D, 3ADC|1|D
164NR_all_38099.1
Exact match
3BNS|1|C+3BNS|1|D (3BNS)
  • A site of human mitochondrial ribosome, [...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, L, O, P; model(s): 1
1.9 Å22(6) 3BNS|1|C+3BNS|1|D, 3BNS|1|A+3BNS|1|B, 3BNQ|1|A+3BNQ|1|B, 3BNR|1|A+3BNR|1|B, 3BNR|1|C+3BNR|1|D, 3BNQ|1|C+3BNQ|1|D
165NR_all_11791.1
Exact match
3BSU|1|I (3BSU)
  • RNA (5'-R(*GP*AP*CP*AP*CP*CP*UP*GP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
2.1 Å12(6) 3BSU|1|I, 4WKJ|1|A, 4WKJ|1|C, 4WKJ|1|D, 3BSU|1|D, 4WKJ|1|G
166NR_all_47203.1
Exact match
3F2Q|1|X (3F2Q)
  • FMN riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.0 Å107(6) 3F2Q|1|X, 3F2Y|1|X, 3F2W|1|X, 3F30|1|X, 3F2X|1|X, 3F2T|1|X
167NR_all_22826.1
Exact match
3GPQ|1|F (3GPQ)
  • RNA (5'-R(*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.0 Å2(6) 3GPQ|1|F, 4OAU|1|A, 2A1R|1|C, 2A1R|1|D, 1LAJ|1|R, 3GPQ|1|E
168NR_all_66484.2
Exact match
3HHN|1|E (3HHN)
  • Class I ligase ribozyme, self-ligation p[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.0 Å136(6) 3HHN|1|E, 3HHN|1|C, 3R1L|1|F, 3R1H|1|F, 3R1H|1|C, 3R1L|1|C
169NR_all_39651.1
Exact match
3LWR|1|D (3LWR)
  • H/ACA RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.2 Å58(6) 3LWR|1|D, 3LWV|1|D, 3LWP|1|D, 3HJW|1|D, 3LWO|1|D, 3LWQ|1|D
170NR_all_96295.1
Exact match
3M7N|1|Z (3M7N)
  • 5'-R(*C*UP*CP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
2.4 Å4(6) 3M7N|1|Z, 3M7N|1|X, 3M7N|1|Y, 3M85|1|X, 3M85|1|Y, 3M85|1|Z
171NR_all_33460.1
Exact match
Homo sapiens
3PGW|1|R (3PGW)
  • U1 snRNA
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
4.4 Å163(6) 3PGW|1|R, 3PGW|1|N, 3CW1|1|V, 3CW1|1|v, 3CW1|1|w, 3CW1|1|x
172NR_all_22904.1
Exact match
3R1C|1|e+3R1C|1|f (3R1C)
  • RNA (5'-R(*GP*CP*GP*GP*CP*GP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): L, O, P, e, f; model(s): 1
2.1 Å8(6) 3R1C|1|e+3R1C|1|f, 3R1C|1|C+3R1C|1|D, 3R1C|1|I+3R1C|1|J, 3R1C|1|K+3R1C|1|L, 3R1C|1|W+3R1C|1|X, 3R1C|1|c+3R1C|1|d
173NR_all_15508.1
Exact match
3TRZ|1|Z (3TRZ)
  • RNA (5'-R(*GP*GP*GP*CP*AP*GP*GP*GP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
2.9 Å20(6) 3TRZ|1|Z, 3TRZ|1|U, 3TRZ|1|V, 3TRZ|1|W, 3TRZ|1|X, 3TRZ|1|Y
174NR_all_80911.1
Exact match
Tetrahymena thermophila
4BTS|1|DA (4BTS)
  • 18S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): DA; model(s): 1
3.7 Å1717(6) 4BTS|1|DA, 4BTS|1|CA, 4BTS|1|AA, 4BTS|1|BA, 4V5O|1|BA, 4V5O|1|AA
175NR_all_24235.1
Exact match
4LGT|1|F (4LGT)
  • stem-loop of 23S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
1.3 Å19(6) 4LGT|1|F, 3J0E|1|D, 3J0D|1|E, 4LGT|1|E, 3DH3|1|F+3DH3|1|E, 3DH3|1|G+3DH3|1|H
176NR_all_22632.1
Exact match
4M6D|1|H (4M6D)
  • aptamer
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.7 Å42(6) 4M6D|1|H, 4M6D|1|D, 4M6D|1|L, 4M6D|1|B, 4M6D|1|F, 4M6D|1|J
177NR_all_33394.2
Exact match
4OO8|1|E (4OO8)
  • RNA (97-MER)
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.5 Å97(6) 4OO8|1|E, 4OO8|1|B, 5B2S|1|A, 5B2R|1|A, 5B2T|1|A, 5XBL|1|B
178NR_all_04974.3
Exact match
synthetic construct
4U3L|1|A+4U3L|1|B (4U3L)
  • RNA (5'-R(*UP*CP*GP*UP*AP*CP*GP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
1.5 Å8(6) 4U3L|1|A+4U3L|1|B, 4U78|1|A+4U78|1|B, 4U3P|1|A+4U3P|1|B, 4U3R|1|A+4U3R|1|B, 4U47|1|A+4U47|1|B, 4U3O|1|A+4U3O|1|B
179NR_all_15756.1
Exact match
Saccharomyces cerevisiae
4U8T|1|T (4U8T)
  • RNA (5'-R(*AP*GP*GP*(6MZ)P*CP*AP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.7 Å6(6) 4U8T|1|T, 4U8T|1|O, 4U8T|1|P, 4U8T|1|Q, 4U8T|1|R, 4U8T|1|S
180NR_all_11986.2
Exact match
Escherichia coli
4V5V|1|BX (4V5V)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): BX; model(s): 1
3.6 Å70(6) 4V5V|1|BX, 4V5V|1|AK, 4V5V|1|AM, 4V5V|1|BR, 2YHM|1|K, 5FVC|1|K
181NR_all_91467.5
Exact match
Homo sapiens
4V6X|1|A5+4V6X|1|A8 (4V6X)
  • 28S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A5, A8, L, O, P; model(s): 1
5.0 Å4298(6) 4V6X|1|A5+4V6X|1|A8, 5AJ0|1|A2+5AJ0|1|A3, 5T2C|1|A+5T2C|1|C, 4UG0|1|L5+4UG0|1|L8, 5A8L|1|A, 5LKS|1|L5+5LKS|1|L8
182NR_all_02142.1
Exact match
Haloarcula marismortui
4V8N|1|CV (4V8N)
  • E-SITE TRNA ILE2 AGMATIDINE OR P-SITE TR[...]
  • X-RAY DIFFRACTION
  • Chain(s): CV; model(s): 1
3.1 Å77(6) 4V8N|1|CV, 4V8N|1|AV, 4V8N|1|CY, 4V8N|1|AY, 4V8N|1|CW, 4V8N|1|AW
183NR_all_78862.1
Exact match
4V9E|1|Bm (4V9E)
  • 35-mer poly(U) RNA
  • X-RAY DIFFRACTION
  • Chain(s): Bm; model(s): 1
3.4 Å36(6) 4V9E|1|Bm, 4V9E|1|Aa, 4V9E|1|Ag, 4V9E|1|Am, 4V9E|1|Ba, 4V9E|1|Bg
184NR_all_70313.2
Exact match
Escherichia coli
5CD4|1|X (5CD4)
  • crRNA
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.2 Å60(6) 5CD4|1|X, 4TVX|1|L, 4TVX|1|X, 5CD4|1|L, 5H9F|1|L, 5H9E|1|L
185NR_all_46720.1
Exact match
Synechococcus elongatus
5DDP|1|B (5DDP)
  • RNA (61-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å61(6) 5DDP|1|B, 5DDQ|1|B, 5DDQ|1|A, 5DDP|1|A, 5DDR|1|B, 5DDR|1|A
186NR_all_04536.1
Exact match
Influenza B virus
5EPI|1|X (5EPI)
  • CRNA 5' END
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
4.1 Å12(6) 5EPI|1|X, 5EPI|1|D, 5EPI|1|H, 5EPI|1|L, 5EPI|1|P, 5EPI|1|T
187NR_all_80570.5
Exact match
synthetic construct
5JJU|1|C (5JJU)
  • RNA (5'-R(P*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.3 Å2(6) 5JJU|1|C, 4EJT|1|G, 3J0L|1|w, 3J0O|1|w, 3J0Q|1|w, 3J0P|1|w
188NR_all_33278.1
Exact match
Homo sapiens
5LYV|1|B (5LYV)
  • RNA (57-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å56(6) 5LYV|1|B, 5LYS|1|B, 5LYU|1|B, 5LYU|1|A, 5LYV|1|A, 5LYS|1|A
189NR_all_51660.3
Exact match
Escherichia coli
5NCO|1|1 (5NCO)
  • 4.5S SRP RNA (Ffs)
  • ELECTRON MICROSCOPY
  • Chain(s): 1; model(s): 1
4.8 Å104(6) 5NCO|1|1, 5GAF|1|1, 5GAH|1|1, 5GAD|1|1, 5GAG|1|1, 2IY3|1|B
190NR_all_91124.2
Exact match
Gloeobacter violaceus
5NEP|1|A (5NEP)
  • RNA (5'-R(*GP*GP*UP*GP*GP*GP*GP*AP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.6 Å17(6) 5NEP|1|A, 5NOM|1|A, 5NEX|1|A, 5NEF|1|A, 5NEQ|1|A, 5NEO|1|A
191NR_all_99471.1
Exact match
Homo sapiens
5WWR|1|D (5WWR)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.1 Å72(6) 5WWR|1|D, 5WWS|1|D, 5WWT|1|C, 5WWT|1|D, 5WWS|1|C, 5WWR|1|C
192NR_all_18996.1
Exact match
1DI2|1|G (1DI2)
  • RNA (5'-R(*GP*GP*CP*GP*CP*GP*CP*GP*CP*C)[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
1.9 Å10(5) 1DI2|1|G, 1RC7|1|B+1RC7|1|C, 1DI2|1|C+1DI2|1|D, 1RC7|1|D+1RC7|1|E, 1DI2|1|E
193NR_all_58906.1
Exact match
Bacillus phage phi29
1FOQ|1|E (1FOQ)
  • BACTERIOPHAGE PHI29 PROHEAD RNA
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
109(5) 1FOQ|1|E, 1FOQ|1|A, 1FOQ|1|B, 1FOQ|1|C, 1FOQ|1|D
194NR_all_99963.1
Exact match
1IBL|1|Y+1IBL|1|Z (1IBL)
  • ANTICODON STEM-LOOP OF PHENYLALANINE TRA[...]
  • X-RAY DIFFRACTION
  • Chain(s): L, O, P, Y, Z; model(s): 1
3.1 Å15(5) 1IBL|1|Y+1IBL|1|Z, 1IBM|1|Y+1IBM|1|Z, 4DR4|1|W+4DR4|1|V, 4DR5|1|W+4DR5|1|V, 4AQY|1|Z+4AQY|1|W
195NR_all_61343.1
Exact match
1JGQ|1|D (1JGQ)
  • tRNA(Phe)
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
5.0 Å68(5) 1JGQ|1|D, 4V42|1|AD, 1JGO|1|D, 1JGP|1|D, 2OM7|1|M
196NR_all_36712.2
Exact match
1K8W|1|B (1K8W)
  • 5'-R(*GP*GP*CP*AP*AP*CP*GP*GP*UP*(FHU)P*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å21(5) 1K8W|1|B, 1ZL3|1|B, 1ZE2|1|C, 1ZE2|1|D, 2AB4|1|B
197NR_all_49890.1
Exact match
1NUJ|1|E+1NUJ|1|F (1NUJ)
  • 5'-R(*CP*GP*GP*AP*CP*CP*GP*AP*GP*CP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): E, F, L, O, P; model(s): 1
1.8 Å13(5) 1NUJ|1|E+1NUJ|1|F, 429D|1|C+429D|1|D, 1NUV|1|C+1NUV|1|D, 1NUJ|1|C+1NUJ|1|D, 1NUV|1|E+1NUV|1|F
198NR_all_07779.1
Exact match
1NUJ|1|G+1NUJ|1|H (1NUJ)
  • 5'-R(*CP*GP*GP*AP*CP*CP*GP*AP*GP*CP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): G, H, L, O, P; model(s): 1
1.8 Å15(5) 1NUJ|1|G+1NUJ|1|H, 1NUV|1|A+1NUV|1|B, 1NUJ|1|A+1NUJ|1|B, 1NUV|1|G+1NUV|1|H, 429D|1|A+429D|1|B
199NR_all_88088.1
Exact match
Staphylococcus phage Twort
1Y0Q|1|A (1Y0Q)
  • Group I ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.6 Å229(5) 1Y0Q|1|A, 2RKJ|1|C, 2RKJ|1|G, 2RKJ|1|K, 2RKJ|1|O
200NR_all_40597.1
Exact match
1ZHO|1|H (1ZHO)
  • mRNA
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.6 Å38(5) 1ZHO|1|H, 1ZHO|1|D, 1ZHO|1|F, 2HW8|1|B, 1ZHO|1|B
201NR_all_56766.1
Exact match
Escherichia coli
2CD5|1|A (2CD5)
  • 5'-R(*GP*GP*AP*AP*GP*UP*CP*CP*GP*GP*UP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(5) 2CD5|1|A, 2CD1|1|A, 1F78|1|A, 1F7F|3|A, 1F6X|1|A
202NR_all_79496.3
Exact match
2DER|1|D (2DER)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.1 Å71(5) 2DER|1|D, 2DER|1|C, 2DET|1|C, 2DEU|1|C, 2DEU|1|D
203NR_all_14663.1
Exact match
2NR0|1|E (2NR0)
  • leucyl tRNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.9 Å81(5) 2NR0|1|E, 2NR0|1|G, 2NR0|1|H, 2NRE|1|F, 2NR0|1|F
204NR_all_86436.1
Exact match
2PN4|1|C+2PN4|1|D (2PN4)
  • 5'-R(*CP*GP*GP*AP*GP*GP*AP*AP*CP*UP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, L, O, P; model(s): 1
2.3 Å24(5) 2PN4|1|C+2PN4|1|D, 2NOK|1|A+2NOK|1|B, 2PN4|1|A+2PN4|1|B, 2PN3|1|A+2PN3|1|B, 2NOK|1|C+2NOK|1|D
205NR_all_46403.1
Exact match
3BNN|1|C+3BNN|1|D (3BNN)
  • A site of human ribosome
  • X-RAY DIFFRACTION
  • Chain(s): C, D, L, O, P; model(s): 1
2.0 Å21(5) 3BNN|1|C+3BNN|1|D, 3BNP|1|A+3BNP|1|B, 3BNN|1|A+3BNN|1|B, 3BNO|1|A+3BNO|1|B, 3BNO|1|C+3BNO|1|D
206NR_all_95363.2
Exact match
3FU2|1|A (3FU2)
  • PreQ1 riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å32(5) 3FU2|1|A, 3FU2|1|B, 3FU2|1|C, 2L1V|1|A, 3K1V|1|A
207NR_all_95755.2
Exact match
Plasmodium falciparum
3J79|1|A+3J79|1|C (3J79)
  • 28S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A, C, L, O, P; model(s): 1
3.2 Å3191(5) 3J79|1|A+3J79|1|C, 5UMD|1|A+5UMD|1|C, 3JBP|1|AA+3JBP|1|AC, 3JBO|1|AA+3JBO|1|AC, 3JBN|1|AA+3JBN|1|AC
208NR_all_20392.1
Exact match
Caldanaerobacter subterraneus
3W1K|1|J (3W1K)
  • selenocysteine tRNA
  • X-RAY DIFFRACTION
  • Chain(s): J; model(s): 1
7.5 Å92(5) 3W1K|1|J, 3W1K|1|F, 3W1K|1|G, 3W1K|1|H, 3W1K|1|I
209NR_all_65600.1
Exact match
Pseudomonas aeruginosa
4AL6|1|B (4AL6)
  • CRRNA, 5'-R(CP*UP*GP*CP*CP*GP*UP*AP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å16(5) 4AL6|1|B, 2XLI|1|B, 2XLJ|1|B, 2XLK|1|C, 2XLK|1|D
210NR_all_82984.1
Exact match
Thermotoga petrophila
4ENB|1|A (4ENB)
  • Fluoride riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å51(5) 4ENB|1|A, 4ENA|1|A, 3VRS|1|A, 4ENC|1|A, 4EN5|1|A
211NR_all_69766.1
Exact match
4MCF|1|H+4MCF|1|G (4MCF)
  • Gas5 GREM Rev
  • X-RAY DIFFRACTION
  • Chain(s): G, H, L, O, P; model(s): 1
1.9 Å10(5) 4MCF|1|H+4MCF|1|G, 4MCF|1|B+4MCF|1|D+4MCF|1|C+4MCF|1|A, 4MCE|1|D+4MCE|1|C, 4MCE|1|B+4MCE|1|A, 4MCF|1|F+4MCF|1|E
212NR_all_73731.1
Exact match
Thermus thermophilus
4QVI|1|B (4QVI)
  • fragment of 23S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å80(5) 4QVI|1|B, 3UMY|1|B, 3U4M|1|B, 4QG3|1|B, 3U56|1|B
213NR_all_52096.2
Exact match
synthetic construct
4TUX|1|C (4TUX)
  • RNA (26-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.1 Å25(5) 4TUX|1|C, 4TV0|1|B, 4TUW|1|D, 4TUX|1|D, 4TUW|1|C
214NR_all_34999.1
Exact match
Thermus thermophilus
4V4J|1|2 (4V4J)
  • E-site tRNA
  • X-RAY DIFFRACTION
  • Chain(s): 2; model(s): 1
3.8 Å75(5) 4V4J|1|2, 4V68|1|AY, 4V4I|1|0, 4V4P|1|BC, 4V4P|1|BB
215NR_all_56633.3
Exact match
Escherichia coli
4V6M|1|AV (4V6M)
  • FtsQ nascent chain
  • ELECTRON MICROSCOPY
  • Chain(s): AV; model(s): 1
7.1 Å77(5) 4V6M|1|AV, 4V5H|1|AV, 5NP6|1|B, 4UY8|1|V, 3JBU|1|v
216NR_all_94396.3
Exact match
4WAN|1|H (4WAN)
  • RNA (5'-R(P*UP*AP*CP*UP*AP*AP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
1.8 Å9(5) 4WAN|1|H, 4WAN|1|D, 4WAN|1|F, 4WAN|1|B, 4WAL|1|B
217NR_all_03097.4
Exact match
Hepatitis C virus
5A2Q|1|3 (5A2Q)
  • HCV IRES
  • ELECTRON MICROSCOPY
  • Chain(s): 3; model(s): 1
3.9 Å257(5) 5A2Q|1|3, 5OA3|1|3, 5FLX|1|z, 4UJC|1|AC, 4UJD|1|BC
218NR_all_20325.1
Exact match
synthetic construct
5C3E|1|R (5C3E)
  • Synthetic RNA
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.7 Å9(5) 5C3E|1|R, 5C4X|1|R, 5C4J|1|R, 5C4A|1|R, 5C44|1|R
219NR_all_67574.1
Exact match
synthetic construct
5F8N|1|B+5F8N|1|C (5F8N)
  • RNA (35-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B, C, L, O, P; model(s): 1
2.5 Å9(5) 5F8N|1|B+5F8N|1|C, 4K4W|1|B+4K4W|1|C, 4K4W|1|F+4K4W|1|G, 5F8L|1|B+5F8L|1|C, 5F8M|1|B+5F8M|1|C
220NR_all_64208.1
Exact match
Haloarcula marismortui
5G4U|1|I+5G4U|1|J (5G4U)
  • HMKT-7
  • X-RAY DIFFRACTION
  • Chain(s): I, J, L, O, P; model(s): 1
2.7 Å19(5) 5G4U|1|I+5G4U|1|J, 5G4U|1|A+5G4U|1|B, 5G4V|1|A+5G4V|1|B, 5G4V|1|E+5G4V|1|F, 5G4U|1|E+5G4U|1|F
221NR_all_87852.1
Exact match
unidentified
5JCF|1|C+5JCF|1|D (5JCF)
  • RNA (5'-R(P*GP*GP*UP*AP*CP*GP*UP*AP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, L, O, P; model(s): 1
2.6 Å10(5) 5JCF|1|C+5JCF|1|D, 5JC3|1|C+5JC3|1|D, 5JCH|1|U+5JCH|1|V, 5JCH|1|X+5JCH|1|Y, 5JC3|1|X+5JC3|1|Y
222NR_all_89026.2
Exact match
synthetic construct
5L00|1|C+5L00|1|D (5L00)
  • RNA (5'-R(*(LCC)P*(LCC)P*(LCC)P*(LCG)P*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, L, O, P; model(s): 1
1.3 Å13(5) 5L00|1|C+5L00|1|D, 5L00|1|A+5L00|1|B, 5V0H|1|A+5V0H|1|B, 5KRG|1|A+5KRG|1|B, 5KRG|1|C+5KRG|1|D
223NR_all_62109.1
Exact match
Staphylococcus aureus
5ND8|1|a (5ND8)
  • 16S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): a; model(s): 1
3.7 Å1542(5) 5ND8|1|a, 5ND9|1|a, 5LI0|1|a, 5TCU|1|A, 5T7V|1|A
224NR_all_48402.4
Exact match
Homo sapiens
5T2C|1|B (5T2C)
  • 5S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
3.6 Å120(5) 5T2C|1|B, 5AJ0|1|A4, 4UG0|1|L7, 4V6X|1|A7, 5LKS|1|L7
225NR_all_50424.1
Exact match
Alicyclobacillus acidoterrestris
5U31|1|B (5U31)
  • sgRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å99(5) 5U31|1|B, 5WQE|1|B, 5U30|1|B, 5U33|1|B, 5U34|1|B
226NR_all_56892.1
Exact match
synthetic construct
5UED|1|A+5UED|1|B (5UED)
  • RNA (5'-R(*(LCC)P*(LCC)P*(LCC)P*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
1.5 Å11(5) 5UED|1|A+5UED|1|B, 5UEE|1|A+5UEE|1|B, 5UEF|1|A+5UEF|1|B, 5UEG|1|A+5UEG|1|B, 5UEG|1|C+5UEG|1|D
227NR_all_17605.2
Exact match
Plasmodium falciparum
5UMD|1|B (5UMD)
  • 5S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
3.2 Å118(5) 5UMD|1|B, 3J79|1|B, 3JBP|1|AB, 3JBO|1|AB, 3JBN|1|AB
228NR_all_49339.2
Exact match
synthetic construct
5V0J|1|A+5V0J|1|B (5V0J)
  • RNA (5'-R(*(LCC)P*(LCC)P*(LCA)P*(LCG)P*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
1.5 Å10(5) 5V0J|1|A+5V0J|1|B, 5HBX|1|A+5HBX|1|B, 5DHC|1|A+5DHC|1|B, 5DHC|1|C+5DHC|1|D, 5HBX|1|C+5HBX|1|D
229NR_all_96354.3
Exact match
Spinacia oleracea
5X8P|1|a (5X8P)
  • 16S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): a; model(s): 1
3.4 Å1480(5) 5X8P|1|a, 5MMM|1|a, 5X8R|1|a, 5MMJ|1|a, 4V61|1|AA
230NR_all_77140.1
Exact match
synthetic construct
5XUZ|1|F (5XUZ)
  • crRNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.4 Å40(5) 5XUZ|1|F, 5XUT|1|B, 5XUZ|1|B, 5XUU|1|B, 5XUS|1|B
231NR_all_24974.1
Exact match
1DUQ|1|H+1DUQ|1|G (1DUQ)
  • THE REV BINDING ELEMENT
  • X-RAY DIFFRACTION
  • Chain(s): G, H, L, O, P; model(s): 1
2.1 Å14(4) 1DUQ|1|H+1DUQ|1|G, 1DUQ|1|B+1DUQ|1|A, 1DUQ|1|D+1DUQ|1|C, 1DUQ|1|F+1DUQ|1|E
232NR_all_59504.1
Exact match
1HVU|1|L (1HVU)
  • RNA (33 NUCLEOTIDE RNA PSEUDOKNOT)
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
4.8 Å30(4) 1HVU|1|L, 1HVU|1|C, 1HVU|1|F, 1HVU|1|I
233NR_all_16996.1
Exact match
1I9K|1|D (1I9K)
  • 5'-R(*UP*CP*CP*CP*CP*C)-3'
  • SOLUTION NMR
  • Chain(s): D; model(s): 1
6(4) 1I9K|1|D, 1I9K|1|A, 1I9K|1|B, 1I9K|1|C
234NR_all_57348.1
Exact match
1IVS|1|C (1IVS)
  • tRNA (Val)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å75(4) 1IVS|1|C, 1GAX|1|C, 1GAX|1|D, 1IVS|1|D
235NR_all_81653.1
Exact match
1J6S|1|D (1J6S)
  • 5'-R(*(BRUP*GP*AP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.4 Å5(4) 1J6S|1|D, 1J6S|1|A, 1J6S|1|B, 1J6S|1|C
236NR_all_28334.1
Exact match
1KNZ|1|Z (1KNZ)
  • 5'-R(*UP*GP*AP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
2.5 Å5(4) 1KNZ|1|Z, 1KNZ|1|W, 1KNZ|1|X, 1KNZ|1|Y
237NR_all_80888.1
Exact match
1MV6|1|A+1MV6|1|B (1MV6)
  • 5'-R(*GP*GP*CP*(P5P)P*(P5P)P*GP*CP*CP*U)[...]
  • SOLUTION NMR
  • Chain(s): A, B, L, O, P; model(s): 1
7(4) 1MV6|1|A+1MV6|1|B, 1MUV|1|A+1MUV|1|B, 1MV1|1|A+1MV1|1|B, 1MV2|1|A+1MV2|1|B
238NR_all_51549.1
Exact match
1PJO|1|A (1PJO)
  • 5'-R(*CP*AP*AP*AP*GP*AP*AP*AP*AP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å14(4) 1PJO|1|A, 1PJG|1|A, 1G4Q|1|A, 1JB8|1|A
239NR_all_01597.1
Exact match
1Q2R|1|F (1Q2R)
  • RNA (5'-R(*AP*GP*CP*AP*CP*GP*GP*CP*UP*(N[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.9 Å19(4) 1Q2R|1|F, 1Q2R|1|E, 1Q2S|1|E, 1Q2S|1|F
240NR_all_62858.1
Exact match
Sulfolobus solfataricus
1QZW|1|H (1QZW)
  • 7S RNA
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
4.1 Å45(4) 1QZW|1|H, 1QZW|1|B, 1QZW|1|D, 1QZW|1|F
241NR_all_01612.1
Exact match
1RAU|1|D (1RAU)
  • RNA (5'-R(*UP*GP*GP*GP*GP*U)-3')
  • SOLUTION NMR
  • Chain(s): D; model(s): 1
6(4) 1RAU|1|D, 1RAU|1|A, 1RAU|1|B, 1RAU|1|C
242NR_all_99363.1
Exact match
1SA9|1|E (1SA9)
  • 5'-R(*GP*GP*CP*GP*AP*GP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.9 Å8(4) 1SA9|1|E, 1SA9|1|A+1SA9|1|B, 1YFV|1|A+1YFV|1|B, 1SA9|1|C+1SA9|1|D
243NR_all_18961.1
Exact match
1WMQ|1|D (1WMQ)
  • 5'-R(P*UP*UP*UP*AP*GP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.6 Å7(4) 1WMQ|1|D, 1WRQ|1|C, 1WMQ|1|C, 1WRQ|1|D
244NR_all_99632.2
Exact match
Saccharomyces cerevisiae
1YFG|1|A (1YFG)
  • YEAST INITIATOR TRNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å64(4) 1YFG|1|A, 5OA3|1|1, 3JAQ|1|1, 3J81|1|1
245NR_all_85514.1
Exact match
1YYK|1|E+1YYK|1|F (1YYK)
  • 5'-R(*CP*GP*CP*GP*AP*AP*UP*UP*CP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): E, F, L, O, P; model(s): 1
2.5 Å12(4) 1YYK|1|E+1YYK|1|F, 1YYO|1|C+1YYO|1|D, 1YYK|1|C+1YYK|1|D, 1YYO|1|E+1YYO|1|F
246NR_all_24746.1
Exact match
1YYW|1|K+1YYW|1|L (1YYW)
  • 5'-R(*AP*AP*AP*UP*AP*UP*AP*UP*AP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): K, L, O, P; model(s): 1
2.8 Å12(4) 1YYW|1|K+1YYW|1|L, 1YYW|1|E+1YYW|1|F, 1YYW|1|G+1YYW|1|H, 1YYW|1|I+1YYW|1|J
247NR_all_23650.1
Exact match
259D|1|A+259D|1|B (259D)
  • RNA (5'-R(*CP*CP*CP*CP*GP*GP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
1.5 Å8(4) 259D|1|A+259D|1|B, 1RXA|1|A, 1RXB|1|A+1RXB|1|B, 2A0P|1|A+2A0P|1|B
248NR_all_58761.1
Exact match
2CT8|1|D (2CT8)
  • RNA (74-MER)
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.7 Å74(4) 2CT8|1|D, 2CSX|1|C, 2CT8|1|C, 2CSX|1|D
249NR_all_39150.1
Exact match
2CZJ|1|H (2CZJ)
  • tmRNA (63-MER)
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.0 Å60(4) 2CZJ|1|H, 2CZJ|1|D, 2CZJ|1|B, 2CZJ|1|F
250NR_all_59612.1
Exact match
2DB3|1|H (2DB3)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.2 Å6(4) 2DB3|1|H, 2DB3|1|E, 2DB3|1|F, 2DB3|1|G
251NR_all_33389.1
Exact match
2DU3|1|D (2DU3)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.6 Å71(4) 2DU3|1|D, 2DU4|1|C, 2DU6|1|D, 2DU5|1|D
252NR_all_54657.1
Exact match
2FQN|1|A+2FQN|1|B (2FQN)
  • 5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*UP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
2.3 Å22(4) 2FQN|1|A+2FQN|1|B, 2O3Y|1|A+2O3Y|1|B, 2G5K|1|A+2G5K|1|B, 2O3W|1|A+2O3W|1|B
253NR_all_98374.1
Exact match
2I82|1|H (2I82)
  • 5'-R(*GP*AP*GP*GP*GP*GP*AP*UP*UP*GP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.1 Å20(4) 2I82|1|H, 2I82|1|E, 2I82|1|F, 2I82|1|G
254NR_all_06706.1
Exact match
2JYH|1|B (2JYH)
  • RNA (43-MER)
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
43(4) 2JYH|1|B, 2JYH|1|A, 2JYJ|2|A, 2JYJ|2|B
255NR_all_17139.1
Exact match
Drosophila melanogaster
2KUU|1|A (2KUU)
  • K10 TLS RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
48(4) 2KUU|1|A, 2KUR|10|A, 2KUV|6|A, 2KE6|1|A
256NR_all_49812.1
Exact match
2M18|9|B (2M18)
  • RNA (5'-R(*GP*GP*GP*UP*UP*AP*GP*GP*GP*U)[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 9
10(4) 2M18|9|B, 2M18|9|A, 2M18|9|C, 2M18|9|D
257NR_all_44976.1
Exact match
2MFG|1|D (2MFG)
  • SL4(RsmZ) RNA
  • SOLUTION NMR
  • Chain(s): D; model(s): 1
21(4) 2MFG|1|D, 2MFG|1|B, 2MFE|1|B, 2MFE|1|D
258NR_all_87892.3
Exact match
2NOQ|1|A (2NOQ)
  • CrPV IRES
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
7.3 Å190(4) 2NOQ|1|A, 4D5N|1|X, 4D61|1|j, 5IT9|1|i
259NR_all_45092.1
Exact match
Thermus thermophilus
2OM7|1|C (2OM7)
  • Fragment of 16S rRNA (h44)
  • ELECTRON MICROSCOPY
  • Chain(s): C; model(s): 1
7.3 Å96(4) 2OM7|1|C, 1X1L|1|A, 1ZC8|1|Z, 2OB7|1|D
260NR_all_58198.1
Exact match
2R20|1|A+2R20|1|B (2R20)
  • RNA (5'-R(*GP*CP*GP*UP*UP*(5BU)P*GP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P; model(s): 1
1.3 Å12(4) 2R20|1|A+2R20|1|B, 2R22|1|A+2R22|1|B, 2R1S|1|A+2R1S|1|B, 2R21|1|A+2R21|1|B
261NR_all_16115.1
Exact match
2R7W|1|X (2R7W)
  • RNA (5'-R(*UP*GP*UP*GP*AP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.6 Å7(4) 2R7W|1|X, 2R7X|1|X, 2R7R|1|X, 2R7X|1|Y
262NR_all_03697.3
Exact match
Thermus thermophilus
2UUA|1|Y+2UUA|1|X (2UUA)
  • 5'-R(*CP*CP*UP*CP*CP*CP*UP*CM0P*AP*CP*6M[...]
  • X-RAY DIFFRACTION
  • Chain(s): L, O, P, X, Y; model(s): 1
2.9 Å11(4) 2UUA|1|Y+2UUA|1|X, 2UUC|1|Y+2UUC|1|X, 2UU9|1|Y+2UU9|1|X, 2UUB|1|Y+2UUB|1|X
263NR_all_87944.2
Exact match
3AOH|1|Q (3AOH)
  • RNA (5'-R(*CP*CP*CP*CP*GP*GP*AP*AP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
4.1 Å7(4) 3AOH|1|Q, 3AOI|1|S, 3AOI|1|Q, 3AOI|1|U
264NR_all_95171.1
Exact match
3B31|1|A (3B31)
  • RNA (29-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.4 Å29(4) 3B31|1|A, 3MJA|1|B, 3MJB|1|A, 3MJ3|1|B
265NR_all_64844.1
Exact match
3BSO|1|T+3BSO|1|P (3BSO)
  • RNA (5'-R(P*UP*GP*CP*CP*CP*GP*GP*GP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): L, O, P, T; model(s): 1
1.7 Å9(4) 3BSO|1|T+3BSO|1|P, 3H5X|1|T+3H5X|1|P, 3H5Y|1|T+3H5Y|1|P, 3BSN|1|T+3BSN|1|P
266NR_all_49553.1
Exact match
3CUL|1|D (3CUL)
  • RNA (92-MER)
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.8 Å92(4) 3CUL|1|D, 3CUL|1|C, 3CUN|1|C, 3CUN|1|D
267NR_all_22479.1
Exact match
3D0U|1|A (3D0U)
  • Lysine Riboswitch RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å161(4) 3D0U|1|A, 4ERJ|1|A, 4ERL|1|A, 3D0X|1|A
268NR_all_18955.1
Exact match
3I2S|1|A (3I2S)
  • 5'-R(*UP*CP*CP*CP*(A2M)P*GP*UP*CP*CP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å13(4) 3I2S|1|A, 3I2R|1|A, 3I2U|1|A, 3I2Q|1|A
269NR_all_51748.1
Exact match
3I5X|1|B (3I5X)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å10(4) 3I5X|1|B, 3I61|1|B, 3I62|1|B, 3I5Y|1|B
270NR_all_30893.1
Exact match
Escherichia coli
3J0D|1|A (3J0D)
  • ribosomal 23S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
11.1 Å50(4) 3J0D|1|A, 3EQ4|1|B, 3EP2|1|B, 3EQ3|1|B
271NR_all_11808.1
Exact match
Oryctolagus cuniculus
3J0O|1|2 (3J0O)
  • 60S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
9.0 Å112(4) 3J0O|1|2, 3J0L|1|2, 3J0P|1|2, 3J0Q|1|2
272NR_all_71842.1
Exact match
Oryctolagus cuniculus
3J0O|1|3 (3J0O)
  • 60S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): 3; model(s): 1
9.0 Å12(4) 3J0O|1|3, 3J0L|1|3, 3J0Q|1|3, 3J0P|1|3
273NR_all_28256.1
Exact match
Oryctolagus cuniculus
3J0O|1|7 (3J0O)
  • 60S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): 7; model(s): 1
9.0 Å50(4) 3J0O|1|7, 3J0L|1|7, 3J0Q|1|7, 3J0P|1|7
274NR_all_65349.1
Exact match
Oryctolagus cuniculus
3J0O|1|a (3J0O)
  • 40S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): a; model(s): 1
9.0 Å48(4) 3J0O|1|a, 3J0Q|1|a, 3J0P|1|a, 3J0L|1|a
275NR_all_62142.1
Exact match
Oryctolagus cuniculus
3J0O|1|c (3J0O)
  • 40S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): c; model(s): 1
9.0 Å17(4) 3J0O|1|c, 3J0Q|1|c, 3J0P|1|c, 3J0L|1|c
276NR_all_20576.1
Exact match
Oryctolagus cuniculus
3J0O|1|f (3J0O)
  • 40S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): f; model(s): 1
9.0 Å21(4) 3J0O|1|f, 3J0P|1|f, 3J0Q|1|f, 3J0L|1|f
277NR_all_56124.1
Exact match
Oryctolagus cuniculus
3J0O|1|g+3J0O|1|G+3J0O|1|d (3J0O)
  • 40S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): G, L, O, P, d, g; model(s): 1
9.0 Å31(4) 3J0O|1|g+3J0O|1|G+3J0O|1|d, 3J0Q|1|g+3J0Q|1|G+3J0Q|1|d, 3J0L|1|g+3J0L|1|G+3J0L|1|d, 3J0P|1|g+3J0P|1|G+3J0P|1|d
278NR_all_59615.1
Exact match
Oryctolagus cuniculus
3J0O|1|h (3J0O)
  • 40S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): h; model(s): 1
9.0 Å111(4) 3J0O|1|h, 3J0P|1|h, 3J0Q|1|h, 3J0L|1|h
279NR_all_26483.1
Exact match
Sus scrofa
3J7P|1|5+3J7P|1|8 (3J7P)
  • 28S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 5, 8, L, O, P, d; model(s): 1
3.5 Å3662(4) 3J7P|1|5+3J7P|1|8, 3J7O|1|5+3J7O|1|8, 3J7Q|1|5+3J7Q|1|8, 3J7R|1|5+3J7R|1|8
280NR_all_62824.1
Exact match
Sus scrofa
3J7Q|1|7 (3J7Q)
  • 5S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 7; model(s): 1
3.4 Å120(4) 3J7Q|1|7, 3J7P|1|7, 3J7R|1|7, 3J7O|1|7
281NR_all_41610.3
Exact match
Bacillus subtilis
3J9W|1|BA (3J9W)
  • 23S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): BA; model(s): 1
3.9 Å2923(4) 3J9W|1|BA, 5NJT|1|U, 3J3W|1|A, 3J3V|1|A
282NR_all_50890.1
Exact match
3JXR|1|K (3JXR)
  • r[CGCG(5-fluoro)CG]2
  • X-RAY DIFFRACTION
  • Chain(s): K; model(s): 1
1.3 Å5(4) 3JXR|1|K, 3JXQ|1|B+3JXQ|1|A, 3JXQ|1|L+3JXQ|1|K, 3JXR|1|A+3JXR|1|B
283NR_all_79254.1
Exact match
Thermus thermophilus
3KFU|1|L (3KFU)
  • tRNA-Asn
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
3.0 Å71(4) 3KFU|1|L, 3KFU|1|K, 3KFU|1|M, 3KFU|1|N
284NR_all_56855.1
Exact match
3KMS|1|B+3KMS|1|C (3KMS)
  • RNA (5'-R(*AP*UP*GP*GP*GP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B, C, L, O, P, d; model(s): 1
2.2 Å7(4) 3KMS|1|B+3KMS|1|C, 3KLV|1|B+3KLV|1|C, 4IQX|1|B+4IQX|1|C, 3KNA|1|B+3KNA|1|C
285NR_all_25369.1
Exact match
3NJ6|1|A (3NJ6)
  • 5'-R(*GP*GP*CP*AP*GP*CP*AP*GP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.0 Å10(4) 3NJ6|1|A, 3NJ7|1|A+3NJ7|1|B, 3NJ7|1|C+3NJ7|1|D, 3NJ7|1|E+3NJ7|1|F
286NR_all_83027.1
Exact match
Ralstonia solanacearum
3NPN|1|A (3NPN)
  • S-ADENOSYLHOMOCYSTEINE RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å50(4) 3NPN|1|A, 3NPQ|1|C, 3NPQ|1|A, 3NPQ|1|B
287NR_all_41959.1
Exact match
3P22|1|G (3P22)
  • Core ENE hairpin from KSHV PAN RNA
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.5 Å39(4) 3P22|1|G, 3P22|1|A, 3P22|1|C, 3P22|1|E
288NR_all_76114.1
Exact match
3RKF|1|B (3RKF)
  • Guanine riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å67(4) 3RKF|1|B, 3RKF|1|A, 3RKF|1|D, 3RKF|1|C
289NR_all_59870.1
Exact match
3S49|1|G (3S49)
  • RNA (5'-R(*GP*UP*AP*UP*AP*(RUS)P*AP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.3 Å7(4) 3S49|1|G, 3S49|1|A+3S49|1|B, 3S49|1|C+3S49|1|D, 3S49|1|E+3S49|1|F
290NR_all_94275.1
Exact match
synthetic construct
3ZP8|1|A (3ZP8)
  • HAMMERHEAD RIBOZYME, ENZYME STRAND
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.6 Å42(4) 3ZP8|1|A, 3ZD4|1|A, 2OEU|1|A, 3ZD5|1|A
291NR_all_94840.1
Exact match
404D|1|A (404D)
  • 5'-R(*GP*AP*AP*GP*AP*GP*AP*AP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.5 Å10(4) 404D|1|A, 1RRR|1|A+1RRR|1|B, 1OO7|1|A, 1RRD|1|A
292NR_all_54627.2
Exact match
Saccharomyces cerevisiae
4A3G|1|P (4A3G)
  • TRANSCRIPT RNA 5'-R(*CP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.5 Å2(4) 4A3G|1|P, 4A3J|1|P, 3J9M|1|u, 5MMI|1|z
293NR_all_72182.1
Exact match
Escherichia coli
4AM3|1|I (4AM3)
  • RNA, 5'-R(*UP*AP*AP*CP*UP*UP*UP*GP*GP)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
3.0 Å1(4) 4AM3|1|I, 4AM3|1|E, 4AM3|1|D, 4AM3|1|H
294NR_all_95734.1
Exact match
Thermus thermophilus
4B3T|1|Z+4B3T|1|W (4B3T)
  • 5'-R(*GP*GP*GP*AP*UP*UP*GP*AP*AP*AP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): L, O, P, W, Z, d; model(s): 1
3.0 Å15(4) 4B3T|1|Z+4B3T|1|W, 4B3R|1|Z+4B3R|1|W, 4B3S|1|Z+4B3S|1|W, 4B3M|1|Z+4B3M|1|W
295NR_all_87746.1
Exact match
4IQS|1|F (4IQS)
  • RNA (5'-R(*GP*UP*GP*(S5)P*AP*CP*AP*C)-3'[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.6 Å7(4) 4IQS|1|F, 4IQS|1|A+4IQS|1|B, 4IQS|1|C+4IQS|1|D, 4IQS|1|E
296NR_all_81920.1
Exact match
4K4Y|1|N+4K4Y|1|P (4K4Y)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): L, N, O, P, d; model(s): 1
2.7 Å17(4) 4K4Y|1|N+4K4Y|1|P, 4K4Y|1|B+4K4Y|1|D, 4K4Y|1|J+4K4Y|1|L, 4K4Y|1|F+4K4Y|1|H
297NR_all_31091.1
Exact match
4K50|1|F (4K50)
  • RNA (33-MER)
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.9 Å31(4) 4K50|1|F, 4K50|1|N, 4K50|1|B, 4K50|1|J
298NR_all_06951.1
Exact match
4KZD|1|R (4KZD)
  • RNA (84-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.2 Å83(4) 4KZD|1|R, 4KZE|1|R, 4Q9R|1|R, 4Q9Q|1|R
299NR_all_96269.3
Exact match
Homo sapiens
4KZZ|1|j (4KZZ)
  • initiator Met-RNA-i
  • X-RAY DIFFRACTION
  • Chain(s): j; model(s): 1
7.0 Å75(4) 4KZZ|1|j, 4V6X|1|BC, 4UG0|1|S6, 5T2C|1|An
300NR_all_80093.2
Exact match
4LJ0|1|E (4LJ0)
  • polyadenosine RNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.2 Å2(4) 4LJ0|1|E, 5LZY|1|hh, 4LJ0|1|C, 4LJ0|1|D
301NR_all_31699.1
Exact match
4MGN|1|B (4MGN)
  • tRNA-glycine
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.2 Å71(4) 4MGN|1|B, 4MGM|1|A, 4MGM|1|B, 4MGN|1|D
302NR_all_40559.1
Exact match
synthetic construct
4PEH|1|Y (4PEH)
  • RNA (5'-R(*CP*UP*AP*(A2P)P*AP*CP*AP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.1 Å4(4) 4PEH|1|Y, 4PEH|1|X, 4PEH|1|W, 4PEH|1|V
303NR_all_84961.1
Exact match
Homo sapiens
4PJO|1|3 (4PJO)
  • U1 RNA variant (48-MER) with 4-helix jun[...]
  • X-RAY DIFFRACTION
  • Chain(s): 3; model(s): 1
3.3 Å46(4) 4PJO|1|3, 4PJO|1|1, 4PJO|1|2, 4PJO|1|4
304NR_all_67439.2
Exact match
4PQU|1|T (4PQU)
  • 5'-R(*AP*UP*GP*GP*UP*CP*GP*GP*CP*GP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.5 Å21(4) 4PQU|1|T, 4PQU|1|E, 4PUO|1|T, 4PUO|1|E
305NR_all_19645.1
Exact match
4QI2|1|E (4QI2)
  • RNA (5'-R(*AP*CP*AP*UP*GP*UP*UP*UP*UP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.0 Å19(4) 4QI2|1|E, 4QI2|1|F, 4QI2|1|G, 4QI2|1|H
306NR_all_34740.1
Exact match
4QJD|1|H (4QJD)
  • Twister RNA sequence
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.1 Å46(4) 4QJD|1|H, 4QJD|1|B, 4QJD|1|F, 4QJD|1|D
307NR_all_26321.1
Exact match
4QOZ|1|A (4QOZ)
  • histone mRNA stem-loop
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å26(4) 4QOZ|1|A, 4L8R|1|A, 4QOZ|1|D, 4L8R|1|D
308NR_all_30317.1
Exact match
synthetic construct
4S3N|1|B+4S3N|1|C (4S3N)
  • RNA (5'-R(*GP*GP*CP*UP*UP*UP*UP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, L, O, P, d; model(s): 1
2.0 Å19(4) 4S3N|1|B+4S3N|1|C, 4RWP|1|B+4RWP|1|C, 4RWN|1|B+4RWN|1|C, 4RWO|1|B+4RWO|1|C
309NR_all_17333.1
Exact match
4V50|1|CW (4V50)
  • PHE TRNA (UNMODIFIED BASES)
  • X-RAY DIFFRACTION
  • Chain(s): CW; model(s): 1
3.2 Å17(4) 4V50|1|CW, 4V6D|1|AV, 4V50|1|AW, 4V6D|1|CV
310NR_all_13728.1
Exact match
Tetrahymena thermophila
4V8P|1|F1+4V8P|1|E2 (4V8P)
  • 26S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): E2, F1, L, O, P, d; model(s): 1
3.5 Å3119(4) 4V8P|1|F1+4V8P|1|E2, 4V8P|1|D1+4V8P|1|C2, 4V8P|1|H1+4V8P|1|G2, 4V8P|1|A1+4V8P|1|B2
311NR_all_42832.1
Exact match
Tetrahymena thermophila
4V8P|1|G3 (4V8P)
  • 5S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): G3; model(s): 1
3.5 Å120(4) 4V8P|1|G3, 4V8P|1|B3, 4V8P|1|C3, 4V8P|1|E3
312NR_all_29909.1
Exact match
Alcaligenes sp.
4V9Q|1|DV (4V9Q)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): DV; model(s): 1
3.4 Å77(4) 4V9Q|1|DV, 4V9Q|1|BV, 4V9Q|1|BW, 4V9Q|1|DW
313NR_all_73795.1
Exact match
Pseudomonas aeruginosa
4WJ3|1|T (4WJ3)
  • 76mer-tRNA
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
3.7 Å76(4) 4WJ3|1|T, 4WJ3|1|Q, 4WJ3|1|S, 4WJ3|1|R
314NR_all_74156.3
Exact match
Influenza B virus
4WRT|1|V+4WRT|1|R (4WRT)
  • Influenza virus polymerase vRNA promoter[...]
  • X-RAY DIFFRACTION
  • Chain(s): L, O, P, R, V, d; model(s): 1
2.7 Å14(4) 4WRT|1|V+4WRT|1|R, 5MSG|1|V+5MSG|1|R, 4WSA|1|V+4WSA|1|R, 5M3J|1|V+5M3J|1|R
315NR_all_49730.1
Exact match
Homo sapiens
4X4V|1|B (4X4V)
  • Human MenBeta minihelix ending in CCACC
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å34(4) 4X4V|1|B, 4X4U|1|D, 4X4U|1|B, 4X4V|1|D
316NR_all_00143.1
Exact match
Lactococcus lactis
4Y1J|1|A (4Y1J)
  • yybP-ykoY riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.2 Å100(4) 4Y1J|1|A, 4Y1I|1|B, 4Y1I|1|A, 4Y1J|1|B
317NR_all_31480.1
Exact match
4YAZ|1|R (4YAZ)
  • RNA (84-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.0 Å83(4) 4YAZ|1|R, 4YAZ|1|A, 4YB0|1|A, 4YB0|1|R
318NR_all_65123.1
Exact match
Streptococcus pyogenes
4ZT0|1|D (4ZT0)
  • single-guide RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.9 Å72(4) 4ZT0|1|D, 4ZT0|1|B, 4ZT9|1|B, 4ZT9|1|D
319NR_all_49464.1
Exact match
synthetic construct
5AY3|1|A+5AY3|1|B (5AY3)
  • RNA (5'-R(*GP*GP*AP*CP*UP*(CBR)P*GP*A*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, L, O, P, d; model(s): 1
1.2 Å12(4) 5AY3|1|A+5AY3|1|B, 5AY2|1|A+5AY2|1|B, 5AY4|1|A+5AY4|1|B, 5AY2|1|C+5AY2|1|D
320NR_all_18889.3
Exact match
Fusobacterium nucleatum
5C45|1|X+5C45|1|Y (5C45)
  • FMN Riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): L, O, P, X, Y, d; model(s): 1
2.9 Å54(4) 5C45|1|X+5C45|1|Y, 5KX9|1|X+5KX9|1|Y, 3F4G|1|X+3F4G|1|Y, 2YIE|1|X+2YIE|1|Z
321NR_all_72172.1
Exact match
Homo sapiens
5CCB|1|N (5CCB)
  • tRNA3Lys
  • X-RAY DIFFRACTION
  • Chain(s): N; model(s): 1
2.0 Å78(4) 5CCB|1|N, 5CCX|1|N, 5CD1|1|N, 5CD1|1|M
322NR_all_55964.1
Exact match
Lactobacillus rhamnosus
5D5L|1|D (5D5L)
  • PreQ1-II riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.5 Å76(4) 5D5L|1|D, 5D5L|1|A, 5D5L|1|B, 5D5L|1|C
323NR_all_56345.1
Exact match
Vibrio vulnificus
5E54|1|B (5E54)
  • Vibrio vulnificus strain 93U204 chromoso[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å68(4) 5E54|1|B, 5SWD|1|B, 5E54|1|A, 5SWD|1|A
324NR_all_06496.1
Exact match
Homo sapiens
5E6M|1|E (5E6M)
  • tRNA(Gly)
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.9 Å73(4) 5E6M|1|E, 4KR2|1|C, 4KR3|1|C, 5E6M|1|C
325NR_all_08138.1
Exact match
Homo sapiens
5F0Q|1|E (5F0Q)
  • RNA (5'-R(P*GP*GP*CP*GP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.2 Å5(4) 5F0Q|1|E, 5F0S|1|C, 5F0Q|1|C, 5F0S|1|E
326NR_all_20758.1
Exact match
synthetic construct
5F8H|1|B+5F8H|1|C (5F8H)
  • RNA (35-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B, C, L, O, P, d; model(s): 1
2.5 Å12(4) 5F8H|1|B+5F8H|1|C, 5F8J|1|B+5F8J|1|C, 5F8G|1|B+5F8G|1|C, 5F8I|1|B+5F8I|1|C
327NR_all_73988.1
Exact match
Saccharomyces cerevisiae
5L2L|1|H (5L2L)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*G)[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
1.6 Å11(4) 5L2L|1|H, 5L2L|1|D, 5L2L|1|G, 5L2L|1|C
328NR_all_76892.1
Exact match
Escherichia coli
5LZD|1|y (5LZD)
  • Sec-tRNASec
  • ELECTRON MICROSCOPY
  • Chain(s): y; model(s): 1
3.4 Å91(4) 5LZD|1|y, 5LZB|1|y, 5LZF|1|y, 5LZC|1|y
329NR_all_08470.1
Exact match
Saccharomyces cerevisiae
5MRC|1|A (5MRC)
  • 21S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.3 Å2709(4) 5MRC|1|A, 5MRF|1|A, 5MRE|1|A, 3J6B|1|A
330NR_all_77294.1
Exact match
Gloeobacter violaceus
5NDH|1|D (5NDH)
  • RNA (5'-R(*GP*(CBV)P*GP*GP*GP*GP*AP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.8 Å15(4) 5NDH|1|D, 5NDH|1|A, 5NDH|1|B, 5NDH|1|C
331NR_all_66896.1
Exact match
Escherichia coli
5NDI|1|D (5NDI)
  • RNA (5'-R(*UP*UP*UP*GP*CP*AP*GP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.6 Å19(4) 5NDI|1|D, 5NDI|1|A, 5NDI|1|B, 5NDI|1|C
332NR_all_24181.1
Exact match
synthetic construct
5NG6|1|H (5NG6)
  • crRNA
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.3 Å25(4) 5NG6|1|H, 5NG6|1|B, 5NG6|1|D, 5NG6|1|F
333NR_all_20829.3
Exact match
Saccharomyces cerevisiae
5NRL|1|2+5NRL|1|4+5NRL|1|6 (5NRL)
  • U2 snRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 2, 4, 6, L, O, P; model(s): 1
7.2 Å152(4) 5NRL|1|2+5NRL|1|4+5NRL|1|6, 5MQ0|1|2+5MQ0|1|6, 5LJ5|1|Z+5LJ5|1|V, 5LJ3|1|Z+5LJ3|1|V
334NR_all_73286.3
Exact match
Homo sapiens
5O9Z|1|5 (5O9Z)
  • Homo sapiens U5 A small nuclear RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 5; model(s): 1
4.5 Å114(4) 5O9Z|1|5, 5MQF|1|5, 5XJC|1|B, 3JCR|1|H
335NR_all_59689.3
Exact match
Vibrio vulnificus
5SWE|1|X (5SWE)
  • Vibrio vulnificus strain 93U204 chromoso[...]
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.0 Å71(4) 5SWE|1|X, 4TZY|1|X, 4TZX|1|X, 4XNR|1|X
336NR_all_42653.1
Exact match
5T16|1|P (5T16)
  • RNA substrate analog
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.8 Å33(4) 5T16|1|P, 5T16|1|G, 5T16|1|H, 5T16|1|O
337NR_all_83745.1
Exact match
synthetic construct
5T3K|1|C+5T3K|1|D (5T3K)
  • RNA (5'-R(*GP*GP*UP*GP*GP*UP*GP*AP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, C, D, L, O, P; model(s): 1
2.1 Å17(4) 5T3K|1|C+5T3K|1|D, 5T3K|1|A+5T3K|1|B, 1T0D|1|A+1T0D|1|B, 1T0D|1|C+1T0D|1|D
338NR_all_93599.1
Exact match
Homo sapiens
5UDZ|1|W (5UDZ)
  • let-7f-1 pre-element
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
2.0 Å23(4) 5UDZ|1|W, 5UDZ|1|V, 3TS0|1|U, 3TS0|1|V
339NR_all_23929.2
Exact match
Saccharomyces cerevisiae
5W5Y|1|R (5W5Y)
  • RNA
  • ELECTRON MICROSCOPY
  • Chain(s): R; model(s): 1
3.8 Å6(4) 5W5Y|1|R, 5W65|1|R, 5W64|1|R, 5W66|1|R
340NR_all_56118.3
Exact match
Saccharomyces cerevisiae
5WSG|1|E (5WSG)
  • Saccharomyces cerevisiae S288c SNR6 snRN[...]
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
4.0 Å103(4) 5WSG|1|E, 5MPS|1|6, 5GMK|1|E+5GMK|1|L, 5LQW|1|6+5LQW|1|2
341NR_all_03710.1
Exact match
Escherichia coli
1EFW|1|D (1EFW)
  • ASPARTYL-TRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å63(3) 1EFW|1|D, 1EFW|1|C, 1C0A|1|B
342NR_all_23049.1
Exact match
1F7Y|1|B (1F7Y)
  • 16S RIBOSOMAL RNA FRAGMENT
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å60(3) 1F7Y|1|B, 1DK1|1|B, 1KUQ|1|B
343NR_all_05236.1
Exact match
Bluetongue virus
1H1K|1|K+1H1K|1|N (1H1K)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): 6, K, L, N, O, P; model(s): 1
10.0 Å265(3) 1H1K|1|K+1H1K|1|N, 1H1K|1|I+1H1K|1|L, 1H1K|1|J+1H1K|1|M
344NR_all_61174.1
Exact match
Escherichia coli
1H2C|1|R (1H2C)
  • 5'-R(*UP*GP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
1.6 Å3(3) 1H2C|1|R, 1H2D|1|R, 1H2D|1|S
345NR_all_41342.1
Exact match
1I9F|5|A (1I9F)
  • REV RESPONSE ELEMENT RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
34(3) 1I9F|5|A, 1ETG|14|A, 1ETF|1|A
346NR_all_82070.1
Exact match
1NTT|1|A (1NTT)
  • 5'-R(*AP*AP*AP*GP*GP*AP*GP*GP*A)-3'
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
9(3) 1NTT|1|A, 1NTS|1|A, 1NTQ|1|A
347NR_all_52295.1
Exact match
Escherichia coli
1O9M|1|A+1O9M|1|B (1O9M)
  • EUBACTERIAL A-SITE
  • X-RAY DIFFRACTION
  • Chain(s): 6, A, B, L, O, P; model(s): 1
2.4 Å21(3) 1O9M|1|A+1O9M|1|B, 2ET8|1|A+2ET8|1|B, 2F4U|1|A+2F4U|1|B
348NR_all_32272.1
Exact match
1OKF|1|B (1OKF)
  • 5'-R(*GP*CP*AP*UP*AP*UP*CP*AP*GP)-3'
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
9(3) 1OKF|1|B, 1HG9|1|B, 1HHX|1|B
349NR_all_08416.1
Exact match
1QBP|1|E+1QBP|1|F (1QBP)
  • 5'-R(*UP*GP*(CBV)P*(CBV)P*AP*GP*UP*UP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, E, F, L, O, P; model(s): 1
2.1 Å13(3) 1QBP|1|E+1QBP|1|F, 1QBP|1|A+1QBP|1|B, 1QBP|1|C+1QBP|1|D
350NR_all_03715.1
Exact match
Staphylococcus aureus
1QU2|1|T (1QU2)
  • ISOLEUCYL-TRNA
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.2 Å75(3) 1QU2|1|T, 1FFY|1|T, 1QU3|1|T
351NR_all_16422.1
Exact match
1SAQ|1|E (1SAQ)
  • 5'-R(*GP*IP*CP*GP*AP*GP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.7 Å7(3) 1SAQ|1|E, 1SAQ|1|A+1SAQ|1|B, 1SAQ|1|C+1SAQ|1|D
352NR_all_73551.1
Exact match
1SDS|1|F (1SDS)
  • box H/ACA sRNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
1.8 Å15(3) 1SDS|1|F, 1SDS|1|D, 1SDS|1|E
353NR_all_79612.1
Exact match
1UVI|1|F (1UVI)
  • 5'-R(*UP*UP*UP*UP*CP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.2 Å4(3) 1UVI|1|F, 1UVI|1|D, 1UVI|1|E
354NR_all_81635.1
Exact match
1UVJ|1|F (1UVJ)
  • 5'-R(*UP*UP*CP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
1.9 Å4(3) 1UVJ|1|F, 1UVJ|1|D, 1UVJ|1|E
355NR_all_96572.1
Exact match
1UVL|1|F (1UVL)
  • 5'-R(*UP*UP*UP*CP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.0 Å5(3) 1UVL|1|F, 1UVL|1|B, 1UVL|1|D
356NR_all_95409.1
Exact match
1UVM|1|F (1UVM)
  • 5'-R(*UP*UP*UP*CP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.0 Å5(3) 1UVM|1|F, 1UVM|1|D, 1UVM|1|E
357NR_all_31949.1
Exact match
1UVN|1|F (1UVN)
  • 5'-R(*UP*UP*UP*UP*CP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.0 Å4(3) 1UVN|1|F, 1UVN|1|B, 1UVN|1|D
358NR_all_00844.2
Exact match
1VOP|1|A (1VOP)
  • 23S RIBOSOMAL RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(3) 1VOP|1|A, 3J0E|1|C, 3J0D|1|D
359NR_all_46102.1
Exact match
1WZ2|1|D (1WZ2)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.2 Å88(3) 1WZ2|1|D, 3J5Y|1|D, 1WZ2|1|C
360NR_all_42126.1
Exact match
2B3J|1|E (2B3J)
  • anticodon stem-loop of t-RNA-Arg2 (nucle[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.0 Å14(3) 2B3J|1|E, 2B3J|1|H, 2B3J|1|F
361NR_all_29524.1
Exact match
2J0S|1|E (2J0S)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP *UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.2 Å6(3) 2J0S|1|E, 2J0Q|1|E, 2J0Q|1|H
362NR_all_47665.1
Exact match
synthetic construct
2JA7|1|6 (2JA7)
  • 5'-R(*UP*UP*CP*GP*AP*CP*CP*AP*GP*GP*AP)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6; model(s): 1
3.8 Å10(3) 2JA7|1|6, 2JA7|1|3, 2JA5|1|P
363NR_all_48307.1
Exact match
2K96|1|A (2K96)
  • TELOMERASE RNA P2B-P3 PSEUDOKNOT
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
47(3) 2K96|1|A, 1YMO|11|A, 2K95|6|A
364NR_all_30619.2
Exact match
2KXM|1|A (2KXM)
  • RNA (27-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(3) 2KXM|1|A, 2N0J|3|A, 2MXS|5|A
365NR_all_31948.1
Exact match
2LB4|1|B (2LB4)
  • RNA_(5'-R(*GP*AP*GP*CP*AP*CP*CP*AP*U)-3'[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
9(3) 2LB4|1|B, 2LAR|1|B, 1C2Q|1|B
366NR_all_31352.3
Exact match
Bacillus subtilis
2LBQ|4|A (2LBQ)
  • RNA (5'-R(*GP*GP*GP*GP*AP*CP*UP*GP*UP*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
16(3) 2LBQ|4|A, 2LA9|1|A, 2LAC|1|A
367NR_all_03598.2
Exact match
2LPT|1|A (2LPT)
  • RNA_(34-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
34(3) 2LPT|1|A, 2F88|1|A, 2LPS|2|A
368NR_all_34462.1
Exact match
2LUP|11|A (2LUP)
  • RNA (32-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 11
32(3) 2LUP|11|A, 1T4L|1|A, 2LBS|1|A
369NR_all_19218.1
Exact match
2NVT|1|R (2NVT)
  • 5'-R(*AP*AP*GP*AP*CP*CP*AP*GP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.4 Å10(3) 2NVT|1|R, 1Y1W|1|P, 1Y77|1|P
370NR_all_83080.1
Exact match
2QWY|1|C (2QWY)
  • SAM-II riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å52(3) 2QWY|1|C, 2QWY|1|A, 2QWY|1|B
371NR_all_58167.1
Exact match
3E5C|1|A (3E5C)
  • SMK box (SAM-III) Riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å52(3) 3E5C|1|A, 3E5F|1|A, 3E5E|1|A
372NR_all_05489.1
Exact match
Escherichia coli
3EQ3|1|A (3EQ3)
  • Fragment h18 of the 16S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
9.0 Å9(3) 3EQ3|1|A, 3EQ4|1|A, 3EP2|1|A
373NR_all_74887.1
Exact match
Escherichia coli
3EQ3|1|C (3EQ3)
  • Fragment h44 of the 16S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): C; model(s): 1
9.0 Å11(3) 3EQ3|1|C, 3EQ4|1|C, 3EP2|1|C
374NR_all_15678.1
Exact match
Escherichia coli
3EQ3|1|E (3EQ3)
  • Fragment H69 of the 23S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
9.0 Å17(3) 3EQ3|1|E, 3EP2|1|E, 3EQ4|1|E
375NR_all_68503.1
Exact match
3F4H|1|Y+3F4H|1|X (3F4H)
  • FMN riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): 6, L, O, P, X, Y; model(s): 1
3.0 Å56(3) 3F4H|1|Y+3F4H|1|X, 3F4E|1|Y+3F4E|1|X, 2YIF|1|Z+2YIF|1|X
376NR_all_81896.1
Exact match
3GLP|1|E (3GLP)
  • 5'-R(*GP*CP*UP*GP*CP*UP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.2 Å8(3) 3GLP|1|E, 3GLP|1|B+3GLP|1|A, 3GLP|1|C+3GLP|1|D
377NR_all_76789.1
Exact match
Oryctolagus cuniculus
3J0Q|1|Y (3J0Q)
  • tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): Y; model(s): 1
10.6 Å77(3) 3J0Q|1|Y, 3J0Q|1|W, 3J0P|1|W
378NR_all_49897.2
Exact match
Bacillus subtilis
3J9W|1|BB (3J9W)
  • 5S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): BB; model(s): 1
3.9 Å112(3) 3J9W|1|BB, 3J3V|1|B, 5NJT|1|V
379NR_all_07053.1
Exact match
Plasmodium falciparum
3JBN|1|A (3JBN)
  • 18S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
4.7 Å1608(3) 3JBN|1|A, 3JBP|1|A, 3JBO|1|A
380NR_all_92727.1
Exact match
3K49|1|F (3K49)
  • RNA (5'-R(*CP*CP*UP*GP*UP*AP*AP*AP*UP*A)[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.5 Å10(3) 3K49|1|F, 3K49|1|B, 3K49|1|D
381NR_all_06376.1
Exact match
3K4E|1|F (3K4E)
  • RNA (5'-R(P*CP*UP*UP*GP*UP*AP*UP*AP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.2 Å10(3) 3K4E|1|F, 3K4E|1|B, 3K4E|1|D
382NR_all_53884.1
Exact match
3O7V|1|A (3O7V)
  • RNA (5'-R(*GP*CP*GP*AP*AP*UP*AP*UP*UP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.1 Å13(3) 3O7V|1|A, 3O3I|1|A, 3O6E|1|A
383NR_all_40560.1
Exact match
3OIN|1|C (3OIN)
  • 5'-R(*GP*GP*GP*CP*UP*UP*CP*AP*AP*CP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.9 Å14(3) 3OIN|1|C, 3OIJ|1|C, 3OIJ|1|D
384NR_all_47162.1
Exact match
Bacillus subtilis
3PDR|1|A (3PDR)
  • M-box Riboswitch RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.9 Å161(3) 3PDR|1|A, 2QBZ|1|X, 3PDR|1|X
385NR_all_81724.1
Exact match
3Q0N|1|D (3Q0N)
  • 5'-R(UP*GP*UP*AP*CP*AP*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å7(3) 3Q0N|1|D, 3Q0O|1|C, 3Q0O|1|D
386NR_all_54128.1
Exact match
3Q0R|1|B (3Q0R)
  • 5'-R(UP*GP*UP*AP*GP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å8(3) 3Q0R|1|B, 3Q0M|1|C, 3Q0M|1|D
387NR_all_51472.1
Exact match
3Q1Q|1|B (3Q1Q)
  • RNase P RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.8 Å347(3) 3Q1Q|1|B, 3Q1R|1|B, 2A2E|1|A
388NR_all_89202.1
Exact match
3Q50|1|A (3Q50)
  • PREQ1 RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å33(3) 3Q50|1|A, 3Q51|1|A, 3GCA|1|A
389NR_all_68171.1
Exact match
3R1C|1|i+3R1C|1|j (3R1C)
  • RNA (5'-R(*GP*CP*GP*GP*CP*GP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): 6, L, O, P, i, j; model(s): 1
2.1 Å8(3) 3R1C|1|i+3R1C|1|j, 3R1C|1|g+3R1C|1|h, 3R1C|1|E+3R1C|1|F
390NR_all_10541.1
Exact match
3S1R|1|R (3S1R)
  • RNA (5'-R(*AP*GP*AP*GP*G*)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.2 Å5(3) 3S1R|1|R, 3RZD|1|R, 3S1Q|1|R
391NR_all_20814.1
Exact match
[Eubacterium] siraeum
3SUX|1|X (3SUX)
  • Riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.9 Å100(3) 3SUX|1|X, 3SUH|1|X, 3SUY|1|X
392NR_all_45159.1
Exact match
3SYW|1|A+3SYW|1|B (3SYW)
  • RNA (5'-R(*UP*UP*GP*GP*GP*CP*CP*UP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, A, B, L, O, P; model(s): 1
1.6 Å21(3) 3SYW|1|A+3SYW|1|B, 4YN6|1|A+4YN6|1|B, 4J50|1|A+4J50|1|B
393NR_all_66740.1
Exact match
Escherichia coli
3T5N|1|C (3T5N)
  • RNA (5'-R(P*UP*AP*UP*CP*UP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.8 Å6(3) 3T5N|1|C, 3T5Q|1|H, 3T5Q|1|L
394NR_all_18396.1
Exact match
synthetic construct
3ZC0|1|O (3ZC0)
  • 5'-R(*UP*UP*CP*GP*AP*CP*GP*CP*GP*UP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): O; model(s): 1
3.0 Å28(3) 3ZC0|1|O, 3ZC0|1|M, 3ZC0|1|N
395NR_all_57688.1
Exact match
409D|1|E+409D|1|F (409D)
  • RNA (5'-R(*CP*CP*CP*IP*UP*GP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): 6, E, F, L, O, P; model(s): 1
2.5 Å7(3) 409D|1|E+409D|1|F, 409D|1|A+409D|1|B, 409D|1|C+409D|1|D
396NR_all_37735.1
Exact match
437D|1|A (437D)
  • RNA PSEUDOKNOT
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.6 Å32(3) 437D|1|A, 1L3D|1|A, 1L2X|1|A
397NR_all_82856.2
Exact match
Saccharomyces cerevisiae
4A3D|1|P (4A3D)
  • TRANSCRIPT RNA 5'-R(*CP*CP*AP*GP*GP*AP)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.4 Å6(3) 4A3D|1|P, 4V1M|1|P, 4A3F|1|P
398NR_all_20180.1
Exact match
Saccharomyces cerevisiae
4BBS|1|P (4BBS)
  • 5'-R(*AP*UP*AP*UP*CP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.6 Å6(3) 4BBS|1|P, 4V1N|1|P, 4V1O|1|P
399NR_all_39555.1
Exact match
4DB2|1|I+4DB2|1|J (4DB2)
  • 5'-R(*GP*GP*GP*CP*GP*GP*GP*CP*CP*CP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, I, J, L, O, P; model(s): 1
3.2 Å14(3) 4DB2|1|I+4DB2|1|J, 4DB2|1|E+4DB2|1|F, 4DB2|1|H+4DB2|1|G
400NR_all_02622.1
Exact match
4GHA|1|I+4GHA|1|J (4GHA)
  • RNA (5'-R(*CP*UP*AP*GP*AP*CP*GP*UP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, I, J, L, O, P; model(s): 1
2.5 Å12(3) 4GHA|1|I+4GHA|1|J, 4LG2|1|I+4LG2|1|J, 4LG2|1|E+4LG2|1|F
401NR_all_85566.1
Exact match
4GV3|1|C+4GV3|1|B (4GV3)
  • RNA (5'-R(P*CP*GP*CP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): 6, B, C, L, O, P; model(s): 1
1.7 Å4(3) 4GV3|1|C+4GV3|1|B, 4GV9|1|F+4GV9|1|E, 4GV6|1|C+4GV6|1|B
402NR_all_73115.1
Exact match
Homo sapiens
4HT9|1|D (4HT9)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.8 Å7(3) 4HT9|1|D, 4HT8|1|I, 4HT8|1|K
403NR_all_88706.1
Exact match
synthetic construct
4JAH|1|E+4JAH|1|F (4JAH)
  • RNA (5'-R(*GP*UP*GP*UP*AP*(RUS)P*AP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, E, F, L, O, P; model(s): 1
1.5 Å7(3) 4JAH|1|E+4JAH|1|F, 4JAH|1|A+4JAH|1|B, 4JAH|1|C+4JAH|1|D
404NR_all_25361.2
Exact match
4JNX|1|B+4JNX|1|G (4JNX)
  • 5'-R(P*GP*CP*UP*GP*CP*UP*GP*CP*UP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, B, G, L, O, P; model(s): 1
2.0 Å39(3) 4JNX|1|B+4JNX|1|G, 4E48|1|A+4E48|1|B, 4E48|1|D
405NR_all_09443.2
Exact match
4K4S|1|B+4K4S|1|F+4K4S|1|C+4K4S|1|G+4K4S|1|D+4K4S|1|H (4K4S)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H; model(s): 1
2.4 Å17(3) 4K4S|1|B+4K4S|1|F+4K4S|1|C+4K4S|1|G+4K4S|1|D+4K4S|1|H, 4K4T|1|B+4K4T|1|C+4K4T|1|D, 4K4T|1|F+4K4T|1|G+4K4T|1|H
406NR_all_48777.1
Exact match
4NKU|1|H (4NKU)
  • 5'-R(*AP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
1.9 Å2(3) 4NKU|1|H, 4NKU|1|D, 1CWP|1|E
407NR_all_50478.2
Exact match
4OHY|1|B (4OHY)
  • RNA (5'-R(*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å2(3) 4OHY|1|B, 4OI1|1|B, 4OI0|1|B
408NR_all_33558.1
Exact match
Endothia gyrosa
4PCO|1|E (4PCO)
  • RNA (5'-D(*GP*GP*UP*GP*GP*CP*UP*GP*UP*U)[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.3 Å16(3) 4PCO|1|E, 4PCO|1|A+4PCO|1|B, 4PCO|1|C+4PCO|1|D
409NR_all_37008.1
Exact match
Homo sapiens
4PLX|1|A (4PLX)
  • Core ENE hairpin and A-rich tract from M[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å74(3) 4PLX|1|A, 4PLX|1|B, 4PLX|1|C
410NR_all_05707.1
Exact match
4QJH|1|F (4QJH)
  • Twister Ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.9 Å47(3) 4QJH|1|F, 4QJH|1|B, 4QJH|1|D
411NR_all_22602.1
Exact match
synthetic construct
4QU7|1|X (4QU7)
  • RNA 5'-(*AP*GP*GP*GP*AP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.5 Å3(3) 4QU7|1|X, 4QU7|1|V, 4QU7|1|U
412NR_all_33922.2
Exact match
4R4V|1|A (4R4V)
  • VS ribozyme RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å185(3) 4R4V|1|A, 5V3I|1|A, 4R4P|1|A
413NR_all_53105.1
Exact match
Pyrococcus horikoshii
4UYK|1|R (4UYK)
  • SRP RNA
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.2 Å133(3) 4UYK|1|R, 4UYJ|1|S, 4UYJ|1|R
414NR_all_06715.2
Exact match
Sus scrofa
4V19|1|A (4V19)
  • MITORIBOSOMAL 16S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.4 Å1515(3) 4V19|1|A, 5AJ4|1|BA, 4CE4|1|A
415NR_all_15400.1
Exact match
Escherichia coli
4V4A|1|AA (4V4A)
  • 16S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): AA; model(s): 1
9.5 Å1533(3) 4V4A|1|AA, 4V49|1|AA, 1ML5|1|A
416NR_all_02491.1
Exact match
4V6E|1|CX (4V6E)
  • P-site tRNA ASL fragment
  • X-RAY DIFFRACTION
  • Chain(s): CX; model(s): 1
3.7 Å17(3) 4V6E|1|CX, 4V6E|1|AX, 4V6E|1|CV
417NR_all_27096.1
Exact match
Bacillus subtilis
4WFL|1|A (4WFL)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.5 Å105(3) 4WFL|1|A, 4WFM|1|B, 4WFM|1|A
418NR_all_50058.1
Exact match
synthetic construct
4WTF|1|T+4WTF|1|P (4WTF)
  • RNA PRIMER TEMPLATE CAAAAUUU
  • X-RAY DIFFRACTION
  • Chain(s): C, D, G, H, P, T; model(s): 1
2.7 Å8(3) 4WTF|1|T+4WTF|1|P, 4WTA|1|T+4WTA|1|P, 4WTG|1|T+4WTG|1|P
419NR_all_81926.1
Exact match
synthetic construct
4YLP|1|9 (4YLP)
  • RNA (5'-R(*(GTP))-R(P*AP*GP*UP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): 9; model(s): 1
5.5 Å4(3) 4YLP|1|9, 4YLP|1|3, 4YLP|1|6
420NR_all_14903.1
Exact match
Methanococcus maripaludis
4Z7L|1|I (4Z7L)
  • RNA (5'-R(*GP*CP*AP*AP*AP*AP*UP*AP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
3.5 Å14(3) 4Z7L|1|I, 4Z7L|1|C, 4Z7L|1|F
421NR_all_15716.1
Exact match
Dictyostelium discoideum
5AN9|1|N (5AN9)
  • 26S RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): N; model(s): 1
3.3 Å1162(3) 5AN9|1|N, 5ANB|1|N, 5ANC|1|N
422NR_all_25771.1
Exact match
Escherichia coli
5D0A|1|F (5D0A)
  • RNA (5'-R(*G*CP*AP*GP*AP*CP*UP*GP*UP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.1 Å14(3) 5D0A|1|F, 5D0A|1|E, 5T8Y|1|X
423NR_all_34346.1
Exact match
synthetic construct
5D8T|1|A+5D8T|1|B (5D8T)
  • RNA oligonucleotide containing (S)-C5'-M[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, G, H; model(s): 1
1.2 Å6(3) 5D8T|1|A+5D8T|1|B, 5DER|1|A+5DER|1|B, 5DER|1|C+5DER|1|D
424NR_all_70098.1
Exact match
synthetic construct
5DEA|1|A (5DEA)
  • sc1
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å35(3) 5DEA|1|A, 5DE8|1|A, 5DE5|1|A
425NR_all_02963.1
Exact match
synthetic construct
5DEA|1|C (5DEA)
  • sc1
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å35(3) 5DEA|1|C, 5DE8|1|C, 5DE5|1|C
426NR_all_84026.1
Exact match
synthetic construct
5DHB|1|C+5DHB|1|D (5DHB)
  • RNA (5'-R(*(LCC)P*(TLN)P*(LCG)P*UP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, G, H; model(s): 1
1.8 Å4(3) 5DHB|1|C+5DHB|1|D, 5DHB|1|A+5DHB|1|B, 5HBW|1|A+5HBW|1|B
427NR_all_54107.1
Exact match
Saccharomyces cerevisiae
5ED1|1|C+5ED1|1|B (5ED1)
  • RNA (5'-R(*GP*AP*CP*UP*GP*AP*AP*CP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, G, H; model(s): 1
2.8 Å23(3) 5ED1|1|C+5ED1|1|B, 5HP3|1|C+5HP3|1|B, 5HP2|1|C+5HP2|1|B
428NR_all_16758.1
Exact match
Mus musculus
5F5F|1|H (5F5F)
  • RNA (5'-R(P*UP*GP*AP*CP*UP*GP*CP*GP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.0 Å20(3) 5F5F|1|H, 5F5F|1|B, 5F5F|1|D
429NR_all_17122.2
Exact match
synthetic construct
5FLM|1|P (5FLM)
  • RNA, DNA-RNA ELONGATION SCAFFOLD
  • ELECTRON MICROSCOPY
  • Chain(s): P; model(s): 1
3.4 Å14(3) 5FLM|1|P, 5M5X|1|R, 5M3F|1|R
430NR_all_07902.2
Exact match
Saccharomyces cerevisiae
5GAN|1|V+5GAN|1|W (5GAN)
  • Saccharomyces cerevisiae strain UOA_M2 c[...]
  • ELECTRON MICROSCOPY
  • Chain(s): C, D, G, H, V, W; model(s): 1
3.7 Å124(3) 5GAN|1|V+5GAN|1|W, 3JCM|1|E, 5GAO|1|V
431NR_all_63960.2
Exact match
Saccharomyces cerevisiae
5JCS|1|y (5JCS)
  • 5.8S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): y; model(s): 1
9.5 Å158(3) 5JCS|1|y, 5FL8|1|y, 4V7F|1|2
432NR_all_83636.1
Exact match
Escherichia coli
5LZC|1|x (5LZC)
  • SECIS mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): x; model(s): 1
4.8 Å48(3) 5LZC|1|x, 5LZD|1|x, 5LZB|1|x
433NR_all_67193.1
Exact match
Saccharomyces cerevisiae
5MRC|1|aa (5MRC)
  • 15S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): aa; model(s): 1
3.3 Å1501(3) 5MRC|1|aa, 5MRF|1|aa, 5MRE|1|aa
434NR_all_25652.1
Exact match
Saccharomyces cerevisiae
5MRC|1|bb (5MRC)
  • tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): bb; model(s): 1
3.3 Å76(3) 5MRC|1|bb, 5MRF|1|bb, 5MRE|1|bb
435NR_all_92635.1
Exact match
synthetic construct
5SUP|1|F (5SUP)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.6 Å6(3) 5SUP|1|F, 5SUP|1|D, 5SUP|1|E
436NR_all_60469.1
Exact match
Saccharomyces cerevisiae
5TF6|1|B (5TF6)
  • U6 snRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å71(3) 5TF6|1|B, 4N0T|1|B, 5TF6|1|D
437NR_all_97573.1
Exact match
synthetic construct
5W0M|1|J (5W0M)
  • U5 single-stranded RNA
  • X-RAY DIFFRACTION
  • Chain(s): J; model(s): 1
2.3 Å4(3) 5W0M|1|J, 5W0M|1|H, 5W0M|1|I
438NR_all_74407.1
Exact match
Acidaminococcus sp. BV3L6
5XH7|1|B (5XH7)
  • crRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å40(3) 5XH7|1|B, 5B43|1|B, 5XH6|1|B
439NR_all_99853.1
Exact match
Escherichia virus T7
6ALG|1|R (6ALG)
  • RNA (5'-R(P*CP*GP*GP*AP*GP*AP*GP*GP*UP*A[...]
  • ELECTRON MICROSCOPY
  • Chain(s): R; model(s): 1
3.7 Å10(3) 6ALG|1|R, 6ALF|1|R, 6ALH|1|R
440NR_all_89332.1
Exact match
Homo sapiens
1A9N|1|R (1A9N)
  • RNA (5'-R(*CP*CP*UP*GP*GP*UP*AP*UP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.4 Å24(2) 1A9N|1|R, 1A9N|1|Q
441NR_all_16304.1
Exact match
1BZ3|1|A (1BZ3)
  • TRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
17(2) 1BZ3|1|A, 1BZT|1|A
442NR_all_56732.1
Exact match
Escherichia coli
1CQL|10|A (1CQL)
  • SRP DOMAIN IV RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 10
43(2) 1CQL|10|A, 1CQ5|1|A
443NR_all_68428.1
Exact match
1D4R|1|C (1D4R)
  • 29-MER OF MODIFIED SRP RNA HELIX 6
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.0 Å28(2) 1D4R|1|C, 1D4R|1|B+1D4R|1|A
444NR_all_43622.1
Exact match
Homo sapiens
1E7K|1|D (1E7K)
  • RNA (5'-R(*GP*CP*CP*AP*AP*UP*GP*AP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.9 Å17(2) 1E7K|1|D, 1E7K|1|C
445NR_all_76196.1
Exact match
Homo sapiens
1E8O|1|E (1E8O)
  • 7SL RNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.2 Å49(2) 1E8O|1|E, 1RY1|1|E
446NR_all_62068.1
Exact match
1EGK|1|C (1EGK)
  • RNA (5'-R(*AP*GP*GP*AP*GP*AP*GP*AP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.1 Å20(2) 1EGK|1|C, 1EGK|1|A
447NR_all_31750.1
Exact match
1F5U|1|B (1F5U)
  • RNA (5'-R(*GP*GP*UP*GP*GP*GP*AP*GP*AP*CP[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
18(2) 1F5U|1|B, 1F5U|1|A
448NR_all_82534.1
Exact match
1F7V|1|B (1F7V)
  • TRNA(ARG)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å60(2) 1F7V|1|B, 1F7U|1|B
449NR_all_99953.1
Exact match
1FEU|1|F+1FEU|1|E (1FEU)
  • 21 NT FRAGMENT OF 5S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, G, H; model(s): 1
2.3 Å21(2) 1FEU|1|F+1FEU|1|E, 1FEU|1|C+1FEU|1|B
450NR_all_14518.1
Exact match
1FUF|1|A+1FUF|1|B (1FUF)
  • (5'-R(*GP*GP*UP*AP*UP*UP*UP*CP*GP*GP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, G, H; model(s): 1
1.7 Å13(2) 1FUF|1|A+1FUF|1|B, 1IK5|1|A+1IK5|1|B
451NR_all_04218.1
Exact match
1FYO|1|A (1FYO)
  • FRAGMENT OF 18S RIBOSOMAL RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(2) 1FYO|1|A, 2M4Q|6|1
452NR_all_26284.1
Exact match
Thermus thermophilus
1H4S|1|T (1H4S)
  • TRNAPRO(CGG)
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.9 Å65(2) 1H4S|1|T, 1H4Q|1|T
453NR_all_55907.2
Exact match
1HMH|1|E (1HMH)
  • HAMMERHEAD RIBOZYME-RNA STRAND
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.6 Å34(2) 1HMH|1|E, 1HMH|1|C
454NR_all_49782.1
Exact match
1I6U|1|C (1I6U)
  • 16S RRNA FRAGMENT
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.6 Å37(2) 1I6U|1|C, 1I6U|1|D
455NR_all_52282.1
Exact match
1J2B|1|C (1J2B)
  • tRNA(Val)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.3 Å77(2) 1J2B|1|C, 1J2B|1|D
456NR_all_41566.1
Exact match
1J8G|1|B (1J8G)
  • 5'-R(*UP*GP*GP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
0.6 Å6(2) 1J8G|1|B, 4RKV|1|B
457NR_all_16983.1
Exact match
1J9H|1|C+1J9H|1|D (1J9H)
  • 5'-R(*GP*UP*GP*UP*CP*GP*(CBR)P*AP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C, D, G, H; model(s): 1
1.4 Å8(2) 1J9H|1|C+1J9H|1|D, 1J9H|1|A+1J9H|1|B
458NR_all_26264.1
Exact match
1JID|1|B (1JID)
  • HELIX 6 OF HUMAN SRP RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å26(2) 1JID|1|B, 1L1W|1|A
459NR_all_39439.2
Exact match
1JWC|1|A (1JWC)
  • 5'-R(*GP*GP*CP*CP*AP*AP*AP*GP*GP*CP*CP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(2) 1JWC|1|A, 1JU7|1|A
460NR_all_19241.1
Exact match
1JZV|1|D+1JZV|1|C (1JZV)
  • 5'-R(*CP*AP*GP*UP*AP*CP*GP*(5IC)P*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C, D, G, H; model(s): 1
1.7 Å8(2) 1JZV|1|D+1JZV|1|C, 1JZV|1|B+1JZV|1|A
461NR_all_03986.1
Exact match
1KD5|1|A+1KD5|1|B (1KD5)
  • 5'-R(*GP*GP*UP*CP*AP*CP*AP*GP*CP*CP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, G, H; model(s): 1
1.6 Å11(2) 1KD5|1|A+1KD5|1|B, 1KD3|1|A+1KD3|1|B
462NR_all_92049.1
Exact match
1KPZ|1|A (1KPZ)
  • P1-P2 frameshifting pseudoknot
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(2) 1KPZ|1|A, 1KPY|3|A
463NR_all_54586.1
Exact match
1L3Z|1|B (1L3Z)
  • 5'-R(*GP*UP*AP*UP*AP*CP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å7(2) 1L3Z|1|B, 1L3Z|1|A
464NR_all_81068.1
Exact match
1M8X|1|C (1M8X)
  • 5'-R(P*UP*UP*GP*UP*AP*UP*AP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.2 Å8(2) 1M8X|1|C, 1M8W|1|C
465NR_all_48641.1
Exact match
1M8X|1|D (1M8X)
  • 5'-R(P*UP*GP*UP*AP*UP*AP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.2 Å7(2) 1M8X|1|D, 1M8W|1|D
466NR_all_81175.1
Exact match
1M8Y|1|D (1M8Y)
  • 5'-R(P*AP*UP*UP*GP*UP*AP*CP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.6 Å10(2) 1M8Y|1|D, 1M8Y|1|C
467NR_all_62367.1
Exact match
Escherichia coli
1MJI|1|C (1MJI)
  • 5S rRNA fragment
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.5 Å34(2) 1MJI|1|C, 1MJI|1|D
468NR_all_46884.1
Exact match
1MZP|1|B (1MZP)
  • fragment of 23S rRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å55(2) 1MZP|1|B, 2NOQ|1|E
469NR_all_20339.1
Exact match
Bacillus subtilis
1NBS|1|B (1NBS)
  • RIBONUCLEASE P RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.2 Å150(2) 1NBS|1|B, 1NBS|1|A
470NR_all_85104.1
Exact match
1NJP|1|5 (1NJP)
  • tRNA acceptor stem mimic
  • X-RAY DIFFRACTION
  • Chain(s): 5; model(s): 1
3.5 Å24(2) 1NJP|1|5, 1NJM|1|5
471NR_all_74199.1
Exact match
1NTB|1|A+1NTB|1|B (1NTB)
  • 5'-R(*GP*GP*AP*UP*CP*GP*CP*AP*UP*UP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, G, H; model(s): 1
2.9 Å22(2) 1NTB|1|A+1NTB|1|B, 1NTA|1|A+1NTA|1|B
472NR_all_12262.1
Exact match
1NZ1|1|A (1NZ1)
  • SP U6 Intramolecular Stem-Loop RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(2) 1NZ1|1|A, 1SYZ|2|A
473NR_all_97287.1
Exact match
1O15|1|A (1O15)
  • THEOPHYLLINE-BINDING RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
33(2) 1O15|1|A, 1EHT|3|A
474NR_all_55924.2
Exact match
1OOA|1|D (1OOA)
  • RNA aptamer
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.5 Å29(2) 1OOA|1|D, 1OOA|1|C
475NR_all_72919.2
Exact match
1P5P|1|A (1P5P)
  • 77-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
77(2) 1P5P|1|A, 1P5O|2|A
476NR_all_47370.1
Exact match
1P6V|1|B (1P6V)
  • 45-MER
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.2 Å45(2) 1P6V|1|B, 1P6V|1|D
477NR_all_14229.3
Exact match
1PBM|1|A+1PBM|1|B (1PBM)
  • RNA (5'-R(*CP*GP*CP*GP*CP*G)-3')
  • SOLUTION NMR
  • Chain(s): A, B, C, D, G, H; model(s): 1
6(2) 1PBM|1|A+1PBM|1|B, 1G3A|1|A+1G3A|1|B
478NR_all_54907.1
Exact match
1PBR|1|A (1PBR)
  • 16S RIBOSOMAL RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(2) 1PBR|1|A, 1BYJ|31|A
479NR_all_31133.1
Exact match
1QFQ|1|A (1QFQ)
  • 15-mer nutRboxB RNA hairpin
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(2) 1QFQ|1|A, 1HJI|1|A
480NR_all_80055.1
Exact match
1RLG|1|D (1RLG)
  • 25-MER
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.7 Å22(2) 1RLG|1|D, 1RLG|1|C
481NR_all_81475.1
Exact match
1SDR|1|C+1SDR|1|D (1SDR)
  • RNA (5'-R(*UP*AP*AP*GP*GP*AP*GP*GP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, G, H; model(s): 1
2.6 Å12(2) 1SDR|1|C+1SDR|1|D, 1SDR|1|A+1SDR|1|B
482NR_all_67819.1
Exact match
Caenorhabditis elegans
1SLP|1|A (1SLP)
  • RNA (5'-R(*UP*UP*AP*CP*CP*CP*AP*AP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
19(2) 1SLP|1|A, 1SLO|1|A
483NR_all_65598.1
Exact match
1TFW|1|I+1TFW|1|F (1TFW)
  • 5'-R(*GP*CP*GP*GP*AP*UP*CP*CP*GP*CP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, G, H, I; model(s): 1
2.2 Å13(2) 1TFW|1|I+1TFW|1|F, 1TFW|1|H+1TFW|1|E
484NR_all_03202.1
Exact match
1TFY|1|I+1TFY|1|F (1TFY)
  • 5'-R(*GP*CP*GP*GP*AP*UP*AP*UP*CP*CP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, G, H, I; model(s): 1
3.2 Å14(2) 1TFY|1|I+1TFY|1|F, 1TFY|1|H+1TFY|1|E
485NR_all_13485.1
Exact match
1U1Y|1|R (1U1Y)
  • 5'-R(*CP*CP*GP*GP*(2PR)P*GP*GP*AP*UP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.9 Å16(2) 1U1Y|1|R, 1U1Y|1|S
486NR_all_20405.1
Exact match
Saccharomyces cerevisiae
1U2A|1|A (1U2A)
  • RNA (5'-R(P*GP*GP*UP*CP*AP*GP*UP*GP*UP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
20(2) 1U2A|1|A, 2U2A|1|A
487NR_all_23978.1
Exact match
1U63|1|D (1U63)
  • 49 NT FRAGMENT OF MRNA FOR L1
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.4 Å49(2) 1U63|1|D, 1U63|1|B
488NR_all_75381.1
Exact match
Xenopus laevis
1UN6|1|F (1UN6)
  • 5S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.1 Å61(2) 1UN6|1|F, 1UN6|1|E
489NR_all_22775.2
Exact match
1URN|1|Q (1URN)
  • RNA (5'-R(*AP*AP*UP*CP*CP*AP*UP*UP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
1.9 Å21(2) 1URN|1|Q, 1URN|1|R
490NR_all_19039.1
Exact match
1WPU|1|D (1WPU)
  • 5'-R(*UP*UP*GP*AP*GP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.5 Å7(2) 1WPU|1|D, 1WPU|1|C
491NR_all_65718.1
Exact match
1WTT|1|A (1WTT)
  • RNA (5'-R(*GP*GP*AP*CP*CP*2MGP*GP*MA6P*M[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
11(2) 1WTT|1|A, 1WTS|1|A
492NR_all_52143.1
Exact match
1XST|1|A (1XST)
  • RNA (27-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(2) 1XST|1|A, 1XSG|1|A
493NR_all_86751.1
Exact match
1YLG|13|A (1YLG)
  • apolipoprotein B mRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 13
31(2) 1YLG|13|A, 1YNE|4|A
494NR_all_38606.3
Exact match
1YN2|1|A (1YN2)
  • VS RIBOZYME STEM-LOOP V
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
17(2) 1YN2|1|A, 1YN1|1|A
495NR_all_45851.1
Exact match
1YTU|1|E+1YTU|1|F (1YTU)
  • 5'-R(P*AP*GP*AP*CP*AP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, G, H; model(s): 1
2.5 Å6(2) 1YTU|1|E+1YTU|1|F, 1YTU|1|C+1YTU|1|D
496NR_all_65678.1
Exact match
1YVP|1|E+1YVP|1|F (1YVP)
  • Y RNA sequence, first strand
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, G, H; model(s): 1
2.2 Å9(2) 1YVP|1|E+1YVP|1|F, 1YVP|1|C+1YVP|1|D
497NR_all_74336.1
Exact match
1ZBH|1|F (1ZBH)
  • 5'-R(*CP*CP*GP*GP*CP*UP*CP*UP*UP*UP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.0 Å16(2) 1ZBH|1|F, 1ZBH|1|E
498NR_all_93523.1
Exact match
1ZBI|1|C (1ZBI)
  • 5'-R(*GP*AP*CP*AP*CP*CP*UP*GP*AP*UP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.9 Å12(2) 1ZBI|1|C, 1ZBL|1|C
499NR_all_53827.1
Exact match
1ZDJ|1|S (1ZDJ)
  • RNA (5'-R(*GP*GP*AP*UP*CP*AP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): S; model(s): 1
2.9 Å8(2) 1ZDJ|1|S, 1ZDJ|1|R
500NR_all_72030.1
Exact match
1ZH5|1|C+1ZH5|1|D (1ZH5)
  • 5'-R(*UP*GP*CP*UP*GP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C, D, G, H; model(s): 1
1.9 Å9(2) 1ZH5|1|C+1ZH5|1|D, 1YTY|1|C+1YTY|1|D
501NR_all_13754.1
Exact match
Escherichia coli
1ZN1|1|C (1ZN1)
  • ribosomal 16S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): C; model(s): 1
14.1 Å40(2) 1ZN1|1|C, 1ZN0|1|C
502NR_all_87784.1
Exact match
1ZX7|1|C+1ZX7|1|E+1ZX7|1|D+1ZX7|1|F (1ZX7)
  • 5'-R(*GP*UP*GP*GP*UP*GP*AP*AP*GP*UP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, H; model(s): 1
2.2 Å15(2) 1ZX7|1|C+1ZX7|1|E+1ZX7|1|D+1ZX7|1|F, 1ZX7|1|A+1ZX7|1|G+1ZX7|1|B+1ZX7|1|H
503NR_all_49362.3
Exact match
280D|1|C+280D|1|D (280D)
  • RNA (5'-R(*GP*GP*CP*GP*CP*UP*UP*GP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, H; model(s): 1
2.4 Å12(2) 280D|1|C+280D|1|D, 280D|1|A+280D|1|B
504NR_all_37650.1
Exact match
Escherichia coli
28SR|1|A (28SR)
  • SRP DOMAIN IV
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
28(2) 28SR|1|A, 28SP|1|A
505NR_all_33604.1
Exact match
2A04|1|A+2A04|1|C+2A04|1|B+2A04|1|D (2A04)
  • 5'-R(*GP*UP*GP*GP*UP*GP*AP*AP*GP*UP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, H; model(s): 1
3.0 Å15(2) 2A04|1|A+2A04|1|C+2A04|1|B+2A04|1|D, 1ZZ5|1|A+1ZZ5|1|C+1ZZ5|1|B+1ZZ5|1|D
506NR_all_73018.1
Exact match
2A8V|1|E (2A8V)
  • 5'-R(P*CP*CP*CP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.4 Å6(2) 2A8V|1|E, 4UFT|1|R
507NR_all_01611.2
Exact match
2A9L|1|A (2A9L)
  • ABISS7 RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
38(2) 2A9L|1|A, 1A9L|1|A
508NR_all_52699.1
Exact match
Bos taurus
2AKE|1|B (2AKE)
  • transfer RNA-Trp
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.1 Å72(2) 2AKE|1|B, 2DR2|1|B
509NR_all_36231.1
Exact match
2ANR|1|B (2ANR)
  • 5'-R(*CP*(5BU)P*CP*GP*CP*GP*GP*AP*UP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å24(2) 2ANR|1|B, 2ANN|1|B
510NR_all_53890.1
Exact match
2AO5|1|C+2AO5|1|D (2AO5)
  • 5'-R(*GP*GP*CP*GP*(5BU)P*GP*CP*GP*CP*U)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, H; model(s): 1
2.1 Å9(2) 2AO5|1|C+2AO5|1|D, 2AO5|1|A+2AO5|1|B
511NR_all_28532.1
Exact match
2ATW|1|D (2ATW)
  • ribosomal RNA (5'- AGAACUCAAUAG -3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.3 Å12(2) 2ATW|1|D, 2ATW|1|B
512NR_all_93219.1
Exact match
2AZ2|1|C+2AZ2|1|D (2AZ2)
  • 5'-R(*GP*CP*AP*(5BU)P*GP*GP*AP*CP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, H; model(s): 1
2.6 Å15(2) 2AZ2|1|C+2AZ2|1|D, 2AZ0|1|C+2AZ0|1|D
513NR_all_98033.1
Exact match
2AZX|1|C (2AZX)
  • 72-MER
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å72(2) 2AZX|1|C, 2AZX|1|D
514NR_all_57734.1
Exact match
2BGG|1|R+2BGG|1|S (2BGG)
  • 5'-R(*UP*UP*CP*GP*AP*CP*GP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, D, H, R, S; model(s): 1
2.2 Å8(2) 2BGG|1|R+2BGG|1|S, 2BGG|1|P+2BGG|1|Q
515NR_all_03525.1
Exact match
Escherichia coli
2BH2|1|D (2BH2)
  • 23S RIBOSOMAL RNA 1932-1968
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.2 Å29(2) 2BH2|1|D, 2BH2|1|C
516NR_all_62398.1
Exact match
2BJ2|1|A+2BJ2|1|B (2BJ2)
  • RNA (5'-R(*GP*GP*CP*AP*AP*CP*GP*GP*AP*UP[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, H; model(s): 1
21(2) 2BJ2|1|A+2BJ2|1|B, 1BJ2|1|A+1BJ2|1|B
517NR_all_57492.2
Exact match
2D1B|1|A (2D1B)
  • RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
39(2) 2D1B|1|A, 2D1B|1|B
518NR_all_62940.1
Exact match
2D6F|1|F (2D6F)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.2 Å74(2) 2D6F|1|F, 2D6F|1|E
519NR_all_33416.1
Exact match
2DD1|1|A+2DD1|1|B (2DD1)
  • 5'-R(*GP*GP*UP*GP*GP*AP*GP*GP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): A, B, D, H; model(s): 1
10(2) 2DD1|1|A+2DD1|1|B, 1XV0|1|A+1XV0|1|B
520NR_all_53841.1
Exact match
2E9T|1|E+2E9T|1|F (2E9T)
  • 5'-R(P*UP*AP*GP*GP*GP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, H; model(s): 1
2.6 Å8(2) 2E9T|1|E+2E9T|1|F, 2E9T|1|B+2E9T|1|C
521NR_all_16755.1
Exact match
2EC0|1|E+2EC0|1|F (2EC0)
  • 5'-R(P*AP*UP*GP*GP*GP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, H; model(s): 1
2.8 Å8(2) 2EC0|1|E+2EC0|1|F, 2EC0|1|B+2EC0|1|C
522NR_all_82951.1
Exact match
2F4S|1|A+2F4S|1|B (2F4S)
  • 5'-R(P*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
2.8 Å21(2) 2F4S|1|A+2F4S|1|B, 2O3X|1|A+2O3X|1|B
523NR_all_31791.1
Exact match
2FZ2|1|D (2FZ2)
  • 5'-R(*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.9 Å3(2) 2FZ2|1|D, 2XPJ|1|D
524NR_all_82905.1
Exact match
2GIP|1|A (2GIP)
  • 28-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
28(2) 2GIP|1|A, 2GIO|1|A
525NR_all_54661.1
Exact match
2GJW|1|I+2GJW|1|J+2GJW|1|L (2GJW)
  • 5'-R(*GP*CP*GP*AP*CP*CP*GP*AP*CP*CP*AP*([...]
  • X-RAY DIFFRACTION
  • Chain(s): D, H, I, J, L; model(s): 1
2.9 Å18(2) 2GJW|1|I+2GJW|1|J+2GJW|1|L, 2GJW|1|E+2GJW|1|F+2GJW|1|H
526NR_all_19413.1
Exact match
2I91|1|F+2I91|1|E (2I91)
  • 5'-R(*C*GP*GP*UP*AP*GP*GP*CP*UP*UP*UP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, H, L; model(s): 1
2.7 Å15(2) 2I91|1|F+2I91|1|E, 2I91|1|D+2I91|1|C
527NR_all_47156.1
Exact match
2IL9|1|M (2IL9)
  • Ribosomal Binding Domain of the IRES RNA
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
3.1 Å132(2) 2IL9|1|M, 2IL9|1|A
528NR_all_75028.1
Exact match
Enterobacteria phage MS2
2IZN|1|R (2IZN)
  • 5'-R(*AP*CP*AP*UP*CP*GP*CP*GP*AP*UP *UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.6 Å15(2) 2IZN|1|R, 2IZN|1|S
529NR_all_67479.1
Exact match
Canis sp.
2J37|1|A (2J37)
  • SRP RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
8.7 Å128(2) 2J37|1|A, 2GO5|1|A
530NR_all_59755.1
Exact match
2JLW|1|D (2JLW)
  • 5'-R(*UP*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.6 Å7(2) 2JLW|1|D, 2JLW|1|C
531NR_all_61682.1
Exact match
2JPP|1|D (2JPP)
  • RNA (5'-R(*GP*GP*GP*CP*UP*UP*CP*AP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): D; model(s): 1
20(2) 2JPP|1|D, 2JPP|1|C
532NR_all_37036.1
Exact match
2JYF|3|B (2JYF)
  • RNA (43-MER)
  • SOLUTION NMR
  • Chain(s): B; model(s): 3
43(2) 2JYF|3|B, 2JYF|3|A
533NR_all_15427.1
Exact match
2KBP|1|B (2KBP)
  • 5'-R(*UP*AP*GP*GP*GP*UP*UP*AP*GP*GP*GP*U[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
12(2) 2KBP|1|B, 2KBP|1|A
534NR_all_34197.1
Exact match
2KF0|2|A (2KF0)
  • RNA (5'-R(*GP*GP*UP*UP*CP*CP*CP*CP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
24(2) 2KF0|2|A, 2KEZ|1|A
535NR_all_50577.3
Exact match
2KP4|1|B (2KP4)
  • RNA (5'-R(*CP*CP*AP*UP*UP*AP*UP*AP*GP*C)[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
10(2) 2KP4|1|B, 2KP3|1|B
536NR_all_33831.1
Exact match
Murine leukemia virus
2L1F|1|B (2L1F)
  • RNA (66-MER)
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
66(2) 2L1F|1|B, 2L1F|1|A
537NR_all_29695.1
Exact match
2LDZ|1|A (2LDZ)
  • LEAD-DEPENDENT RIBOZYME
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
30(2) 2LDZ|1|A, 1LDZ|3|A
538NR_all_46548.1
Exact match
2LV0|1|A (2LV0)
  • RNA (5'-R(*GP*GP*GP*CP*UP*AP*AP*UP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
24(2) 2LV0|1|A, 2GBH|1|A
539NR_all_35756.1
Exact match
2MFC|1|D (2MFC)
  • SL1(RsmZ) RNA
  • SOLUTION NMR
  • Chain(s): D; model(s): 1
22(2) 2MFC|1|D, 2MFC|1|B
540NR_all_40658.1
Exact match
2MFF|5|D (2MFF)
  • SL3(RsmZ) RNA
  • SOLUTION NMR
  • Chain(s): D; model(s): 5
21(2) 2MFF|5|D, 2MFF|5|B
541NR_all_89470.1
Exact match
2MIS|1|A (2MIS)
  • VS Ribozyme
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
26(2) 2MIS|1|A, 2L5Z|1|A
542NR_all_25676.1
Exact match
synthetic construct
2NCR|1|A+2NCR|1|S (2NCR)
  • RNA_(5'-R(P*CP*CP*GP*CP*GP*GP*CP*GP*G)-3[...]
  • SOLUTION NMR
  • Chain(s): A, D, H, L, S; model(s): 1
9(2) 2NCR|1|A+2NCR|1|S, 2NCQ|1|A+2NCQ|1|S
543NR_all_89156.1
Exact match
Saccharomyces cerevisiae
2NOQ|1|B (2NOQ)
  • 18S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
7.3 Å46(2) 2NOQ|1|B, 2R1G|1|B
544NR_all_75945.1
Exact match
2OE8|1|B+2OE8|1|A (2OE8)
  • RNA (5'-R(*CP*GP*GP*UP*AP*CP*UP*AP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H, L; model(s): 1
1.8 Å17(2) 2OE8|1|B+2OE8|1|A, 2OE6|1|B+2OE6|1|A
545NR_all_22747.1
Exact match
2OZB|1|C (2OZB)
  • RNA comprising the 5' Stem-Loop RNA of [...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.6 Å33(2) 2OZB|1|C, 2OZB|1|F
546NR_all_83079.1
Exact match
2P7E|1|A (2P7E)
  • 5' substrate strand, pentameric fragment
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.1 Å5(2) 2P7E|1|A, 2P7D|1|A
547NR_all_64649.1
Exact match
2PY9|1|F (2PY9)
  • 12-mer C-rich strand of human telomeric [...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.6 Å12(2) 2PY9|1|F, 2PY9|1|E
548NR_all_43749.1
Exact match
2Q1O|1|C+2Q1O|1|D (2Q1O)
  • RNA (5'-R(*CP*GP*CP*(NF2)P*AP*AP*UP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H, L; model(s): 1
1.1 Å11(2) 2Q1O|1|C+2Q1O|1|D, 2Q1O|1|A+2Q1O|1|B
549NR_all_17726.1
Exact match
2Q1R|1|A (2Q1R)
  • RNA (5'-R(*CP*GP*CP*GP*AP*AP*UP*UP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å12(2) 2Q1R|1|A, 157D|1|A+157D|1|B
550NR_all_40252.1
Exact match
2QUS|1|B (2QUS)
  • Hammerhead ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å68(2) 2QUS|1|B, 2QUS|1|A
551NR_all_36634.1
Exact match
2QUW|1|B (2QUW)
  • Hammerhead ribozyme, cleaved fragment
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å57(2) 2QUW|1|B, 2QUW|1|D
552NR_all_74744.1
Exact match
2RP1|1|A (2RP1)
  • PEMV-1 mRNA pseudoknot
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
26(2) 2RP1|1|A, 2RP0|4|A
553NR_all_36129.1
Exact match
Escherichia coli
2VAL|1|B+2VAL|1|D (2VAL)
  • 5'-R(*GP*CP*GP*GP*GP*AP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, D, H, L; model(s): 1
2.0 Å7(2) 2VAL|1|B+2VAL|1|D, 2VAL|1|A+2VAL|1|C
554NR_all_16324.1
Exact match
Homo sapiens
2VOD|1|D (2VOD)
  • 5'-R(*AP*UP*AP*UP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.1 Å7(2) 2VOD|1|D, 2VOD|1|C
555NR_all_71707.1
Exact match
Homo sapiens
2VON|1|D (2VON)
  • 5'-R(*AP*UP*AP*AP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.1 Å7(2) 2VON|1|D, 2VON|1|C
556NR_all_25856.1
Exact match
Homo sapiens
2VOO|1|D (2VOO)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.8 Å3(2) 2VOO|1|D, 2VOO|1|C
557NR_all_09706.1
Exact match
Methanocaldococcus jannaschii
2VPL|1|B (2VPL)
  • FRAGMENT OF MRNA FOR L1-OPERON CONTAININ[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å48(2) 2VPL|1|B, 2VPL|1|D
558NR_all_60790.1
Exact match
Thermus thermophilus
2VQE|1|Y+2VQE|1|X (2VQE)
  • 5'-R(*GP*CP*AP*UP*GP*CP*UP*TM2P*AP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, H, L, X, Y; model(s): 1
2.5 Å6(2) 2VQE|1|Y+2VQE|1|X, 2VQF|1|Y+2VQF|1|X
559NR_all_47406.1
Exact match
Equine infectious anemia virus
2W2H|1|S (2W2H)
  • 5'-R(*GP*CP*UP*CP*AP*GP*AP*UP*CP*UP *GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): S; model(s): 1
3.3 Å22(2) 2W2H|1|S, 2W2H|1|R
560NR_all_97569.1
Exact match
Escherichia coli
2W89|1|C+2W89|1|D (2W89)
  • 5'-R(*GP*CP*AP*UP*CP*CP*GP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H, L; model(s): 1
2.0 Å7(2) 2W89|1|C+2W89|1|D, 2W89|1|A+2W89|1|B
561NR_all_07161.1
Exact match
Saccharomyces cerevisiae
2WW9|1|D (2WW9)
  • 25S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
8.6 Å63(2) 2WW9|1|D, 2WWA|1|D
562NR_all_16134.1
Exact match
Saccharomyces cerevisiae
2WW9|1|F (2WW9)
  • 25S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): F; model(s): 1
8.6 Å25(2) 2WW9|1|F, 2WWA|1|F
563NR_all_88536.1
Exact match
Saccharomyces cerevisiae
2WW9|1|G (2WW9)
  • 25S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): G; model(s): 1
8.6 Å18(2) 2WW9|1|G, 2WWA|1|G
564NR_all_07414.1
Exact match
Saccharomyces cerevisiae
2WWA|1|E (2WWA)
  • 25S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
8.9 Å34(2) 2WWA|1|E, 2WW9|1|E
565NR_all_28594.1
Exact match
2X1F|1|B (2X1F)
  • 5'-R(*GP*UP*UP*GP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.6 Å2(2) 2X1F|1|B, 2X1A|1|B
566NR_all_44600.1
Exact match
Mus musculus
2XS5|1|D (2XS5)
  • 5'-R(*UP*GP*UP*UP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.6 Å5(2) 2XS5|1|D, 2XS5|1|C
567NR_all_17264.1
Exact match
Thermus thermophilus
2XSL|1|C+2XSL|1|D (2XSL)
  • 5'-R(*GP*CP*GP*GP*GP*AP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H, L; model(s): 1
1.6 Å7(2) 2XSL|1|C+2XSL|1|D, 2XSL|1|A+2XSL|1|B
568NR_all_57933.1
Exact match
Deinococcus radiodurans
2XXA|1|G (2XXA)
  • 4.5S RNA
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
3.9 Å102(2) 2XXA|1|G, 2XXA|1|F
569NR_all_42835.3
Exact match
synthetic construct
2XZL|1|B (2XZL)
  • 5- R(*UP*UP*UP*UP*UP*UP*UP*UP*U) -3
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å9(2) 2XZL|1|B, 5I8Q|1|C
570NR_all_72322.1
Exact match
2Y9H|1|F (2Y9H)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.5 Å18(2) 2Y9H|1|F, 2Y9H|1|B
571NR_all_24738.1
Exact match
2Y9H|1|H (2Y9H)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.5 Å18(2) 2Y9H|1|H, 2Y9H|1|D
572NR_all_46586.1
Exact match
2Y9H|1|L (2Y9H)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
2.5 Å18(2) 2Y9H|1|L, 2Y9H|1|J
573NR_all_15533.1
Exact match
2Y9H|1|N (2Y9H)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): N; model(s): 1
2.5 Å17(2) 2Y9H|1|N, 2Y9H|1|P
574NR_all_73930.1
Exact match
synthetic construct
2YJY|1|D (2YJY)
  • 5'-R(*AP*UP*UP*GP*CP*AP*UP*AP*UP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.6 Å10(2) 2YJY|1|D, 2YJY|1|C
575NR_all_76729.1
Exact match
2ZNI|1|D (2ZNI)
  • bacterial tRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.1 Å72(2) 2ZNI|1|D, 2ZNI|1|C
576NR_all_65284.1
Exact match
2ZUE|1|B (2ZUE)
  • tRNA-Arg
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å77(2) 2ZUE|1|B, 2ZUF|1|B
577NR_all_90969.1
Exact match
2ZZN|1|D (2ZZN)
  • RNA (71-MER)
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å71(2) 2ZZN|1|D, 2ZZN|1|C
578NR_all_34610.1
Exact match
Escherichia coli
364D|1|C+364D|1|B+364D|1|A (364D)
  • RNA (5'-R(*CP*CP*CP*CP*AP*UP*GP*CP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, H; model(s): 1
3.0 Å31(2) 364D|1|C+364D|1|B+364D|1|A, 357D|1|C+357D|1|B+357D|1|A
579NR_all_70871.1
Exact match
377D|1|C+377D|1|D (377D)
  • RNA-DNA (5'-R(*CP*GP*UP*AP*CP*DG)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, C, D, H; model(s): 1
1.8 Å5(2) 377D|1|C+377D|1|D, 377D|1|A+377D|1|B
580NR_all_34492.3
Exact match
398D|1|C (398D)
  • RNA (5'-R(*GP*CP*AP*GP*UP*GP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.9 Å8(2) 398D|1|C, 398D|1|A
581NR_all_65114.1
Exact match
3A2K|1|D (3A2K)
  • bacterial tRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.7 Å77(2) 3A2K|1|D, 3A2K|1|C
582NR_all_30596.1
Exact match
3A6P|1|J+3A6P|1|I (3A6P)
  • pre-microRNA
  • X-RAY DIFFRACTION
  • Chain(s): A, D, H, I, J; model(s): 1
2.9 Å24(2) 3A6P|1|J+3A6P|1|I, 3A6P|1|E+3A6P|1|D
583NR_all_23187.1
Exact match
3AGV|1|S (3AGV)
  • 5'-R(*GP*GP*AP*GP*GP*(UFT)P*GP*(CFZ)P*(U[...]
  • X-RAY DIFFRACTION
  • Chain(s): S; model(s): 1
2.2 Å10(2) 3AGV|1|S, 3AGV|1|U
584NR_all_56041.1
Exact match
Archaeoglobus fulgidus
3AMU|1|B (3AMU)
  • RNA (78-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.1 Å78(2) 3AMU|1|B, 3AMT|1|B
585NR_all_35987.1
Exact match
Thermus thermophilus
3B0U|1|B (3B0U)
  • RNA (5'-R(*GP*GP*(H2U)P*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å3(2) 3B0U|1|B, 3B0U|1|A
586NR_all_39089.1
Exact match
Escherichia coli
3BO1|1|D (3BO1)
  • 23S RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
9.6 Å27(2) 3BO1|1|D, 3BO0|1|D
587NR_all_03120.1
Exact match
Escherichia coli
3BO1|1|E (3BO1)
  • 23S RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
9.6 Å27(2) 3BO1|1|E, 3BO0|1|E
588NR_all_01016.1
Exact match
Escherichia coli
3BO1|1|F (3BO1)
  • 23S RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): F; model(s): 1
9.6 Å19(2) 3BO1|1|F, 3BO0|1|F
589NR_all_28149.1
Exact match
Escherichia coli
3BO1|1|G (3BO1)
  • 23S RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): G; model(s): 1
9.6 Å32(2) 3BO1|1|G, 3BO0|1|G
590NR_all_91544.1
Exact match
3BSX|1|D (3BSX)
  • 5'-R(*UP*UP*GP*UP*AP*AP*UP*AP*UP*UP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.3 Å9(2) 3BSX|1|D, 3BSX|1|C
591NR_all_51674.1
Exact match
3BT7|1|D (3BT7)
  • RNA (5'-D(P*GP*CP*UP*GP*UP*GP*(5MU)P*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å18(2) 3BT7|1|D, 3BT7|1|C
592NR_all_27661.1
Exact match
3BX2|1|D (3BX2)
  • HO endonuclease 3' UTR binding sequence
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.8 Å9(2) 3BX2|1|D, 3BX2|1|C
593NR_all_95803.1
Exact match
3BX3|1|D (3BX3)
  • COX17 RNA target sequence
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å8(2) 3BX3|1|D, 3BX3|1|C
594NR_all_22223.1
Exact match
3CGP|1|B+3CGP|1|A (3CGP)
  • RNA (5'-R(*CP*GP*CP*UP*AP*CP*UP*AP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.6 Å13(2) 3CGP|1|B+3CGP|1|A, 3CGQ|1|B+3CGQ|1|A
595NR_all_13929.1
Exact match
3CR1|1|A (3CR1)
  • RNA (5'-R(*UP*CP*CP*CP*(A2M)P*GP*UP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å13(2) 3CR1|1|A, 3CQS|1|A
596NR_all_88906.1
Exact match
3CZ3|1|G+3CZ3|1|H (3CZ3)
  • RNA (5'-R(P*CP*GP*UP*AP*CP*GP*CP*GP*GP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, G, H; model(s): 1
3.2 Å38(2) 3CZ3|1|G+3CZ3|1|H, 3CZ3|1|E+3CZ3|1|F
597NR_all_67685.1
Exact match
3D2S|1|G (3D2S)
  • 5'-R(*CP*GP*CP*UP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
1.7 Å6(2) 3D2S|1|G, 3D2S|1|E
598NR_all_35553.1
Exact match
3D2S|1|H (3D2S)
  • 5'-R(*CP*GP*CP*UP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
1.7 Å5(2) 3D2S|1|H, 3D2S|1|F
599NR_all_46343.1
Exact match
3E3J|1|Z (3E3J)
  • RNA (5'-R(*GP*GP*GP*AP*GP*UP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
6.7 Å8(2) 3E3J|1|Z, 3E3J|1|R
600NR_all_07227.1
Exact match
3ERC|1|F (3ERC)
  • RNA/DNA chimera (5'-D(CP*)R(UP*UP*)D(CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.2 Å2(2) 3ERC|1|F, 3ERC|1|E
601NR_all_79282.1
Exact match
3FTM|1|D+3FTM|1|C (3FTM)
  • 5'-R(*CP*CP*AP*GP*UP*CP*GP*GP*AP*AP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, C, D, H; model(s): 1
2.7 Å12(2) 3FTM|1|D+3FTM|1|C, 3FTM|1|B+3FTM|1|A
602NR_all_25125.1
Exact match
3GM7|1|G+3GM7|1|H (3GM7)
  • 5'-R(*CP*UP*GP*CP*UP*GP*CP*UP*GP*CP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, G, H; model(s): 1
1.6 Å18(2) 3GM7|1|G+3GM7|1|H, 1ZEV|1|A+1ZEV|1|B
603NR_all_60450.1
Exact match
3GTJ|1|R (3GTJ)
  • RNA (5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.4 Å12(2) 3GTJ|1|R, 3GTM|1|M
604NR_all_12080.1
Exact match
3HGA|1|X (3HGA)
  • 5'-R(*UP*(US5)P*CP*GP*CP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
1.3 Å5(2) 3HGA|1|X, 1OSU|1|A
605NR_all_10218.1
Exact match
3HOU|1|6 (3HOU)
  • 5'-R(*UP*GP*CP*AP*UP*U*UP*CP*GP*AP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6; model(s): 1
3.2 Å11(2) 3HOU|1|6, 3HOU|1|3
606NR_all_34753.1
Exact match
3HOW|1|3 (3HOW)
  • 5'-R(*UP*GP*CP*AP*UP*UP*U*CP*AP*AP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): 3; model(s): 1
3.6 Å11(2) 3HOW|1|3, 3HOX|1|P
607NR_all_47541.1
Exact match
3HTX|1|E+3HTX|1|F (3HTX)
  • 5'-R(*GP*AP*UP*UP*UP*CP*UP*CP*UP*CP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, E, F, H; model(s): 1
3.1 Å22(2) 3HTX|1|E+3HTX|1|F, 3HTX|1|B+3HTX|1|C
608NR_all_17498.1
Exact match
3ICQ|1|E (3ICQ)
  • RNA (62-MER)
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.2 Å62(2) 3ICQ|1|E, 3ICQ|1|D
609NR_all_38996.1
Exact match
3ID5|1|H (3ID5)
  • half C/D RNA
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
4.0 Å34(2) 3ID5|1|H, 3ID5|1|D
610NR_all_58564.1
Exact match
3IVK|1|M (3IVK)
  • class I ligase product
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
3.1 Å130(2) 3IVK|1|M, 3IVK|1|C
611NR_all_66984.1
Exact match
Bacillus subtilis
3IVN|1|B (3IVN)
  • A-riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å69(2) 3IVN|1|B, 3IVN|1|A
612NR_all_25458.1
Exact match
3IWN|1|A (3IWN)
  • C-di-GMP riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.2 Å93(2) 3IWN|1|A, 3IWN|1|B
613NR_all_33231.1
Exact match
Thermus thermophilus
3IYQ|1|A (3IYQ)
  • tmRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
13.0 Å349(2) 3IYQ|1|A, 3IYR|1|A
614NR_all_45472.1
Exact match
Escherichia coli
3IZ4|1|A (3IZ4)
  • Modified E. coli transfer-messenger RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
13.6 Å377(2) 3IZ4|1|A, 4V6T|1|AV
615NR_all_16356.1
Exact match
Escherichia coli
3IZZ|1|E (3IZZ)
  • Helix 44 (Small Subunit)
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
10.8 Å100(2) 3IZZ|1|E, 1MVR|1|B
616NR_all_17900.1
Exact match
Escherichia coli
3J0E|1|B (3J0E)
  • ribosomal 23S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
9.9 Å17(2) 3J0E|1|B, 3J0D|1|C
617NR_all_07345.1
Exact match
Escherichia coli
3J0E|1|e+3J0E|1|E (3J0E)
  • ribosomal 16S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A, D, E, H, e; model(s): 1
9.9 Å19(2) 3J0E|1|e+3J0E|1|E, 3J0D|1|h+3J0D|1|H
618NR_all_93451.1
Exact match
Oryctolagus cuniculus
3J0O|1|4 (3J0O)
  • 60S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): 4; model(s): 1
9.0 Å14(2) 3J0O|1|4, 3J0L|1|4
619NR_all_68052.1
Exact match
Oryctolagus cuniculus
3J0O|1|5 (3J0O)
  • 60S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): 5; model(s): 1
9.0 Å6(2) 3J0O|1|5, 3J0L|1|5
620NR_all_63046.1
Exact match
Oryctolagus cuniculus
3J0O|1|6 (3J0O)
  • 60S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): 6; model(s): 1
9.0 Å19(2) 3J0O|1|6, 3J0L|1|6
621NR_all_57105.1
Exact match
Oryctolagus cuniculus
3J0O|1|8 (3J0O)
  • 60S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): 8; model(s): 1
9.0 Å20(2) 3J0O|1|8, 3J0L|1|8
622NR_all_39771.1
Exact match
Oryctolagus cuniculus
3J0O|1|E+3J0O|1|e (3J0O)
  • 40S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): A, D, E, H, e; model(s): 1
9.0 Å5(2) 3J0O|1|E+3J0O|1|e, 3J0L|1|E+3J0L|1|e
623NR_all_23724.1
Exact match
Oryctolagus cuniculus
3J0O|1|b (3J0O)
  • 40S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): b; model(s): 1
9.0 Å12(2) 3J0O|1|b, 3J0L|1|b
624NR_all_82908.1
Exact match
Escherichia coli
3J45|1|2 (3J45)
  • 23S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
9.5 Å36(2) 3J45|1|2, 3J46|1|2
625NR_all_06653.1
Exact match
Escherichia coli
3J46|1|1 (3J46)
  • 23S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 1; model(s): 1
10.1 Å63(2) 3J46|1|1, 3J45|1|1
626NR_all_86022.1
Exact match
Escherichia coli
3J46|1|4 (3J46)
  • 23S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 4; model(s): 1
10.1 Å109(2) 3J46|1|4, 3J45|1|5
627NR_all_30486.1
Exact match
Plasmodium falciparum
3J7A|1|7 (3J7A)
  • tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 7; model(s): 1
3.2 Å74(2) 3J7A|1|7, 3JBP|1|7
628NR_all_61505.1
Exact match
Sus scrofa
3J7P|1|S2 (3J7P)
  • 18S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): S2; model(s): 1
3.5 Å1742(2) 3J7P|1|S2, 3J7R|1|S2
629NR_all_02817.1
Exact match
Homo sapiens
3J7Y|1|A (3J7Y)
  • 16S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.4 Å1473(2) 3J7Y|1|A, 3J9M|1|A
630NR_all_26052.1
Exact match
3J9B|1|K+3J9B|1|L (3J9B)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*A)-3')
  • ELECTRON MICROSCOPY
  • Chain(s): A, D, H, K, L; model(s): 1
4.3 Å5(2) 3J9B|1|K+3J9B|1|L, 3J9B|1|D
631NR_all_26348.1
Exact match
Homo sapiens
3J9M|1|B (3J9M)
  • mt-tRNAVal
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
3.5 Å56(2) 3J9M|1|B, 3J7Y|1|B
632NR_all_72418.1
Exact match
Bacillus subtilis
3J9W|1|AA (3J9W)
  • 16S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): AA; model(s): 1
3.9 Å1544(2) 3J9W|1|AA, 5NJT|1|A
633NR_all_35965.1
Exact match
Oryctolagus cuniculus
3JAN|1|4 (3JAN)
  • SRP 7S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 4; model(s): 1
3.8 Å212(2) 3JAN|1|4, 3JAJ|1|4
634NR_all_19099.1
Exact match
3K0J|1|E (3K0J)
  • RNA (87-MER)
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.1 Å87(2) 3K0J|1|E, 3K0J|1|F
635NR_all_84036.1
Exact match
3K5Y|1|B (3K5Y)
  • 5'-R(*UP*GP*UP*GP*CP*CP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å9(2) 3K5Y|1|B, 3QGB|1|B
636NR_all_32874.1
Exact match
Sulfolobus solfataricus
3KTW|1|C (3KTW)
  • SRP RNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.2 Å96(2) 3KTW|1|C, 3KTW|1|D
637NR_all_34992.1
Exact match
3L25|1|C+3L25|1|F (3L25)
  • RNA (5'-R(*CP*GP*CP*AP*UP*GP*CP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, C, D, F, H; model(s): 1
2.0 Å8(2) 3L25|1|C+3L25|1|F, 3L26|1|C
638NR_all_46231.1
Exact match
Pyrococcus furiosus
3NMU|1|D+3NMU|1|I (3NMU)
  • RNA (34-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A, D, H, I; model(s): 1
2.7 Å34(2) 3NMU|1|D+3NMU|1|I, 3NMU|1|E+3NMU|1|K
639NR_all_50588.1
Exact match
Pyrococcus furiosus
3NVI|1|F (3NVI)
  • RNA (5'-R(*CP*UP*CP*UP*GP*AP*CP*CP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.7 Å24(2) 3NVI|1|F, 3NVI|1|E
640NR_all_15188.1
Exact match
3NVK|1|K+3NVK|1|G (3NVK)
  • RNA (5'-R(*GP*CP*CP*GP*UP*UP*GP*AP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, G, H, K; model(s): 1
3.2 Å24(2) 3NVK|1|K+3NVK|1|G, 3NVK|1|L+3NVK|1|S
641NR_all_61988.1
Exact match
3OG8|1|C+3OG8|1|D (3OG8)
  • RNA (5'-R(*GP*GP*CP*GP*CP*GP*CP*GP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, C, D, H; model(s): 1
2.4 Å14(2) 3OG8|1|C+3OG8|1|D, 3LRN|1|C+3LRN|1|D
642NR_all_97537.1
Exact match
3P4D|1|B (3P4D)
  • 5'-R(*(CFZ)P*CP*(CFZ)P*CP*(GF2)P*GP*(GF2[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å4(2) 3P4D|1|B, 3P4D|1|A
643NR_all_22853.1
Exact match
3PLA|1|N+3PLA|1|O (3PLA)
  • C/D guide RNA
  • X-RAY DIFFRACTION
  • Chain(s): A, D, H, N, O; model(s): 1
3.2 Å31(2) 3PLA|1|N+3PLA|1|O, 3PLA|1|G+3PLA|1|H+3PLA|1|I+3PLA|1|J
644NR_all_08738.1
Exact match
3Q0P|1|D (3Q0P)
  • 5'-R(UP*GP*UP*AP*UP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.6 Å8(2) 3Q0P|1|D, 3Q0P|1|C
645NR_all_98055.1
Exact match
3Q0S|1|B (3Q0S)
  • 5'-R(UP*GP*UP*AP*CP*AP*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å8(2) 3Q0S|1|B, 3Q0N|1|C
646NR_all_17316.1
Exact match
3Q1Q|1|C (3Q1Q)
  • TRNA (PHE)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.8 Å86(2) 3Q1Q|1|C, 3Q1R|1|C
647NR_all_65073.1
Exact match
Clostridium acetobutylicum
3Q3Z|1|V (3Q3Z)
  • c-di-GMP-II riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): V; model(s): 1
2.5 Å74(2) 3Q3Z|1|V, 3Q3Z|1|A
648NR_all_10014.1
Exact match
3QGC|1|B (3QGC)
  • 5'-R(*UP*GP*UP*GP*CP*CP*UP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å9(2) 3QGC|1|B, 3QG9|1|B
649NR_all_34288.1
Exact match
3QJL|1|X (3QJL)
  • RNA (5'-R(*GP*UP*UP*AP*CP*AP*AP*UP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.7 Å12(2) 3QJL|1|X, 3QJL|1|R
650NR_all_40400.1
Exact match
3QSU|1|R (3QSU)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.2 Å4(2) 3QSU|1|R, 3QSU|1|P
651NR_all_95407.1
Exact match
3R1D|1|C+3R1D|1|D (3R1D)
  • RNA (5'-R(*GP*CP*(GRB)P*GP*CP*GP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, C, D, H; model(s): 1
1.5 Å16(2) 3R1D|1|C+3R1D|1|D, 3R1D|1|A+3R1D|1|B
652NR_all_86424.1
Exact match
Aquifex aeolicus
3R2C|1|S (3R2C)
  • 5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): S; model(s): 1
1.9 Å10(2) 3R2C|1|S, 3R2C|1|R
653NR_all_07663.1
Exact match
3RER|1|K (3RER)
  • 5'-R(*AP*UP*UP*UP*UP*UP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): K; model(s): 1
1.7 Å8(2) 3RER|1|K, 4HT9|1|E
654NR_all_57598.2
Exact match
Mus musculus
3RG5|1|B (3RG5)
  • tRNA(Sec)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å86(2) 3RG5|1|B, 3RG5|1|A
655NR_all_76909.1
Exact match
3RW6|1|H (3RW6)
  • constitutive transport element(CTE)of Ma[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.3 Å60(2) 3RW6|1|H, 3RW6|1|F
656NR_all_31327.1
Exact match
3S17|1|R (3S17)
  • RNA (5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*G)-3'[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.2 Å9(2) 3S17|1|R, 2E2J|1|R
657NR_all_14513.1
Exact match
Homo sapiens
3SIU|1|F (3SIU)
  • U4atac snRNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.6 Å28(2) 3SIU|1|F, 3SIU|1|C
658NR_all_08155.1
Exact match
Homo sapiens
3SIV|1|I+3SIV|1|L (3SIV)
  • U4atac snRNA
  • X-RAY DIFFRACTION
  • Chain(s): A, D, H, I, L; model(s): 1
3.3 Å32(2) 3SIV|1|I+3SIV|1|L, 3SIV|1|C+3SIV|1|F
659NR_all_53881.1
Exact match
3SNP|1|D (3SNP)
  • ferritin H IRE RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.8 Å30(2) 3SNP|1|D, 3SNP|1|C
660NR_all_51156.1
Exact match
3SQW|1|B (3SQW)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å8(2) 3SQW|1|B, 3SQX|1|B
661NR_all_47433.1
Exact match
Caldanaerobacter subterraneus
3V7E|1|C (3V7E)
  • SAM-I riboswitch aptamer with an enginee[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å126(2) 3V7E|1|C, 3V7E|1|D
662NR_all_45693.1
Exact match
3VJR|1|D (3VJR)
  • tRNA CCA-acceptor
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å36(2) 3VJR|1|D, 3VJR|1|B
663NR_all_87467.1
Exact match
3WC1|1|Q (3WC1)
  • 75-mer tRNA
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
4.2 Å73(2) 3WC1|1|Q, 3WC1|1|P
664NR_all_69638.1
Exact match
Archaeoglobus fulgidus
3WQY|1|C (3WQY)
  • RNA (75-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.3 Å75(2) 3WQY|1|C, 3WQZ|1|C
665NR_all_68126.1
Exact match
420D|1|A+420D|1|B (420D)
  • RNA (5'-R(*GP*CP*AP*GP*AP*GP*UP*UP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.9 Å16(2) 420D|1|A+420D|1|B, 2H1M|1|A+2H1M|1|B
666NR_all_08327.1
Exact match
435D|1|C+435D|1|D (435D)
  • RNA (5'-R(*UP*AP*GP*CP*CP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, C, D, H; model(s): 1
1.4 Å7(2) 435D|1|C+435D|1|D, 435D|1|A+435D|1|B
667NR_all_31833.1
Exact match
Thermus thermophilus
486D|1|G (486D)
  • 900 STEM-LOOP OF 16S RRNA IN THE 70S RIB[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
7.5 Å33(2) 486D|1|G, 2R1G|1|C
668NR_all_92005.1
Exact match
synthetic construct
4A2X|1|N+4A2X|1|O (4A2X)
  • 5'-R(*GP*GP*GP*AP*GP*AP*AP*CP*AP*AP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, H, N, O; model(s): 1
4.0 Å14(2) 4A2X|1|N+4A2X|1|O, 4A2X|1|L+4A2X|1|M
669NR_all_28969.1
Exact match
synthetic construct
4A36|1|T+4A36|1|U (4A36)
  • 5'-R(*GP*CP*AP*UP*GP*CP*GP*AP*CP*CP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, H, T, U; model(s): 1
3.7 Å18(2) 4A36|1|T+4A36|1|U, 4A36|1|R+4A36|1|S
670NR_all_64994.1
Exact match
Saccharomyces cerevisiae
4A3B|1|P (4A3B)
  • TRANSCRIPT RNA 5'-R(*AP*GP*GP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.5 Å4(2) 4A3B|1|P, 4A3M|1|P
671NR_all_07798.1
Exact match
Saccharomyces cerevisiae
4A3E|1|P (4A3E)
  • TRANSCRIPT RNA 5'-R(*CP*AP*GP*GP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.4 Å4(2) 4A3E|1|P, 4A3C|1|P
672NR_all_23131.1
Exact match
Saccharomyces cerevisiae
4A3L|1|P (4A3L)
  • 5'-R(*AP*CP*CP*AP*GP*GP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.5 Å7(2) 4A3L|1|P, 4A3K|1|P
673NR_all_06402.1
Exact match
Pseudomonas aeruginosa
4AL7|1|B (4AL7)
  • 5'-R(*CP*UP*GP*CP*CP*GP*UP*AP*UP*AP*GP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å15(2) 4AL7|1|B, 4AL5|1|B
674NR_all_11428.1
Exact match
Pseudomonas phage PRR1
4ANG|1|R (4ANG)
  • 5'-R(*CP*CP*AP*UP*AP*AP*GP*GP*AP*GP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.5 Å26(2) 4ANG|1|R, 4ANG|1|S
675NR_all_04968.1
Exact match
synthetic construct
4B3P|1|R (4B3P)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
4.8 Å21(2) 4B3P|1|R, 4B3Q|1|R
676NR_all_94132.1
Exact match
Influenza A virus
4BBL|1|Z (4BBL)
  • RNA
  • ELECTRON MICROSCOPY
  • Chain(s): Z; model(s): 1
18.0 Å308(2) 4BBL|1|Z, 4BBL|1|Y
677NR_all_92231.1
Exact match
synthetic construct
4BY7|1|P (4BY7)
  • 5'-R(*UP*UP*CP*GP*AP*CP*CP*AP*GP*GP*AP)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.2 Å10(2) 4BY7|1|P, 4BY1|1|P
678NR_all_49359.1
Exact match
Pyrococcus furiosus
4BY9|1|B (4BY9)
  • SSR26
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
72(2) 4BY9|1|B, 4BY9|1|A
679NR_all_23939.1
Exact match
Kneallhazia solenopsae
4C4W|1|H (4C4W)
  • TSKT-23
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.0 Å35(2) 4C4W|1|H, 4C4W|1|D
680NR_all_88374.1
Exact match
Thermus thermophilus
4C9D|1|C (4C9D)
  • R3 REPEAT RNA CLEAVAGE PRODUCT
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.0 Å12(2) 4C9D|1|C, 4C9D|1|D
681NR_all_67355.1
Exact match
Haloarcula marismortui
4CS1|1|A (4CS1)
  • 5'-(*GP*GP*CP*GP*AP*AP*GP*AP*AP*CP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å19(2) 4CS1|1|A, 4C40|1|A
682NR_all_39109.1
Exact match
Oryctolagus cuniculus
4CXG|1|1 (4CXG)
  • 18S RRNA - H44
  • ELECTRON MICROSCOPY
  • Chain(s): 1; model(s): 1
8.7 Å135(2) 4CXG|1|1, 4CXH|1|1
683NR_all_43355.1
Exact match
Oryctolagus cuniculus
4CXG|1|2 (4CXG)
  • 28S RRNA - H89
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
8.7 Å50(2) 4CXG|1|2, 4CXH|1|2
684NR_all_72858.1
Exact match
Oryctolagus cuniculus
4CXG|1|Y (4CXG)
  • TRANSFER RNA
  • ELECTRON MICROSCOPY
  • Chain(s): Y; model(s): 1
8.7 Å65(2) 4CXG|1|Y, 4CXH|1|Y
685NR_all_18260.1
Exact match
Oryctolagus cuniculus
4CXG|1|a (4CXG)
  • 18S RRNA - H5-H14
  • ELECTRON MICROSCOPY
  • Chain(s): a; model(s): 1
8.7 Å48(2) 4CXG|1|a, 4CXH|1|a
686NR_all_62991.1
Exact match
Oryctolagus cuniculus
4CXG|1|b (4CXG)
  • 18S RRNA - H8
  • ELECTRON MICROSCOPY
  • Chain(s): b; model(s): 1
8.7 Å17(2) 4CXG|1|b, 4CXH|1|b
687NR_all_11234.1
Exact match
Oryctolagus cuniculus
4CXG|1|c (4CXG)
  • 28S RRNA - H95
  • ELECTRON MICROSCOPY
  • Chain(s): c; model(s): 1
8.7 Å19(2) 4CXG|1|c, 4CXH|1|c
688NR_all_68928.1
Exact match
Bombyx mori
4D25|1|D (4D25)
  • 5'-R(*UP*GP*AP*CP*AP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.9 Å6(2) 4D25|1|D, 4D26|1|D
689NR_all_48272.1
Exact match
4DZS|1|D (4DZS)
  • 5'-R(*UP*GP*UP*AP*UP*CP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.1 Å9(2) 4DZS|1|D, 4DZS|1|C
690NR_all_06694.1
Exact match
4ED5|1|D (4ED5)
  • 5'-R(*A*UP*UP*UP*UP*UP*AP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.0 Å10(2) 4ED5|1|D, 4ED5|1|C
691NR_all_58977.1
Exact match
synthetic construct
4EYA|1|k+4EYA|1|l (4EYA)
  • RNA (5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, H, k, l; model(s): 1
3.2 Å12(2) 4EYA|1|k+4EYA|1|l, 4EYA|1|i+4EYA|1|j
692NR_all_48927.1
Exact match
synthetic construct
4EYA|1|m+4EYA|1|n (4EYA)
  • RNA (5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, H, m, n; model(s): 1
3.2 Å12(2) 4EYA|1|m+4EYA|1|n, 4EYA|1|a+4EYA|1|b
693NR_all_87225.1
Exact match
synthetic construct
4EYA|1|o+4EYA|1|p (4EYA)
  • RNA (5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, H, o, p; model(s): 1
3.2 Å12(2) 4EYA|1|o+4EYA|1|p, 4EYA|1|c+4EYA|1|d
694NR_all_15820.1
Exact match
synthetic construct
4EYA|1|q+4EYA|1|r (4EYA)
  • RNA (5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, H, q, r; model(s): 1
3.2 Å12(2) 4EYA|1|q+4EYA|1|r, 4EYA|1|e+4EYA|1|f
695NR_all_13759.1
Exact match
synthetic construct
4EYA|1|s+4EYA|1|t (4EYA)
  • RNA (5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, H, s, t; model(s): 1
3.2 Å12(2) 4EYA|1|s+4EYA|1|t, 4EYA|1|g+4EYA|1|h
696NR_all_68289.1
Exact match
4F02|1|E (4F02)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.0 Å9(2) 4F02|1|E, 4F02|1|B
697NR_all_29401.1
Exact match
Vanderwaltozyma polyspora
4F1N|1|F (4F1N)
  • RNA 5'-R(P*UP*AP*AP*AP*AP*AP*AP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.2 Å9(2) 4F1N|1|F, 4F1N|1|E
698NR_all_01779.1
Exact match
marine metagenome
4FRG|1|B (4FRG)
  • cobalamin riboswitch aptamer domain
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å84(2) 4FRG|1|B, 4FRG|1|X
699NR_all_95082.1
Exact match
marine metagenome
4FRN|1|B (4FRN)
  • Cobalamin riboswitch aptamer domain
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.4 Å102(2) 4FRN|1|B, 4FRN|1|A
700NR_all_99371.1
Exact match
Spodoptera frugiperda
4FTS|1|R (4FTS)
  • Random cellular RNAs
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.2 Å15(2) 4FTS|1|R, 4FTE|1|R
701NR_all_99451.1
Exact match
4FWT|1|G+4FWT|1|T (4FWT)
  • RNA (5'-R(*C*CP*CP*UP*AP*CP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, D, G, H, T; model(s): 1
3.2 Å7(2) 4FWT|1|G+4FWT|1|T, 3VNU|1|G+3VNU|1|T
702NR_all_49582.1
Exact match
4FXD|1|F (4FXD)
  • RNA (5'-R(*AP*GP*GP*CP*GP*GP*GP*CP*AP*G)[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.0 Å8(2) 4FXD|1|F, 4FXD|1|E
703NR_all_79184.1
Exact match
4GCW|1|B (4GCW)
  • TRNA(THR)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å53(2) 4GCW|1|B, 2FK6|1|R
704NR_all_00536.1
Exact match
4GHL|1|F (4GHL)
  • short palindromic RNA AGACAGCAUAUGCUGUCU
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.0 Å18(2) 4GHL|1|F, 4GHL|1|E
705NR_all_51944.1
Exact match
4GL2|1|E+4GL2|1|F (4GL2)
  • RNA (5'-R(*AP*UP*CP*CP*GP*CP*GP*GP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, D, E, F, H; model(s): 1
3.6 Å12(2) 4GL2|1|E+4GL2|1|F, 4GL2|1|C+4GL2|1|D
706NR_all_08724.1
Exact match
4H5O|1|L (4H5O)
  • 35-mer poly(U) RNA
  • X-RAY DIFFRACTION
  • Chain(s): L; model(s): 1
3.9 Å35(2) 4H5O|1|L, 4H5O|1|K
707NR_all_00747.1
Exact match
4H5P|1|F (4H5P)
  • 28-mer poly(U) RNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.2 Å14(2) 4H5P|1|F, 4H5P|1|E
708NR_all_12719.1
Exact match
4IFD|1|R (4IFD)
  • RNA (45-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.8 Å30(2) 4IFD|1|R, 5C0X|1|R
709NR_all_31263.1
Exact match
4ILL|1|C (4ILL)
  • RNA (5'-R(*GP*CP*UP*AP*AP*UP*CP*UP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.5 Å17(2) 4ILL|1|C, 4ILL|1|R
710NR_all_93859.1
Exact match
4J39|1|B (4J39)
  • 5'-R(P*CP*AP*GP*CP*AP*GP*CP*AP*GP*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.7 Å21(2) 4J39|1|B, 4J5V|1|B
711NR_all_40086.1
Exact match
4JGN|1|E (4JGN)
  • 5'-R(P*UP*UP*GP*CP*UP*GP*CP*UP*GP*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.9 Å20(2) 4JGN|1|E, 4JK0|1|B
712NR_all_26186.1
Exact match
4JRC|1|B (4JRC)
  • Distal Stem I region of the glyQS T box [...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å56(2) 4JRC|1|B, 4JRC|1|A
713NR_all_76613.1
Exact match
4JRD|1|B (4JRD)
  • RNA (5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.0 Å11(2) 4JRD|1|B, 4JRD|1|A
714NR_all_40895.1
Exact match
4JVY|1|F (4JVY)
  • RNA (5'-R(P*CP*UP*AP*AP*CP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.9 Å8(2) 4JVY|1|F, 4JVY|1|D
715NR_all_28348.1
Exact match
synthetic construct
4JXZ|1|B (4JXZ)
  • RNA (71-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å71(2) 4JXZ|1|B, 4JYZ|1|B
716NR_all_96460.1
Exact match
4JZU|1|C (4JZU)
  • RNA (5'-R(*(GCP)P*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.7 Å1(2) 4JZU|1|C, 4JZV|1|C
717NR_all_33790.1
Exact match
4K4U|1|F+4K4U|1|G+4K4U|1|H (4K4U)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, F, G, H; model(s): 1
2.9 Å19(2) 4K4U|1|F+4K4U|1|G+4K4U|1|H, 4K4U|1|B+4K4U|1|C+4K4U|1|D
718NR_all_31084.1
Exact match
4K4V|1|F (4K4V)
  • RNA (5'-R(*AP*AP*GP*UP*CP*UP*CP*CP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.6 Å13(2) 4K4V|1|F, 4K4V|1|B
719NR_all_73146.1
Exact match
Thermus thermophilus
4KHP|1|X (4KHP)
  • Fragment of messenger RNA
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.1 Å6(2) 4KHP|1|X, 1HNX|1|X
720NR_all_72481.1
Exact match
4KJI|1|D (4KJI)
  • RsmZ-2
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.2 Å16(2) 4KJI|1|D, 4KJI|1|C
721NR_all_57443.1
Exact match
4KR7|1|M (4KR7)
  • RNA (39-MER)
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
3.4 Å39(2) 4KR7|1|M, 4KR9|1|M
722NR_all_87561.1
Exact match
4KR7|1|X (4KR7)
  • RNA (39-MER)
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.4 Å39(2) 4KR7|1|X, 4KR9|1|X
723NR_all_41922.1
Exact match
4KTG|1|E (4KTG)
  • 5'-R(P*GP*CP*GP*GP*CP*GP*GP*CP*GP*GP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.9 Å21(2) 4KTG|1|E, 4KTG|1|B
724NR_all_12869.1
Exact match
4L81|1|A (4L81)
  • SAM-I/IV variant riboswitch aptamer doma[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å96(2) 4L81|1|A, 4OQU|1|A
725NR_all_73445.1
Exact match
Vibrio vulnificus
4LX6|1|A (4LX6)
  • Mutated adenine riboswitch aptamer
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.2 Å71(2) 4LX6|1|A, 4LX5|1|A
726NR_all_55785.1
Exact match
4M59|1|C (4M59)
  • psaJ RNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.5 Å14(2) 4M59|1|C, 4OE1|1|C
727NR_all_27182.1
Exact match
4M59|1|D (4M59)
  • psaJ RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.5 Å18(2) 4M59|1|D, 4OE1|1|D
728NR_all_17764.1
Exact match
4M7A|1|P (4M7A)
  • U6 snRNA
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.8 Å5(2) 4M7A|1|P, 4M7A|1|O
729NR_all_42085.1
Exact match
4M7D|1|P (4M7D)
  • U6 snRNA
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.6 Å4(2) 4M7D|1|P, 4M7D|1|O
730NR_all_19112.1
Exact match
4MGN|1|A (4MGN)
  • glyQS T box riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.2 Å85(2) 4MGN|1|A, 4MGN|1|C
731NR_all_98303.1
Exact match
4N48|1|G (4N48)
  • capped RNA
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.7 Å4(2) 4N48|1|G, 4N48|1|D
732NR_all_47933.1
Exact match
4NGD|1|B (4NGD)
  • 5'-R(P*GP*CP*GP*AP*AP*UP*UP*CP*GP*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å12(2) 4NGD|1|B, 4NGB|1|B
733NR_all_06683.1
Exact match
4NGF|1|G+4NGF|1|H (4NGF)
  • 5'-R(P*UP*CP*GP*AP*AP*GP*GP*UP*CP*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, G, H; model(s): 1
3.1 Å17(2) 4NGF|1|G+4NGF|1|H, 4NGF|1|E+4NGF|1|F
734NR_all_11458.2
Exact match
Oryzias latipes
4O26|1|E (4O26)
  • Telomerase TR
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.0 Å47(2) 4O26|1|E, 4O26|1|F
735NR_all_56235.1
Exact match
4O41|1|C+4O41|1|D (4O41)
  • AMIDE LINKED RNA
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H; model(s): 1
1.2 Å10(2) 4O41|1|C+4O41|1|D, 4O41|1|B+4O41|1|A
736NR_all_41964.1
Exact match
4O8J|1|E (4O8J)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.0 Å6(2) 4O8J|1|E, 4O8J|1|D
737NR_all_91413.1
Exact match
4OL8|1|G (4OL8)
  • 5'-R(*CP*UP*GP*AP*GP*AP*GP*AP*GP*AP*GP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
3.1 Å17(2) 4OL8|1|G, 4OL8|1|C
738NR_all_47021.1
Exact match
Homo sapiens
4OLA|1|B (4OLA)
  • 5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å10(2) 4OLA|1|B, 4OLB|1|B
739NR_all_43274.1
Exact match
Senecavirus A
4P97|1|C+4P97|1|D (4P97)
  • RNA (5'-R(*CP*GP*UP*CP*UP*AP*CP*CP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H; model(s): 1
1.9 Å16(2) 4P97|1|C+4P97|1|D, 4P97|1|A+4P97|1|B
740NR_all_57460.1
Exact match
Didymium iridis
4P9R|1|A (4P9R)
  • RNA (189-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å191(2) 4P9R|1|A, 4P95|1|A
741NR_all_52610.1
Exact match
synthetic construct
4PCJ|1|A (4PCJ)
  • trCUG-3('5)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.9 Å34(2) 4PCJ|1|A, 4FNJ|1|A
742NR_all_13685.1
Exact match
unidentified
4PMW|1|D (4PMW)
  • U-U-U-U-U-U-U-U-U-U-U-U-U-U
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å14(2) 4PMW|1|D, 4PMW|1|C
743NR_all_73328.1
Exact match
4PWD|1|T (4PWD)
  • 5'-R(*AP*UP*GP*GP*UP*CP*GP*GP*CP*GP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
3.0 Å21(2) 4PWD|1|T, 4PWD|1|E
744NR_all_67179.1
Exact match
4Q0B|1|T (4Q0B)
  • 5'-R(*AP*UP*GP*GP*UP*CP*GP*GP*CP*GP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
3.3 Å9(2) 4Q0B|1|T, 4Q0B|1|E
745NR_all_89275.1
Exact match
4Q0B|1|t (4Q0B)
  • 5'-R(P*AP*CP*AP*GP*GP*GP*AP*CP*UP*GP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): t; model(s): 1
3.3 Å10(2) 4Q0B|1|t, 4Q0B|1|e
746NR_all_65762.1
Exact match
4Q5S|1|I (4Q5S)
  • RNA (5'-R(P*CP*UP*CP*AP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
3.0 Å5(2) 4Q5S|1|I, 1T2R|1|B
747NR_all_91665.3
Exact match
4Q5V|1|F (4Q5V)
  • RNA primer
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.5 Å10(2) 4Q5V|1|F, 4Q5V|1|B
748NR_all_61892.1
Exact match
4QIL|1|D (4QIL)
  • 5'-R(*CP*UP*CP*CP*CP*UP*UP*CP*UP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.9 Å16(2) 4QIL|1|D, 4QIL|1|C
749NR_all_66230.1
Exact match
4QK8|1|A (4QK8)
  • C-di-AMP riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å120(2) 4QK8|1|A, 4QKA|1|A
750NR_all_53735.1
Exact match
Caldanaerobacter subterraneus
4QLM|1|A (4QLM)
  • RNA (108-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å108(2) 4QLM|1|A, 4QLN|1|A
751NR_all_75344.1
Exact match
4QM6|1|D (4QM6)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.5 Å7(2) 4QM6|1|D, 4QM6|1|C
752NR_all_29353.1
Exact match
4QQB|1|P (4QQB)
  • msl2 mRNA
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.8 Å17(2) 4QQB|1|P, 4QQB|1|C
753NR_all_81784.1
Exact match
4S20|1|P (4S20)
  • 5'-R(P*AP*UP*CP*GP*GP*CP*UP*CP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
4.7 Å9(2) 4S20|1|P, 4S20|1|N
754NR_all_77810.1
Exact match
4S2X|1|B (4S2X)
  • RNA (5'-R(*(APC)*GP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.5 Å2(2) 4S2X|1|B, 4S2Y|1|B
755NR_all_80828.1
Exact match
synthetic construct
4TS0|1|Y+4TS0|1|X (4TS0)
  • Spinach RNA aptamer, bimolecular constru[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, H, X, Y; model(s): 1
2.8 Å46(2) 4TS0|1|Y+4TS0|1|X, 4TS2|1|Y+4TS2|1|X
756NR_all_63520.1
Exact match
synthetic construct
4TU0|1|G (4TU0)
  • 2'-5' OLIGOADENYLATE TRIMER
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.3 Å2(2) 4TU0|1|G, 4TU0|1|F
757NR_all_72820.1
Exact match
Limbella pachyloma
4TUE|1|QV (4TUE)
  • P-site tRNA-fMet
  • X-RAY DIFFRACTION
  • Chain(s): QV; model(s): 1
3.5 Å77(2) 4TUE|1|QV, 4TUE|1|XV
758NR_all_39792.1
Exact match
Escherichia coli
4U7U|1|X (4U7U)
  • crRNA
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.0 Å61(2) 4U7U|1|X, 4U7U|1|L
759NR_all_48361.1
Exact match
Escherichia coli
4V49|1|B0 (4V49)
  • 23S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): B0; model(s): 1
8.7 Å2825(2) 4V49|1|B0, 4V4A|1|B0
760NR_all_59231.1
Exact match
Escherichia coli
4V49|1|B9 (4V49)
  • 5S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): B9; model(s): 1
8.7 Å118(2) 4V49|1|B9, 4V4A|1|B9
761NR_all_24471.1
Exact match
4V4R|1|AX (4V4R)
  • 5'-R(*AP*UP*GP*UP*UP*CP*UP*AP*GP*UP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): AX; model(s): 1
5.9 Å17(2) 4V4R|1|AX, 4V4T|1|AX
762NR_all_54761.1
Exact match
Thermus thermophilus
4V5G|1|AY (4V5G)
  • A-SITE TRNA THR
  • X-RAY DIFFRACTION
  • Chain(s): AY; model(s): 1
3.6 Å69(2) 4V5G|1|AY, 4V5G|1|CY
763NR_all_33072.1
Exact match
Canis lupus
4V5Z|1|BT (4V5Z)
  • RNA Expansion segment ES39 part III
  • ELECTRON MICROSCOPY
  • Chain(s): BT; model(s): 1
8.7 Å30(2) 4V5Z|1|BT, 4V5Z|1|BR
764NR_all_92714.1
Exact match
Canis lupus
4V5Z|1|BV (4V5Z)
  • RNA Expansion segment ES9 part2
  • ELECTRON MICROSCOPY
  • Chain(s): BV; model(s): 1
8.7 Å22(2) 4V5Z|1|BV, 4V5Z|1|BO
765NR_all_79672.1
Exact match
Pectobacterium parmentieri
4V7M|1|AY (4V7M)
  • tRNA-Gln
  • X-RAY DIFFRACTION
  • Chain(s): AY; model(s): 1
3.5 Å75(2) 4V7M|1|AY, 4V7M|1|CY
766NR_all_71771.1
Exact match
Thermus thermophilus
4V83|1|CV (4V83)
  • domain 3 of PSIC IGR IRES RNA
  • X-RAY DIFFRACTION
  • Chain(s): CV; model(s): 1
3.5 Å35(2) 4V83|1|CV, 4V83|1|AV
767NR_all_51196.1
Exact match
Thermus thermophilus
4V84|1|CV (4V84)
  • RNA (34-MER)
  • X-RAY DIFFRACTION
  • Chain(s): CV; model(s): 1
3.4 Å34(2) 4V84|1|CV, 4V84|1|AV
768NR_all_86129.1
Exact match
synthetic construct
4V85|1|AV (4V85)
  • messenger RNA
  • X-RAY DIFFRACTION
  • Chain(s): AV; model(s): 1
3.2 Å6(2) 4V85|1|AV, 4V89|1|AV
769NR_all_77709.1
Exact match
Saccharomyces cerevisiae
4V8Y|1|CW (4V8Y)
  • EUKARYOTIC RIBOSOMAL P_E TRNA
  • ELECTRON MICROSCOPY
  • Chain(s): CW; model(s): 1
4.3 Å74(2) 4V8Y|1|CW, 4V8Z|1|CW
770NR_all_40314.1
Exact match
Escherichia coli
4V9I|1|CY (4V9I)
  • A-SITE tRNA
  • X-RAY DIFFRACTION
  • Chain(s): CY; model(s): 1
3.3 Å75(2) 4V9I|1|CY, 4V9I|1|AY
771NR_all_00626.1
Exact match
Bacillus subtilis
4W92|1|C (4W92)
  • C-di-AMP ribsoswitch
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.2 Å96(2) 4W92|1|C, 4W90|1|C
772NR_all_16754.1
Exact match
Homo sapiens
4WKR|1|D (4WKR)
  • 7SK GGHP4 (300-332)
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.2 Å5(2) 4WKR|1|D, 4WKR|1|C
773NR_all_90162.1
Exact match
unidentified
4WQS|1|Y (4WQS)
  • RNA (5'-R(P*CP*CP*AP*GP*CP*CP*GP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
4.3 Å15(2) 4WQS|1|Y, 4WQS|1|H
774NR_all_55925.1
Exact match
Escherichia coli
4WSM|1|3L (4WSM)
  • tRNA-Leu
  • X-RAY DIFFRACTION
  • Chain(s): 3L; model(s): 1
3.3 Å75(2) 4WSM|1|3L, 4WSM|1|3K
775NR_all_97864.1
Exact match
synthetic construct
4WTD|1|T+4WTD|1|P (4WTD)
  • RNA PRIMER TEMPLATE AUAAAUUU
  • X-RAY DIFFRACTION
  • Chain(s): D, H, P, T; model(s): 1
2.7 Å8(2) 4WTD|1|T+4WTD|1|P, 5UJ2|1|T+5UJ2|1|P
776NR_all_13730.1
Exact match
Escherichia coli
4X9E|1|H (4X9E)
  • RNA (5'-R(P*CP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.1 Å3(2) 4X9E|1|H, 4X9E|1|G
777NR_all_69484.1
Exact match
Plautia stali intestine virus
4XEJ|1|BIRE (4XEJ)
  • IRES RNA
  • X-RAY DIFFRACTION
  • Chain(s): BIRE; model(s): 1
3.8 Å32(2) 4XEJ|1|BIRE, 4XEJ|1|AIRE
778NR_all_48352.1
Exact match
Actinomyces odontolyticus
4XWF|1|A (4XWF)
  • pfl RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.8 Å64(2) 4XWF|1|A, 4XW7|1|A
779NR_all_83641.1
Exact match
Escherichia coli
4Y1M|1|B (4Y1M)
  • E. coli yybP-ykoY riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å107(2) 4Y1M|1|B, 4Y1M|1|A
780NR_all_97050.1
Exact match
synthetic construct
4Y7N|1|R (4Y7N)
  • RNA (5'-D(*AP*UP*GP*GP*AP*GP*AP*GP*G)-3'[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.3 Å9(2) 4Y7N|1|R, 4Y52|1|R
781NR_all_39569.1
Exact match
Saccharomyces cerevisiae
4YYE|1|D (4YYE)
  • tRNA
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.3 Å74(2) 4YYE|1|D, 4YYE|1|C
782NR_all_98573.1
Exact match
synthetic construct
4Z0C|1|C (4Z0C)
  • DNA (5'-R(P*AP*CP*GP*GP*AP*AP*AP*GP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.3 Å13(2) 4Z0C|1|C, 4Z0C|1|B
783NR_all_80882.1
Exact match
Homo sapiens
4Z31|1|F (4Z31)
  • RNA (5'-R(*A)-D(P*UP*GP*UP*UP*CP*UP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.5 Å15(2) 4Z31|1|F, 4Z31|1|E
784NR_all_27625.1
Exact match
synthetic construct
4ZC7|1|C+4ZC7|1|D (4ZC7)
  • RNA duplex
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H; model(s): 1
3.0 Å21(2) 4ZC7|1|C+4ZC7|1|D, 4ZC7|1|A+4ZC7|1|B
785NR_all_45659.1
Exact match
synthetic construct
4ZNP|1|A (4ZNP)
  • pfI Riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å73(2) 4ZNP|1|A, 4ZNP|1|B
786NR_all_86148.1
Exact match
Escherichia coli
5A0T|1|F (5A0T)
  • 5'-R(*CP*GP*CP*CP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.3 Å6(2) 5A0T|1|F, 5A0T|1|E
787NR_all_60836.1
Exact match
Streptomyces coelicolor
5A0V|1|F (5A0V)
  • 5'-R(*CP*GP*CP*CP*UP*CP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.8 Å6(2) 5A0V|1|F, 5A0V|1|E
788NR_all_23840.1
Exact match
Drosophila melanogaster
5A18|1|A (5A18)
  • OSKAR MRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
32(2) 5A18|1|A, 5A17|1|A
789NR_all_09775.1
Exact match
Agrobacterium tumefaciens
5AH5|1|C (5AH5)
  • TRNA-LEU TAA ISOACCEPTOR
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.1 Å80(2) 5AH5|1|C, 5AH5|1|D
790NR_all_71445.1
Exact match
Yersinia pseudotuberculosis
5AJ0|1|Bv (5AJ0)
  • tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): Bv; model(s): 1
3.5 Å76(2) 5AJ0|1|Bv, 5AJ0|1|Bw
791NR_all_19551.1
Exact match
Sus scrofa
5AJ3|1|A (5AJ3)
  • MITORIBOSOMAL 12S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.6 Å960(2) 5AJ3|1|A, 5AJ4|1|AA
792NR_all_52445.1
Exact match
California encephalitis orthobunyavirus
5AMR|1|B+5AMR|1|C (5AMR)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, H; model(s): 1
2.6 Å16(2) 5AMR|1|B+5AMR|1|C, 5AMQ|1|B+5AMQ|1|c
793NR_all_31135.1
Exact match
synthetic construct
5AOR|1|D (5AOR)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.1 Å10(2) 5AOR|1|D, 5AOR|1|C
794NR_all_59099.1
Exact match
synthetic construct
5AOX|1|C (5AOX)
  • ALU JO CONSENSUS RNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.0 Å86(2) 5AOX|1|C, 5AOX|1|F
795NR_all_43992.1
Exact match
synthetic construct
5AWH|1|E (5AWH)
  • RNA (5'-D(P*UP*UP*AP*CP*AP*AP*CP*CP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.0 Å18(2) 5AWH|1|E, 5AWH|1|C
796NR_all_90160.3
Exact match
synthetic construct
5B2Q|1|B (5B2Q)
  • Guide RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.7 Å93(2) 5B2Q|1|B, 5B2O|1|B
797NR_all_63919.1
Exact match
Geobacillus stearothermophilus
5B63|1|B (5B63)
  • tRNA-Arg
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å63(2) 5B63|1|B, 5B63|1|D
798NR_all_74260.1
Exact match
Homo sapiens
5BTM|1|A (5BTM)
  • RNA (55-mer)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å43(2) 5BTM|1|A, 5BTM|1|B
799NR_all_76901.1
Exact match
synthetic construct
5BTP|1|A (5BTP)
  • RNA (62-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å62(2) 5BTP|1|A, 5BTP|1|B
800NR_all_74556.1
Exact match
synthetic construct
5BZV|1|B (5BZV)
  • RNA (5'-R(*UP*GP*UP*AP*CP*UP*AP*UP*A)-3'[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å9(2) 5BZV|1|B, 5BYM|1|C
801NR_all_11112.1
Exact match
synthetic construct
5C0W|1|R (5C0W)
  • RNA synthetic
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
4.6 Å12(2) 5C0W|1|R, 5C0W|1|N
802NR_all_56975.1
Exact match
synthetic construct
5CKK|1|D (5CKK)
  • RNA (5'-R(P*GP*CP*AP*CP*UP*AP*GP*AP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.8 Å15(2) 5CKK|1|D, 5CKI|1|D
803NR_all_02070.1
Exact match
Senecavirus A
5CNR|1|E+5CNR|1|F (5CNR)
  • RNA (5'-R(*GP*UP*CP*UP*AP*CP*CP*CP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, H; model(s): 1
2.6 Å16(2) 5CNR|1|E+5CNR|1|F, 5CNR|1|A+5CNR|1|B
804NR_all_96162.1
Exact match
Staphylococcus aureus
5CZZ|1|B (5CZZ)
  • RNA (73-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å73(2) 5CZZ|1|B, 5AXW|1|B
805NR_all_79481.1
Exact match
Trypanosoma brucei
5DA6|1|A (5DA6)
  • RNA (32-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å36(2) 5DA6|1|A, 4RBQ|1|A
806NR_all_67474.1
Exact match
Pyrococcus horikoshii
5DCV|1|D (5DCV)
  • RNA (47-MER)
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.4 Å46(2) 5DCV|1|D, 5DCV|1|B
807NR_all_16095.1
Exact match
Thermus thermophilus
5E17|1|I (5E17)
  • RNA (5'-R(*CP*CP*CP*UP*CP*GP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
3.2 Å7(2) 5E17|1|I, 5E18|1|I
808NR_all_32332.1
Exact match
Thermus thermophilus
5E81|1|3L (5E81)
  • tRNA-Lys
  • X-RAY DIFFRACTION
  • Chain(s): 3L; model(s): 1
3.0 Å72(2) 5E81|1|3L, 5E81|1|3K
809NR_all_45605.1
Exact match
Homo sapiens
5ED2|1|F+5ED2|1|E (5ED2)
  • RNA (5'-R(P*CP*AP*GP*AP*GP*CP*CP*CP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, H; model(s): 1
3.0 Å23(2) 5ED2|1|F+5ED2|1|E, 5ED2|1|C+5ED2|1|B
810NR_all_00179.1
Exact match
synthetic construct
5EIM|1|D (5EIM)
  • RNA (5'-R(*AP*UP*UP*AP*AP*AP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.5 Å8(2) 5EIM|1|D, 5EIM|1|C
811NR_all_09020.1
Exact match
synthetic construct
5ELT|1|F (5ELT)
  • RNA (5'-R(P*UP*AP*AP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.1 Å4(2) 5ELT|1|F, 5ELT|1|E
812NR_all_30433.1
Exact match
Homo sapiens
5EW4|1|B+5EW4|1|A (5EW4)
  • RNA (5'-R(*CP*CP*CP*CP*GP*GP*CP*CP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, H; model(s): 1
1.5 Å21(2) 5EW4|1|B+5EW4|1|A, 5EW7|1|B+5EW7|1|A
813NR_all_86832.1
Exact match
Haloarcula marismortui
5FJ0|1|C (5FJ0)
  • HMKT-7
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.2 Å19(2) 5FJ0|1|C, 5FJ0|1|A+5FJ0|1|B
814NR_all_70895.1
Exact match
Haloarcula marismortui
5FJ4|1|H (5FJ4)
  • HMKT-7
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.0 Å35(2) 5FJ4|1|H, 5FJ4|1|D
815NR_all_78714.1
Exact match
Influenza B virus
5FMZ|1|V (5FMZ)
  • 5'-R(*AP*GP*UP*AP*GP*UP*AP*AP*CP*AP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): V; model(s): 1
3.4 Å12(2) 5FMZ|1|V, 5FMZ|1|H
816NR_all_28269.1
Exact match
Lactococcus lactis
5G2X|1|A (5G2X)
  • GROUP II INTRON
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.8 Å692(2) 5G2X|1|A, 5G2Y|1|A
817NR_all_86169.1
Exact match
synthetic construct
5HAB|1|D (5HAB)
  • RNA (5'-R(P*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.3 Å5(2) 5HAB|1|D, 5HAB|1|C
818NR_all_23118.1
Exact match
synthetic construct
5HBY|1|A (5HBY)
  • RNA (5'-R(*(LCC)P*(LCC)P*(LCC)P*(LCG)P*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.2 Å9(2) 5HBY|1|A, 5V0K|1|A
819NR_all_91027.1
Exact match
Mycobacterium tuberculosis
5HK0|1|F (5HK0)
  • RNA (5'-R(*AP*GP*UP*C)-D(P*U)-R(P*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.3 Å1(2) 5HK0|1|F, 5HK0|1|E
820NR_all_65615.1
Exact match
Escherichia coli
5HR6|1|C (5HR6)
  • tRNA Glu
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å68(2) 5HR6|1|C, 5HR6|1|D
821NR_all_42502.1
Exact match
Escherichia coli
5HR7|1|D (5HR7)
  • tRNA Glu
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å70(2) 5HR7|1|D, 5HR7|1|C
822NR_all_56203.1
Exact match
synthetic construct
5I4A|1|D (5I4A)
  • RNA (5'-R(*UP*AP*UP*AP*CP*AP*AP*CP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.0 Å13(2) 5I4A|1|D, 5I4A|1|B
823NR_all_88410.1
Exact match
Salmonella enterica
5IMQ|1|4 (5IMQ)
  • P- site tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 4; model(s): 1
3.8 Å77(2) 5IMQ|1|4, 5IMR|1|4
824NR_all_04887.1
Exact match
Salmonella enterica
5IMR|1|5 (5IMR)
  • E site- tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 5; model(s): 1
5.7 Å76(2) 5IMR|1|5, 5IMQ|1|5
825NR_all_67371.1
Exact match
Kluyveromyces lactis
5IT7|1|7 (5IT7)
  • 5S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 7; model(s): 1
3.6 Å121(2) 5IT7|1|7, 4V91|1|3
826NR_all_15997.1
Exact match
Homo sapiens
5IYD|1|Z (5IYD)
  • RNA
  • ELECTRON MICROSCOPY
  • Chain(s): Z; model(s): 1
3.9 Å6(2) 5IYD|1|Z, 5IY9|1|Z
827NR_all_19209.1
Exact match
unidentified
5JAJ|1|X+5JAJ|1|Y (5JAJ)
  • RNA (5'-R(P*GP*GP*UP*AP*CP*GP*UP*AP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, H, X, Y; model(s): 1
1.5 Å13(2) 5JAJ|1|X+5JAJ|1|Y, 5JB2|1|X+5JB2|1|Y
828NR_all_93395.1
Exact match
Pyrococcus abyssi
5JB3|1|2 (5JB3)
  • 16S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
5.3 Å1495(2) 5JB3|1|2, 5JBH|1|2
829NR_all_53587.1
Exact match
Escherichia coli
5JU8|1|AX (5JU8)
  • P-site tRNA Aspartate
  • ELECTRON MICROSCOPY
  • Chain(s): AX; model(s): 1
3.6 Å67(2) 5JU8|1|AX, 5JTE|1|AX
830NR_all_06870.1
Exact match
Escherichia coli
5JU8|1|AY (5JU8)
  • E-site tRNA Valine
  • ELECTRON MICROSCOPY
  • Chain(s): AY; model(s): 1
3.6 Å65(2) 5JU8|1|AY, 5JTE|1|AY
831NR_all_71651.1
Exact match
Saccharomyces cerevisiae
5K78|1|Y (5K78)
  • branch 1 of branched RNA 5'-UACUAA(2'-GU[...]
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.6 Å4(2) 5K78|1|Y, 5K78|1|X
832NR_all_33619.1
Exact match
Saccharomyces cerevisiae
5K78|1|y (5K78)
  • branch 2 of branched RNA 5'-UACUAA(2'-GU[...]
  • X-RAY DIFFRACTION
  • Chain(s): y; model(s): 1
2.6 Å5(2) 5K78|1|y, 5K78|1|x
833NR_all_23226.1
Exact match
metagenome
5KTJ|1|C (5KTJ)
  • Pistol (50-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.0 Å49(2) 5KTJ|1|C, 5KTJ|1|A
834NR_all_10362.1
Exact match
Enterobacteria phage lambda
5LM7|1|G (5LM7)
  • RNA (29-MER)
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
3.4 Å27(2) 5LM7|1|G, 5LM7|1|R
835NR_all_86088.1
Exact match
Homo sapiens
5LR4|1|C+5LR4|1|D (5LR4)
  • RNA (5'-R(*GP*(CBV)P*CP*GP*GP*(6MZ)P*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H; model(s): 1
1.8 Å8(2) 5LR4|1|C+5LR4|1|D, 5LR4|1|A+5LR4|1|B
836NR_all_96413.1
Exact match
Homo sapiens
5LR5|1|C+5LR5|1|D (5LR5)
  • RNA (5'-R(*GP*GP*(6MZ)P*CP*UP*AP*GP*UP*([...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H; model(s): 1
2.4 Å8(2) 5LR5|1|C+5LR5|1|D, 5LR5|1|A+5LR5|1|B
837NR_all_32983.1
Exact match
Saccharomyces cerevisiae
5M5Y|1|R (5M5Y)
  • RNA
  • ELECTRON MICROSCOPY
  • Chain(s): R; model(s): 1
4.0 Å7(2) 5M5Y|1|R, 5M64|1|R
838NR_all_45609.1
Exact match
Saccharomyces cerevisiae
5MC6|1|m (5MC6)
  • A-site tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): m; model(s): 1
3.8 Å76(2) 5MC6|1|m, 5GAK|1|A
839NR_all_32990.1
Exact match
Saccharomyces cerevisiae
5MC6|1|n (5MC6)
  • P-site tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): n; model(s): 1
3.8 Å77(2) 5MC6|1|n, 5GAK|1|B
840NR_all_72335.1
Exact match
5MSF|1|R (5MSF)
  • 5'-R(*CP*CP*GP*GP*AP*GP*GP*AP*UP*CP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.8 Å18(2) 5MSF|1|R, 5MSF|1|S
841NR_all_45098.1
Exact match
Escherichia coli
5O2R|1|x (5O2R)
  • P-site Ile-tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): x; model(s): 1
3.4 Å77(2) 5O2R|1|x, 5KCS|1|1x
842NR_all_64115.1
Exact match
Mycobacterium smegmatis
5O60|1|A (5O60)
  • 23S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.2 Å3119(2) 5O60|1|A, 5O61|1|A
843NR_all_45569.1
Exact match
Mycobacterium smegmatis
5O61|1|B (5O61)
  • 5S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
3.3 Å118(2) 5O61|1|B, 5O60|1|B
844NR_all_12033.1
Exact match
Mycobacterium smegmatis
5O61|1|BA (5O61)
  • 16S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): BA; model(s): 1
3.3 Å1511(2) 5O61|1|BA, 5O5J|1|A
845NR_all_23975.1
Exact match
Shewanella putrefaciens
5O6U|1|A (5O6U)
  • crRNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.3 Å43(2) 5O6U|1|A, 5O7H|1|A
846NR_all_58139.1
Exact match
Homo sapiens
5O9Z|1|4+5O9Z|1|2+5O9Z|1|6 (5O9Z)
  • Homo sapiens U4A snRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 2, 4, 6, D, H; model(s): 1
4.5 Å137(2) 5O9Z|1|4+5O9Z|1|2+5O9Z|1|6, 3JCR|1|M
847NR_all_36683.1
Exact match
Leishmania donovani
5T2A|1|A+5T2A|1|C (5T2A)
  • LSU-alpha
  • ELECTRON MICROSCOPY
  • Chain(s): 6, A, C, D, H; model(s): 1
2.9 Å1603(2) 5T2A|1|A+5T2A|1|C, 3JCS|1|1+3JCS|1|7
848NR_all_69984.1
Exact match
Leishmania donovani
5T2A|1|D (5T2A)
  • 5S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
2.9 Å119(2) 5T2A|1|D, 3JCS|1|8
849NR_all_01258.1
Exact match
Leishmania donovani
5T2A|1|G (5T2A)
  • srRNA2
  • ELECTRON MICROSCOPY
  • Chain(s): G; model(s): 1
2.9 Å183(2) 5T2A|1|G, 3JCS|1|4
850NR_all_74018.1
Exact match
Staphylococcus aureus
5TCU|1|E (5TCU)
  • P-site tRNA CHAIN
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
3.9 Å75(2) 5TCU|1|E, 5TCU|1|D
851NR_all_38581.1
Exact match
Thermobifida fusca
5U07|1|K (5U07)
  • crRNA
  • ELECTRON MICROSCOPY
  • Chain(s): K; model(s): 1
3.8 Å59(2) 5U07|1|K, 5U0A|1|K
852NR_all_14902.1
Exact match
synthetic construct
5UX0|1|E (5UX0)
  • RNA (5'-R(*G*GP*UP*AP*CP*AP*AP*CP*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.2 Å18(2) 5UX0|1|E, 5UX0|1|B
853NR_all_93701.1
Exact match
synthetic construct
5V3F|1|A (5V3F)
  • RNA (31-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.7 Å31(2) 5V3F|1|A, 5V3F|1|B
854NR_all_60079.1
Exact match
Campylobacter jejuni
5X2G|1|B (5X2G)
  • sgRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å93(2) 5X2G|1|B, 5X2H|1|B
855NR_all_09224.1
Exact match
Homo sapiens
5XJC|1|H+5XJC|1|F (5XJC)
  • Homo sapiens small nuclear RNA (U2) gene
  • ELECTRON MICROSCOPY
  • Chain(s): 6, D, F, H; model(s): 1
3.6 Å140(2) 5XJC|1|H+5XJC|1|F, 5MQF|1|2+5MQF|1|6
856NR_all_60411.1
Exact match
7MSF|1|R (7MSF)
  • 5'-R(*UP*CP*GP*CP*CP*AP*AP*CP*AP*GP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.8 Å14(2) 7MSF|1|R, 7MSF|1|S
857NR_all_03375.1
Exact match
8PSH|1|B (8PSH)
  • RNA (5'-R(*CP*CP*UP*GP*AP*CP*GP*C)-3')
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
8(2) 8PSH|1|B, 8DRH|1|B
858NR_all_54274.1
Exact match
124D|1|B (124D)
  • RNA (5'-R(*CP*AP*UP*GP*UP*GP*AP*C)-3')
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
8(1) 124D|1|B
859NR_all_00122.1
Exact match
165D|1|A+165D|1|B (165D)
  • DNA/RNA (5'-R(*GP*CP*UP*UP*CP*GP*GP*CP*)[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, A, B, D, H; model(s): 1
1.6 Å8(1) 165D|1|A+165D|1|B
860NR_all_61072.1
Exact match
176D|1|B (176D)
  • RNA (5'-R(P*GP*AP*GP*UP*UP*C)-3')
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
6(1) 176D|1|B
861NR_all_82060.1
Exact match
17RA|7|A (17RA)
  • RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 7
21(1) 17RA|7|A
862NR_all_65529.1
Exact match
1A1T|1|B (1A1T)
  • SL3 STEM-LOOP RNA
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
20(1) 1A1T|1|B
863NR_all_91199.1
Exact match
1A3M|1|A+1A3M|1|B (1A3M)
  • 16S RRNA (5'-R(*GP*GP*CP*GP*UP*CP*AP*CP*[...]
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
14(1) 1A3M|1|A+1A3M|1|B
864NR_all_66286.1
Exact match
Escherichia coli
1A4D|1|A+1A4D|1|B (1A4D)
  • RNA (5'-R(*GP*GP*CP*CP*GP*AP*UP*GP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
21(1) 1A4D|1|A+1A4D|1|B
865NR_all_04124.1
Exact match
1A4T|1|A (1A4T)
  • BOXB RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(1) 1A4T|1|A
866NR_all_65451.1
Exact match
Escherichia coli
1A51|3|A (1A51)
  • 5S RRNA LOOP D/LOOP E
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
41(1) 1A51|3|A
867NR_all_93153.1
Exact match
Turnip yellow mosaic virus
1A60|1|A (1A60)
  • TYMV PSEUDOKNOT
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
44(1) 1A60|1|A
868NR_all_84970.1
Exact match
1AC3|1|B (1AC3)
  • DNA (5'-D(*(TCP)P*TP*GP*CP*GP*C)-3')
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
12(1) 1AC3|1|B
869NR_all_83722.1
Exact match
1AFX|2|A (1AFX)
  • RNA (5'-R(*GP*GP*UP*GP*UP*GP*AP*AP*CP*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
12(1) 1AFX|2|A
870NR_all_62040.1
Exact match
1AJF|1|A (1AJF)
  • RNA (5'-R(*GP*AP*CP*AP*GP*GP*GP*GP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
18(1) 1AJF|1|A
871NR_all_52254.1
Exact match
Tetrahymena thermophila
1AJL|1|A+1AJL|1|B (1AJL)
  • RNA (5'-R(*GP*GP*UP*AP*AP*UP*AP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
12(1) 1AJL|1|A+1AJL|1|B
872NR_all_57473.1
Exact match
1AJT|1|A+1AJT|1|B (1AJT)
  • RNA (5'-R(*GP*GP*UP*AP*AP*UP*AP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
12(1) 1AJT|1|A+1AJT|1|B
873NR_all_29722.1
Exact match
1AJU|9|A (1AJU)
  • TAR RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 9
30(1) 1AJU|9|A
874NR_all_18727.1
Exact match
1AKX|1|A (1AKX)
  • TAR RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
30(1) 1AKX|1|A
875NR_all_07975.1
Exact match
1AL5|1|A+1AL5|1|B (1AL5)
  • RNA (5'-R(*CP*GP*CP*AP*AP*AP*UP*UP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
12(1) 1AL5|1|A+1AL5|1|B
876NR_all_34704.1
Exact match
1AM0|2|A (1AM0)
  • RNA APTAMER
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
16(1) 1AM0|2|A
877NR_all_52900.1
Exact match
1ANR|2|A (1ANR)
  • RNA REGULATORY ELEMENT TAR
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
29(1) 1ANR|2|A
878NR_all_00390.1
Exact match
1AQO|3|A (1AQO)
  • IRON RESPONSIVE ELEMENT RNA HAIRPIN
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
29(1) 1AQO|3|A
879NR_all_76462.1
Exact match
1ARJ|7|N (1ARJ)
  • TAR RNA
  • SOLUTION NMR
  • Chain(s): N; model(s): 7
29(1) 1ARJ|7|N
880NR_all_47387.1
Exact match
Hepatitis delta virus
1ATO|1|A (1ATO)
  • RNA (5'-R(*GP*GP*CP*AP*CP*CP*UP*CP*CP*UP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
19(1) 1ATO|1|A
881NR_all_07425.1
Exact match
1ATV|1|A (1ATV)
  • RNA (5'-R(*GP*GP*GP*AP*CP*CP*AP*GP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
17(1) 1ATV|1|A
882NR_all_70406.1
Exact match
1ATW|1|A (1ATW)
  • RNA (5'-R(*GP*CP*UP*CP*CP*AP*GP*AP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(1) 1ATW|1|A
883NR_all_89800.1
Exact match
1AUD|8|B (1AUD)
  • RNA 3UTR
  • SOLUTION NMR
  • Chain(s): B; model(s): 8
30(1) 1AUD|8|B
884NR_all_76648.1
Exact match
1AV6|1|B (1AV6)
  • RNA (5'-R(*GP*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å6(1) 1AV6|1|B
885NR_all_34221.1
Exact match
Escherichia coli
1B23|1|R (1B23)
  • CYSTEINYL TRNA
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.6 Å66(1) 1B23|1|R
886NR_all_14284.1
Exact match
synthetic construct
1B36|8|A (1B36)
  • RNA (RNA LOOP B)
  • SOLUTION NMR
  • Chain(s): A; model(s): 8
38(1) 1B36|8|A
887NR_all_61964.1
Exact match
1B7F|1|P (1B7F)
  • RNA (5'-R(P*GP*UP*UP*GP*UP*UP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.6 Å12(1) 1B7F|1|P
888NR_all_09952.1
Exact match
1B7F|1|Q (1B7F)
  • RNA (5'-R(P*GP*UP*UP*GP*UP*UP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
2.6 Å12(1) 1B7F|1|Q
889NR_all_25450.1
Exact match
1BAU|1|A+1BAU|1|B (1BAU)
  • SL1 RNA DIMER
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
23(1) 1BAU|1|A+1BAU|1|B
890NR_all_82965.1
Exact match
1BGZ|1|A (1BGZ)
  • RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 1BGZ|1|A
891NR_all_45541.1
Exact match
1BIV|5|A (1BIV)
  • BOVINE IMMUNODEFICIENCY VIRUS TAR RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
28(1) 1BIV|5|A
892NR_all_11198.1
Exact match
1BMV|1|M (1BMV)
  • RNA (5'-R(*GP*GP*UP*CP*AP*AP*AP*AP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
3.0 Å11(1) 1BMV|1|M
893NR_all_64055.1
Exact match
1BN0|2|A (1BN0)
  • SL3 RNA HAIRPIN
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
20(1) 1BN0|2|A
894NR_all_10796.1
Exact match
1BR3|1|A (1BR3)
  • RNA (5'-R(*GP*GP*AP*CP*AP*GP*AP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å13(1) 1BR3|1|A
895NR_all_76134.1
Exact match
Human immunodeficiency virus 1
1BVJ|1|A (1BVJ)
  • RNA (5'-R(P*GP*GP*CP*GP*AP*CP*GP*GP*UP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 1BVJ|1|A
896NR_all_32222.1
Exact match
1BYX|1|A (1BYX)
  • RNA (5'-R(*GP*CP*AP*GP*UP*GP*GP*C)-3')
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
8(1) 1BYX|1|A
897NR_all_25417.1
Exact match
1BZ2|1|A (1BZ2)
  • TRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
17(1) 1BZ2|1|A
898NR_all_69912.1
Exact match
1BZU|1|A (1BZU)
  • TRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 1BZU|1|A
899NR_all_48565.1
Exact match
Tetrahymena thermophila
1C0O|1|A (1C0O)
  • RNA (5'-R(*GP*GP*GP*UP*CP*UP*UP*CP*GP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 1C0O|1|A
900NR_all_98506.1
Exact match
1C4L|1|A+1C4L|1|B (1C4L)
  • RNA (5'-R(*CP*GP*AP*CP*UP*CP*AP*GP*G)-3'[...]
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
9(1) 1C4L|1|A+1C4L|1|B
901NR_all_55702.1
Exact match
1C9S|1|W (1C9S)
  • SINGLE STRANDED RNA (55-MER)
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
1.9 Å55(1) 1C9S|1|W
902NR_all_53157.1
Exact match
1CSL|1|B+1CSL|1|A (1CSL)
  • 5'-R(*UP*CP*UP*GP*AP*CP*GP*GP*UP*AP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, A, B, D, H; model(s): 1
1.6 Å15(1) 1CSL|1|B+1CSL|1|A
903NR_all_85902.1
Exact match
1CVJ|1|M (1CVJ)
  • 5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
2.6 Å9(1) 1CVJ|1|M
904NR_all_87059.1
Exact match
1CVJ|1|Q (1CVJ)
  • 5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
2.6 Å9(1) 1CVJ|1|Q
905NR_all_05106.1
Exact match
1CWP|1|D (1CWP)
  • RNA (5'-R(*AP*UP*AP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.2 Å4(1) 1CWP|1|D
906NR_all_15685.1
Exact match
1CWP|1|F (1CWP)
  • RNA (5'-R(*AP*UP*AP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.2 Å4(1) 1CWP|1|F
907NR_all_63585.1
Exact match
1CX5|1|B (1CX5)
  • 5'-R(*GP*CP*GP*CP*AP*AP*AP*AP*CP*GP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
12(1) 1CX5|1|B
908NR_all_26549.1
Exact match
1D0T|1|A (1D0T)
  • PHOSPHOROTHIOATE SUBSTITUTED PHAGE MS2 R[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 1D0T|1|A
909NR_all_33353.1
Exact match
1D0U|14|A (1D0U)
  • PHAGE MS2 RNA BINDING SITE
  • SOLUTION NMR
  • Chain(s): A; model(s): 14
21(1) 1D0U|14|A
910NR_all_26988.1
Exact match
1D6K|4|B (1D6K)
  • 5S RRNA E-LOOP (5SE)
  • SOLUTION NMR
  • Chain(s): B; model(s): 4
37(1) 1D6K|4|B
911NR_all_03657.1
Exact match
1DDL|1|D (1DDL)
  • RNA (5'-R(P*UP*UP*UP*UP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.7 Å7(1) 1DDL|1|D
912NR_all_14136.1
Exact match
1DFU|1|M+1DFU|1|N (1DFU)
  • 5S RRNA
  • X-RAY DIFFRACTION
  • Chain(s): 6, D, H, M, N; model(s): 1
1.8 Å19(1) 1DFU|1|M+1DFU|1|N
913NR_all_14653.1
Exact match
1DQF|1|B+1DQF|1|A (1DQF)
  • RNA (5'-R(*CP*AP*GP*GP*GP*UP*CP*GP*GP*C)[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, A, B, D, H; model(s): 1
2.2 Å10(1) 1DQF|1|B+1DQF|1|A
914NR_all_57060.1
Exact match
1DQH|1|B+1DQH|1|A (1DQH)
  • RNA (5'-R(*CP*AP*GP*GP*GP*UP*CP*GP*GP*C)[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, A, B, D, H; model(s): 1
1.7 Å10(1) 1DQH|1|B+1DQH|1|A
915NR_all_62339.1
Exact match
1DRR|1|B (1DRR)
  • RNA (5'-R(*GP*CP*UP*UP*CP*UP*CP*UP*UP*C)[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
10(1) 1DRR|1|B
916NR_all_99432.1
Exact match
1DUH|1|A (1DUH)
  • 4.5S RNA DOMAIN IV
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å44(1) 1DUH|1|A
917NR_all_56977.1
Exact match
Homo sapiens
1DZ5|1|C+1DZ5|1|D (1DZ5)
  • PIE, RNA (5'-R(*GP*AP*GP*AP*CP*AP*UP*UP*[...]
  • SOLUTION NMR
  • Chain(s): 6, C, D, H; model(s): 1
22(1) 1DZ5|1|C+1DZ5|1|D
918NR_all_66000.1
Exact match
1E4P|8|A (1E4P)
  • RNA (5'-R(*GP*UP*GP*CP*GP*AP*AP*GP*AP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 8
24(1) 1E4P|8|A
919NR_all_19932.1
Exact match
Homo sapiens
1E8S|1|C (1E8S)
  • 7SL RNA, 88-MER
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
4.0 Å86(1) 1E8S|1|C
920NR_all_15923.1
Exact match
Mason-Pfizer monkey virus
1E95|14|A (1E95)
  • RNA (5'-(*GP*CP*GP*GP*CP*CP*AP*GP*CP*UP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 14
36(1) 1E95|14|A
921NR_all_24762.1
Exact match
1EBQ|1|A (1EBQ)
  • HIV-1 REV RESPONSIVE ELEMENT RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
29(1) 1EBQ|1|A
922NR_all_17006.1
Exact match
1EBR|1|A (1EBR)
  • HIV-1 REV RESPONSIVE ELEMENT RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
30(1) 1EBR|1|A
923NR_all_02783.1
Exact match
1EBS|1|A (1EBS)
  • HIV-1 REV RESPONSIVE ELEMENT RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
29(1) 1EBS|1|A
924NR_all_94113.1
Exact match
1EC6|1|C (1EC6)
  • 20-MER RNA HAIRPIN
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.4 Å20(1) 1EC6|1|C
925NR_all_53294.1
Exact match
1EC6|1|D (1EC6)
  • 20-MER RNA HAIRPIN
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å20(1) 1EC6|1|D
926NR_all_73942.1
Exact match
1EFO|1|B (1EFO)
  • RNA (5'-R(*GP*AP*AP*GP*AP*GP*AP*GP*AP*G)[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å10(1) 1EFO|1|B
927NR_all_58575.1
Exact match
1EFS|1|B (1EFS)
  • RNA (5'-R(*UP*UP*CP*UP*CP*UP*UP*CP*CP*UP[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
13(1) 1EFS|1|B
928NR_all_98716.1
Exact match
1EI2|9|A (1EI2)
  • TAU EXON 10 SRE RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 9
25(1) 1EI2|9|A
929NR_all_88865.1
Exact match
1EJZ|1|A (1EJZ)
  • RNA (5'-R(*CP*GP*CP*UP*AP*CP*GP*C)-3')
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
8(1) 1EJZ|1|A
930NR_all_78038.1
Exact match
1EKA|1|A+1EKA|1|B (1EKA)
  • RNA (5'-R(*GP*AP*GP*UP*GP*CP*UP*C)-3')
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
8(1) 1EKA|1|A+1EKA|1|B
931NR_all_85681.1
Exact match
1EKZ|4|B (1EKZ)
  • STAUFEN DOUBLE-STRANDED RNA BINDING DOMA[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 4
30(1) 1EKZ|4|B
932NR_all_97306.1
Exact match
Escherichia coli
1ELH|1|B+1ELH|1|A (1ELH)
  • RNA (5'-R(*AP*AP*CP*UP*GP*CP*CP*AP*GP*GP[...]
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
13(1) 1ELH|1|B+1ELH|1|A
933NR_all_64125.1
Exact match
Thermus thermophilus
1EMI|1|B (1EMI)
  • 16S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
7.5 Å161(1) 1EMI|1|B
934NR_all_39732.1
Exact match
1ESH|1|A (1ESH)
  • RNA (5'-R(*GP*GP*UP*GP*CP*AP*UP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 1ESH|1|A
935NR_all_41120.1
Exact match
1ESY|2|A (1ESY)
  • RNA (5'-R(P*GP*GP*CP*GP*AP*CP*UP*GP*GP*U[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
19(1) 1ESY|2|A
936NR_all_55696.1
Exact match
1EXY|1|A (1EXY)
  • RNA APTAMER, 33-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
33(1) 1EXY|1|A
937NR_all_74421.1
Exact match
1F1T|1|A (1F1T)
  • MALACHITE GREEN APTAMER RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å33(1) 1F1T|1|A
938NR_all_16825.1
Exact match
1F27|1|A (1F27)
  • RNA (5'-R(*AP*CP*CP*GP*UP*CP*AP*GP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.3 Å19(1) 1F27|1|A
939NR_all_98048.1
Exact match
1F5G|1|A+1F5G|1|B (1F5G)
  • 5'-R(*GP*CP*AP*GP*GP*CP*GP*UP*GP*C)-3'
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
10(1) 1F5G|1|A+1F5G|1|B
940NR_all_56050.1
Exact match
1F5H|1|A+1F5H|1|B (1F5H)
  • 5'-R(*GP*CP*AP*GP*GP*CP*GP*UP*GP*C)-3'
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
10(1) 1F5H|1|A+1F5H|1|B
941NR_all_81739.1
Exact match
1F6U|2|B (1F6U)
  • HIV-1 STEM-LOOP SL2 FROM PSI-RNA PACKAGI[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 2
18(1) 1F6U|2|B
942NR_all_83539.1
Exact match
1F7G|1|A (1F7G)
  • RNASE P RNA RIBOZYME, P4 DOMAIN
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 1F7G|1|A
943NR_all_00165.1
Exact match
1F7H|5|A (1F7H)
  • RNASE P RNA RIBOZYME, P4 DOMAIN
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
27(1) 1F7H|5|A
944NR_all_34881.1
Exact match
1F84|10|A (1F84)
  • HCV-1B IRES RNA DOMAIN IIID
  • SOLUTION NMR
  • Chain(s): A; model(s): 10
29(1) 1F84|10|A
945NR_all_09578.1
Exact match
1F85|1|A (1F85)
  • HCV-1B IRES RNA DOMAIN IIIE
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 1F85|1|A
946NR_all_08337.1
Exact match
Pariacoto virus
1F8V|1|R (1F8V)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.0 Å25(1) 1F8V|1|R
947NR_all_93725.1
Exact match
1F9L|1|A (1F9L)
  • 5'-R(*GP*GP*CP*GP*AP*AP*GP*UP*CP*GP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 1F9L|1|A
948NR_all_17816.1
Exact match
1FEQ|1|A (1FEQ)
  • 5'-R(*GP*CP*AP*GP*AP*CP*UP*UP*UP*UP*(T6A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 1FEQ|1|A
949NR_all_84438.1
Exact match
1FHK|4|A (1FHK)
  • RNA (5'-R(*GP*GP*CP*GP*GP*UP*GP*AP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
14(1) 1FHK|4|A
950NR_all_90775.1
Exact match
Bos taurus
1FIR|1|A (1FIR)
  • HIV-1 REVERSE TRANSCRIPTION PRIMER TRNA([...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.3 Å62(1) 1FIR|1|A
951NR_all_92759.1
Exact match
1FIX|1|A (1FIX)
  • RNA (5'-R(*UP*UP*CP*GP*GP*GP*CP*GP*CP*C)[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å10(1) 1FIX|1|A
952NR_all_93461.1
Exact match
1FJE|1|A (1FJE)
  • SNRE RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 1FJE|1|A
953NR_all_58357.1
Exact match
Thermus thermophilus
1FJG|1|X (1FJG)
  • FRAGMENT OF MESSENGER RNA
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.0 Å6(1) 1FJG|1|X
954NR_all_15840.1
Exact match
1FL8|1|A (1FL8)
  • ANTICODON DOMAIN OF TRNA(LYS)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 1FL8|1|A
955NR_all_57703.1
Exact match
1FMN|1|A (1FMN)
  • RNA (5'-R(*GP*GP*CP*GP*UP*GP*UP*AP*GP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
35(1) 1FMN|1|A
956NR_all_30413.1
Exact match
1FNX|1|R (1FNX)
  • AU-RICH RNA ELEMENT
  • SOLUTION NMR
  • Chain(s): R; model(s): 1
10(1) 1FNX|1|R
957NR_all_18069.1
Exact match
1FQZ|1|A (1FQZ)
  • HEPATITIS C VIRUS IRES DOMAIN IIID
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 1FQZ|1|A
958NR_all_50004.1
Exact match
1FXL|1|B (1FXL)
  • 5'-R(P*UP*UP*UP*UP*AP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å9(1) 1FXL|1|B
959NR_all_52226.1
Exact match
1FYP|1|A (1FYP)
  • FRAGMENT OF 18S RIBOSOMAL RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 1FYP|1|A
960NR_all_13125.1
Exact match
1G1X|1|D+1G1X|1|E (1G1X)
  • 16S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): 6, D, E, H; model(s): 1
2.6 Å40(1) 1G1X|1|D+1G1X|1|E
961NR_all_40657.1
Exact match
1G1X|1|J+1G1X|1|I (1G1X)
  • 16S RIBOSOMAL RNA
  • X-RAY DIFFRACTION
  • Chain(s): 6, D, H, I, J; model(s): 1
2.6 Å44(1) 1G1X|1|J+1G1X|1|I
962NR_all_88266.1
Exact match
1G2E|1|B (1G2E)
  • 5'-R(P*UP*AP*UP*UP*UP*AP*UP*UP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å10(1) 1G2E|1|B
963NR_all_36794.1
Exact match
1G2J|1|A (1G2J)
  • 5'-R(*CP*CP*CP*(PYY)P*GP*GP*GP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å7(1) 1G2J|1|A
964NR_all_28653.1
Exact match
Human immunodeficiency virus 1
1G70|1|A (1G70)
  • HIV-1 RRE-IIB 32 NUCLEOTIDE RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
32(1) 1G70|1|A
965NR_all_84424.1
Exact match
1GTN|1|W (1GTN)
  • (GAGCC)11G 56-NUCLEOTIDE RNA
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
2.5 Å44(1) 1GTN|1|W
966NR_all_10396.1
Exact match
1GUC|1|A+1GUC|1|B (1GUC)
  • RNA (5'-R(*GP*AP*GP*GP*UP*CP*UP*C)-3')
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
8(1) 1GUC|1|A+1GUC|1|B
967NR_all_15880.1
Exact match
1H0Q|1|B (1H0Q)
  • 5-R(*GP*CP*AP*UP*AP*UP*CP*AP*G)-3
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
9(1) 1H0Q|1|B
968NR_all_13221.1
Exact match
Thermus thermophilus
1H3E|1|B (1H3E)
  • WILD-TYPE TRNATYR(GUA)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å80(1) 1H3E|1|B
969NR_all_40229.1
Exact match
1HHW|1|B (1HHW)
  • 5- R(*GP*CP*AP*UP*AP*UP*CP*AP*G) -3
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
9(1) 1HHW|1|B
970NR_all_81539.1
Exact match
1HLX|1|A (1HLX)
  • RNA (5'-R(*GP*GP*GP*AP*UP*AP*AP*CP*UP*UP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
20(1) 1HLX|1|A
971NR_all_82681.1
Exact match
1HMH|1|A (1HMH)
  • HAMMERHEAD RIBOZYME-RNA STRAND
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.6 Å34(1) 1HMH|1|A
972NR_all_65794.1
Exact match
1HS1|1|A (1HS1)
  • 5'-R(*GP*CP*GP*UP*UP*AP*AP*CP*UP*CP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 1HS1|1|A
973NR_all_87560.1
Exact match
1HS2|1|A (1HS2)
  • 5'-R(*GP*CP*GP*UP*UP*AP*AP*GP*UP*CP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 1HS2|1|A
974NR_all_52164.1
Exact match
1HS3|1|A (1HS3)
  • 5'-R(*GP*CP*GP*UP*UP*AP*AP*UP*UP*CP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 1HS3|1|A
975NR_all_91356.1
Exact match
1HS4|1|A (1HS4)
  • 5'-R(*GP*CP*GP*UP*UP*AP*AP*AP*UP*CP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 1HS4|1|A
976NR_all_90481.1
Exact match
1HS8|1|A (1HS8)
  • 5'-R(*GP*CP*GP*UP*CP*AP*AP*UP*UP*CP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 1HS8|1|A
977NR_all_58813.1
Exact match
1HWQ|1|A (1HWQ)
  • VS RIBOZYME SUBSTRATE RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
30(1) 1HWQ|1|A
978NR_all_23180.1
Exact match
1HYS|1|E (1HYS)
  • 5'-R(*UP*CP*AP*GP*CP*CP*AP*CP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.0 Å23(1) 1HYS|1|E
979NR_all_92805.1
Exact match
1I3X|1|A (1I3X)
  • 5'-R(*GP*GP*CP*UP*GP*GP*CP*UP*GP*UP*UP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
19(1) 1I3X|1|A
980NR_all_11512.1
Exact match
1I3Y|8|A (1I3Y)
  • 5'-R(*GP*GP*CP*UP*GP*GP*CP*(OMU)P*GP*UP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 8
18(1) 1I3Y|8|A
981NR_all_18772.1
Exact match
1I46|1|A (1I46)
  • 5'-R(*GP*GP*UP*GP*CP*GP*UP*AP*GP*CP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 1I46|1|A
982NR_all_84674.1
Exact match
1I4B|1|A (1I4B)
  • 5'-R(*GP*GP*UP*GP*CP*UP*UP*AP*GP*CP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 1I4B|1|A
983NR_all_14769.1
Exact match
1I4C|1|A (1I4C)
  • RNA (5'-R(*GP*GP*UP*GP*CP*UP*UP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 1I4C|1|A
984NR_all_77921.1
Exact match
1I6H|1|R (1I6H)
  • 5'-R(P*GP*AP*CP*CP*AP*GP*GP*CP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.3 Å9(1) 1I6H|1|R
985NR_all_16044.1
Exact match
1I9X|1|A+1I9X|1|B (1I9X)
  • 5'-R(*UP*AP*CP*UP*AP*AP*CP*GP*UP*AP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, A, B, D, H; model(s): 1
2.2 Å13(1) 1I9X|1|A+1I9X|1|B
986NR_all_50490.1
Exact match
1IDV|1|A (1IDV)
  • HEPATITIS C IRES RNA DOMAIN IIIC
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
10(1) 1IDV|1|A
987NR_all_34670.1
Exact match
1IE1|4|A (1IE1)
  • 5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*UP*CP*CP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
22(1) 1IE1|4|A
988NR_all_72484.1
Exact match
1IE2|16|A (1IE2)
  • 5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*UP*CP*CP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 16
22(1) 1IE2|16|A
989NR_all_83520.1
Exact match
1IK1|1|A (1IK1)
  • 5'-R(*GP*GP*UP*AP*CP*UP*AP*UP*GP*UP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 1IK1|1|A
990NR_all_85144.1
Exact match
1IKD|24|A (1IKD)
  • TRNA ALA ACCEPTOR STEM
  • SOLUTION NMR
  • Chain(s): A; model(s): 24
22(1) 1IKD|24|A
991NR_all_70420.1
Exact match
1J1U|1|B (1J1U)
  • tRNA(Tyr)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å74(1) 1J1U|1|B
992NR_all_94445.1
Exact match
1J4Y|1|A (1J4Y)
  • anticodon stem-loop of tRNA(Phe)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
17(1) 1J4Y|1|A
993NR_all_26846.1
Exact match
1JBR|1|C+1JBR|1|F (1JBR)
  • 5'-R(*GP*CP*GP*CP*UP*CP*CP*UP*CP*AP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, C, D, F, H; model(s): 1
2.2 Å17(1) 1JBR|1|C+1JBR|1|F
994NR_all_29474.1
Exact match
1JO7|18|A (1JO7)
  • Influenza A virus promoter RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 18
31(1) 1JO7|18|A
995NR_all_15327.1
Exact match
1JOX|1|A (1JOX)
  • 5'-R(*GP*GP*CP*GP*GP*UP*GP*CP*UP*GP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
21(1) 1JOX|1|A
996NR_all_67308.1
Exact match
1JP0|1|A (1JP0)
  • 5'-R(*GP*GP*CP*GP*GP*UP*GP*CP*UP*GP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
21(1) 1JP0|1|A
997NR_all_66081.1
Exact match
1JTJ|1|A (1JTJ)
  • HIV-1Lai SL1
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 1JTJ|1|A
998NR_all_37285.1
Exact match
1JTW|5|A (1JTW)
  • 5'-R(*GP*GP*GP*UP*GP*CP*GP*AP*GP*AP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
16(1) 1JTW|5|A
999NR_all_79227.1
Exact match
1JU1|1|A+1JU1|1|B (1JU1)
  • HIV-1Lai SL1
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
23(1) 1JU1|1|A+1JU1|1|B
1000NR_all_25049.1
Exact match
1JUR|1|A (1JUR)
  • 5'-R(*GP*GP*CP*CP*UP*GP*AP*GP*GP*AP*GP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 1JUR|1|A
1001NR_all_90540.1
Exact match
1JZC|1|A (1JZC)
  • 5'-R(*GP*GP*UP*GP*CP*AP*UP*GP*GP*CP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 1JZC|1|A
1002NR_all_46215.1
Exact match
1K1G|1|B (1K1G)
  • 5'-R(*UP*AP*UP*AP*CP*UP*AP*AP*CP*AP*A)-3[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
11(1) 1K1G|1|B
1003NR_all_13408.1
Exact match
1K2G|1|A (1K2G)
  • 5'-R(*CP*AP*GP*AP*CP*UP*UP*CP*GP*GP*UP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 1K2G|1|A
1004NR_all_07899.1
Exact match
1K4A|1|A (1K4A)
  • 5'-R(*GP*GP*UP*UP*CP*AP*GP*AP*AP*GP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 1K4A|1|A
1005NR_all_18222.1
Exact match
1K4B|1|A (1K4B)
  • 5'-R(*GP*GP*UP*UP*CP*AP*GP*UP*UP*GP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 1K4B|1|A
1006NR_all_70019.1
Exact match
1K5I|2|A (1K5I)
  • 5'-R(P*GP*GP*AP*CP*CP*CP*GP*GP*GP*CP*UP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
23(1) 1K5I|2|A
1007NR_all_30897.1
Exact match
1K6G|2|A (1K6G)
  • RNA (5'-R(P*GP*GP*CP*GP*UP*CP*AP*UP*GP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
22(1) 1K6G|2|A
1008NR_all_82207.1
Exact match
1K6H|1|A (1K6H)
  • RNA (5'-R(P*GP*GP*CP*GP*UP*GP*UP*UP*CP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 1K6H|1|A
1009NR_all_30874.1
Exact match
1K8S|1|A+1K8S|1|B (1K8S)
  • 5'-R(*GP*GP*CP*AP*GP*AP*GP*UP*GP*CP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
13(1) 1K8S|1|A+1K8S|1|B
1010NR_all_79637.1
Exact match
1KAJ|1|A (1KAJ)
  • RNA PSEUDOKNOT APK
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
32(1) 1KAJ|1|A
1011NR_all_64635.1
Exact match
1KD4|1|A+1KD4|1|B (1KD4)
  • 5'-R(*GP*GP*UP*CP*AP*CP*AP*GP*CP*CP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, A, B, D, H; model(s): 1
1.9 Å11(1) 1KD4|1|A+1KD4|1|B
1012NR_all_38877.1
Exact match
1KFO|1|A (1KFO)
  • 5'-R(*GP*AP*AP*UP*GP*CP*CP*UP*GP*CP*GP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.6 Å18(1) 1KFO|1|A
1013NR_all_15417.1
Exact match
1KH6|1|A (1KH6)
  • JIIIabc
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å42(1) 1KH6|1|A
1014NR_all_78686.1
Exact match
1KIS|1|A (1KIS)
  • RNA (5'-R(*GP*AP*GP*CP*CP*CP*UP*GP*GP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 1KIS|1|A
1015NR_all_63765.1
Exact match
1KKA|1|A (1KKA)
  • anticodon stem-loop of tRNA(PHE)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
17(1) 1KKA|1|A
1016NR_all_06489.1
Exact match
1KKS|1|A (1KKS)
  • 5'-R(*GP*GP*AP*AP*GP*GP*CP*CP*CP*UP*UP*U[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
24(1) 1KKS|1|A
1017NR_all_72256.1
Exact match
1KOC|1|B+1KOC|1|A (1KOC)
  • RNA (5'-R(P*AP*CP*AP*GP*GP*UP*AP*GP*GP*U[...]
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
14(1) 1KOC|1|B+1KOC|1|A
1018NR_all_41220.1
Exact match
1KOD|1|B+1KOD|1|A (1KOD)
  • RNA (5'-R(P*AP*CP*GP*GP*UP*UP*AP*GP*GP*U[...]
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
14(1) 1KOD|1|B+1KOD|1|A
1019NR_all_54825.1
Exact match
1KOS|1|A (1KOS)
  • 5'-R(*CP*UP*GP*UP*GP*(5MU)P*UP*CP*GP*AP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(1) 1KOS|1|A
1020NR_all_45264.1
Exact match
1KP7|1|A (1KP7)
  • Hepatitis C Virus Internal Ribosome Entr[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
30(1) 1KP7|1|A
1021NR_all_45933.1
Exact match
1KPD|1|A (1KPD)
  • RNA PSEUDOKNOT APKA27G
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
32(1) 1KPD|1|A
1022NR_all_18162.1
Exact match
1KQ2|1|R (1KQ2)
  • 5'-R(*AP*UP*UP*UP*UP*UP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.7 Å7(1) 1KQ2|1|R
1023NR_all_26998.1
Exact match
1KXK|1|A (1KXK)
  • ai5g group II Self-splicing intron
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å70(1) 1KXK|1|A
1024NR_all_78170.1
Exact match
1L1C|1|C (1L1C)
  • licT mRNA antiterminator hairpin
  • SOLUTION NMR
  • Chain(s): C; model(s): 1
29(1) 1L1C|1|C
1025NR_all_80533.1
Exact match
1LC6|7|A (1LC6)
  • U6 Intramolecular Stem-loop RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 7
24(1) 1LC6|7|A
1026NR_all_95834.1
Exact match
Saccharomyces cerevisiae
1LMV|1|B+1LMV|1|A (1LMV)
  • 5'-R(*UP*AP*CP*UP*AP*AP*CP*AP*CP*C)-3'
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
10(1) 1LMV|1|B+1LMV|1|A
1027NR_all_32544.1
Exact match
1LNT|1|A+1LNT|1|B (1LNT)
  • 5'-R(*GP*CP*GP*UP*CP*AP*GP*GP*UP*CP*(CBV[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, A, B, D, H; model(s): 1
1.7 Å11(1) 1LNT|1|A+1LNT|1|B
1028NR_all_93142.1
Exact match
Saccharomyces cerevisiae
1LPW|1|B+1LPW|1|A (1LPW)
  • 5'-R(*UP*AP*CP*UP*AP*AP*CP*AP*CP*C)-3'
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
10(1) 1LPW|1|B+1LPW|1|A
1029NR_all_16624.1
Exact match
Saccharomyces cerevisiae
1LU3|1|A (1LU3)
  • PHENYLALANINE TRANSFER RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
16.8 Å16(1) 1LU3|1|A
1030NR_all_35845.1
Exact match
1LUU|1|A (1LUU)
  • 5'-R(*CP*CP*AP*GP*AP*(OMC)P*UP*(OMG)P*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 1LUU|1|A
1031NR_all_08227.1
Exact match
1LUX|1|A (1LUX)
  • 5'-R(*CP*CP*AP*GP*AP*(OMC)P*UP*(OMG)P*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 1LUX|1|A
1032NR_all_21518.1
Exact match
Human immunodeficiency virus 1
1LVJ|2|A (1LVJ)
  • HIV-1 Trans Activating Region RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
31(1) 1LVJ|2|A
1033NR_all_47361.1
Exact match
1M5L|1|A (1M5L)
  • modified HIV-1 packaging signal stem-loo[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
38(1) 1M5L|1|A
1034NR_all_31526.1
Exact match
1M82|1|A (1M82)
  • RNA (25-MER): THE COMPLEMENTARY RNA PROM[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
25(1) 1M82|1|A
1035NR_all_40126.1
Exact match
1M8W|1|E (1M8W)
  • 5'-R(P*UP*UP*GP*UP*CP*CP*AP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.2 Å8(1) 1M8W|1|E
1036NR_all_93459.1
Exact match
1M8W|1|F (1M8W)
  • 5'-R(P*UP*GP*UP*CP*CP*AP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.2 Å7(1) 1M8W|1|F
1037NR_all_78371.1
Exact match
1MDG|1|A (1MDG)
  • 5'-R(*UP*(BGM)GP*AP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.5 Å5(1) 1MDG|1|A
1038NR_all_25068.1
Exact match
1ME1|1|A (1ME1)
  • 5'-R(*GP*GP*AP*CP*(U25)P*(U25)P*(C25)P*([...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
8(1) 1ME1|1|A
1039NR_all_39223.1
Exact match
1MFJ|1|A (1MFJ)
  • 5'-R(*GP*AP*CP*AP*GP*UP*CP*UP*CP*UP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
20(1) 1MFJ|1|A
1040NR_all_57169.1
Exact match
1MFK|1|A (1MFK)
  • 5'-R(P*GP*GP*CP*GP*GP*UP*UP*GP*CP*AP*GP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 1MFK|1|A
1041NR_all_62030.1
Exact match
1MFY|1|A (1MFY)
  • C4 promoter of influneza A virus
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
31(1) 1MFY|1|A
1042NR_all_39003.1
Exact match
1MHK|1|L+1MHK|1|S (1MHK)
  • RNA 14-mer BCh12
  • X-RAY DIFFRACTION
  • Chain(s): 6, D, H, L, S; model(s): 1
2.5 Å14(1) 1MHK|1|L+1MHK|1|S
1043NR_all_43772.1
Exact match
1MIS|1|A+1MIS|1|B (1MIS)
  • RNA (5'-R(*GP*CP*GP*GP*AP*CP*GP*C)-3')
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
8(1) 1MIS|1|A+1MIS|1|B
1044NR_all_53343.1
Exact match
Escherichia coli
1MJ1|1|Q (1MJ1)
  • sarcin-ricin loop of 23SrRNA
  • ELECTRON MICROSCOPY
  • Chain(s): Q; model(s): 1
13.0 Å41(1) 1MJ1|1|Q
1045NR_all_90233.1
Exact match
Escherichia coli
1MJ1|1|R (1MJ1)
  • helix 69 of 23S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): R; model(s): 1
13.0 Å27(1) 1MJ1|1|R
1046NR_all_68844.1
Exact match
Escherichia coli
1ML5|1|a (1ML5)
  • 50S 23S RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): a; model(s): 1
14.0 Å2889(1) 1ML5|1|a
1047NR_all_68441.1
Exact match
Escherichia coli
1ML5|1|b (1ML5)
  • 50S 5S RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): b; model(s): 1
14.0 Å123(1) 1ML5|1|b
1048NR_all_27965.1
Exact match
1MNB|1|B (1MNB)
  • BIV TAR RNA
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
28(1) 1MNB|1|B
1049NR_all_69913.1
Exact match
Spinacia oleracea
1MNX|5|A (1MNX)
  • Loop E from 5S rRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
42(1) 1MNX|5|A
1050NR_all_99181.1
Exact match
1MSW|1|R (1MSW)
  • RNA message
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.1 Å10(1) 1MSW|1|R
1051NR_all_37932.1
Exact match
1MT4|4|A (1MT4)
  • 23S ribosomal Hairpin 35
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
24(1) 1MT4|4|A
1052NR_all_26915.1
Exact match
Escherichia coli
1MVR|1|A (1MVR)
  • Helix 34 of 16S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
12.8 Å45(1) 1MVR|1|A
1053NR_all_98672.1
Exact match
Escherichia coli
1MVR|1|D (1MVR)
  • Helix 89 of 23S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
12.8 Å59(1) 1MVR|1|D
1054NR_all_69068.1
Exact match
Escherichia coli
1MVR|1|E (1MVR)
  • Helix 93 of 23S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
12.8 Å27(1) 1MVR|1|E
1055NR_all_02111.1
Exact match
1MWG|1|A+1MWG|1|B (1MWG)
  • RNA (5'-R(*GP*GP*CP*AP*GP*GP*CP*C)-3')
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
8(1) 1MWG|1|A+1MWG|1|B
1056NR_all_44959.1
Exact match
1MY9|1|A (1MY9)
  • 5'-R(*GP*GP*AP*GP*GP*UP*UP*UP*UP*GP*GP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 1MY9|1|A
1057NR_all_90845.1
Exact match
1MY9|1|B (1MY9)
  • 5'-R(*GP*GP*AP*GP*GP*UP*UP*UP*UP*GP*GP*A[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
14(1) 1MY9|1|B
1058NR_all_92778.1
Exact match
1N1H|1|B (1N1H)
  • 5'-R(*AP*UP*UP*AP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å4(1) 1N1H|1|B
1059NR_all_13358.1
Exact match
Thermus thermophilus
1N32|1|Y+1N32|1|Z (1N32)
  • ANTICODON STEM-LOOP OF LEU-2 TRANSFER RN[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, D, H, Y, Z; model(s): 1
3.0 Å14(1) 1N32|1|Y+1N32|1|Z
1060NR_all_65818.1
Exact match
Thermus thermophilus
1N33|1|Y+1N33|1|Z (1N33)
  • ANTICODON STEM-LOOP OF SER TRANSFER RNA
  • X-RAY DIFFRACTION
  • Chain(s): 6, D, H, Y, Z; model(s): 1
3.4 Å10(1) 1N33|1|Y+1N33|1|Z
1061NR_all_57770.1
Exact match
1N35|1|C+1N35|1|B (1N35)
  • 5'-R(*AP*UP*UP*AP*GP*CP*CP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): 6, B, C, D, H; model(s): 1
2.5 Å8(1) 1N35|1|C+1N35|1|B
1062NR_all_11290.1
Exact match
1N38|1|C+1N38|1|B (1N38)
  • 5'-R(*AP*UP*UP*AP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): 6, B, C, D, H; model(s): 1
2.8 Å5(1) 1N38|1|C+1N38|1|B
1063NR_all_94897.1
Exact match
1N53|1|A+1N53|1|B (1N53)
  • RNA (5'-R(*GP*AP*GP*GP*GP*UP*GP*GP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
16(1) 1N53|1|A+1N53|1|B
1064NR_all_39177.1
Exact match
1N66|1|A (1N66)
  • internal loop in the Y-domain of poliovi[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 1N66|1|A
1065NR_all_59708.1
Exact match
1N8X|1|A (1N8X)
  • HIV-1 STEM LOOP SL1 MONOMERIC RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
36(1) 1N8X|1|A
1066NR_all_94450.1
Exact match
1NA2|1|A (1NA2)
  • telomerase RNA p2b hairpin
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
30(1) 1NA2|1|A
1067NR_all_87717.1
Exact match
1NAO|1|A (1NAO)
  • RNA (5'-R(*GP*GP*AP*GP*AP*UP*GP*AP*C)-3'[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
9(1) 1NAO|1|A
1068NR_all_32674.1
Exact match
1NBK|1|A (1NBK)
  • RNA aptamer
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
34(1) 1NBK|1|A
1069NR_all_91317.1
Exact match
1NBR|10|A (1NBR)
  • RNA HAIRPIN
  • SOLUTION NMR
  • Chain(s): A; model(s): 10
29(1) 1NBR|10|A
1070NR_all_59452.1
Exact match
1NC0|2|A (1NC0)
  • U80G U6 RNA Intramolecular Stem-Loop
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
24(1) 1NC0|2|A
1071NR_all_53161.1
Exact match
1NEM|1|A (1NEM)
  • 5'-R(*GP*GP*AP*CP*UP*GP*GP*GP*CP*GP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 1NEM|1|A
1072NR_all_41071.1
Exact match
1NXR|1|B (1NXR)
  • RNA (5'-R(*GP*AP*GP*GP*AP*CP*UP*G)-3')
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
8(1) 1NXR|1|B
1073NR_all_20710.1
Exact match
1NYB|1|B (1NYB)
  • BoxB RNA
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
24(1) 1NYB|1|B
1074NR_all_28474.1
Exact match
1OQ0|1|A (1OQ0)
  • P6.1 RNA hairpin from hTR
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(1) 1OQ0|1|A
1075NR_all_35700.1
Exact match
1OSW|3|A (1OSW)
  • 5'-R(*GP*GP*AP*GP*GP*CP*GP*CP*UP*AP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
22(1) 1OSW|3|A
1076NR_all_24378.1
Exact match
1OW9|1|A (1OW9)
  • A mimic of the VS Ribozyme Hairpin Subst[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 1OW9|1|A
1077NR_all_68829.1
Exact match
1P5M|10|A (1P5M)
  • 55-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 10
55(1) 1P5M|10|A
1078NR_all_94175.1
Exact match
1P5N|8|A (1P5N)
  • 34-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 8
34(1) 1P5N|8|A
1079NR_all_10469.1
Exact match
1P79|1|A (1P79)
  • 5'-R(*UP*GP*UP*GP*GP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.1 Å5(1) 1P79|1|A
1080NR_all_28964.1
Exact match
1PGL|1|3 (1PGL)
  • 5'-R(*AP*GP*UP*CP*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): 3; model(s): 1
2.8 Å6(1) 1PGL|1|3
1081NR_all_73434.1
Exact match
1PJY|1|A (1PJY)
  • HIV-1 frameshift inducing stem-loop
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 1PJY|1|A
1082NR_all_51522.1
Exact match
1PN7|1|C (1PN7)
  • P-tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): C; model(s): 1
10.8 Å62(1) 1PN7|1|C
1083NR_all_03559.1
Exact match
1PN8|1|D (1PN8)
  • E-tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
10.8 Å68(1) 1PN8|1|D
1084NR_all_14161.1
Exact match
1Q75|1|A (1Q75)
  • DKC mutant P2b telomerase RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(1) 1Q75|1|A
1085NR_all_93156.1
Exact match
1Q8N|1|A (1Q8N)
  • RNA Aptamer
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
38(1) 1Q8N|1|A
1086NR_all_30844.1
Exact match
1QC0|1|B+1QC0|1|A (1QC0)
  • 5'-R(GP*CP*AP*CP*CP*GP*CP*UP*AP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): 6, A, B, D, H; model(s): 1
1.6 Å10(1) 1QC0|1|B+1QC0|1|A
1087NR_all_51076.1
Exact match
1QC0|1|C+1QC0|1|D (1QC0)
  • 5'-R(*GP*CP*AP*CP*CP*GP*UP*UP*GP*GP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, C, D, H; model(s): 1
1.6 Å19(1) 1QC0|1|C+1QC0|1|D
1088NR_all_82252.1
Exact match
1QC8|1|A (1QC8)
  • TAU EXON 10 SPLICING REGULATORY ELEMENT [...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
25(1) 1QC8|1|A
1089NR_all_23784.1
Exact match
1QCU|1|A+1QCU|1|B (1QCU)
  • 5'-R(P*GP*GP*GP*GP*GP*GP*GP*GP*GP*GP*G)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, A, B, D, H; model(s): 1
1.2 Å11(1) 1QCU|1|A+1QCU|1|B
1090NR_all_20366.1
Exact match
1QCU|1|C+1QCU|1|D (1QCU)
  • 5'-R(P*CP*CP*CP*CP*CP*CP*CP*CP*CP*CP*C)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, C, D, H; model(s): 1
1.2 Å11(1) 1QCU|1|C+1QCU|1|D
1091NR_all_27126.1
Exact match
Human immunodeficiency virus 1
1QD3|1|A (1QD3)
  • HIV-1 TAR RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
29(1) 1QD3|1|A
1092NR_all_36993.1
Exact match
1QES|1|A+1QES|1|B (1QES)
  • RNA (5'-R(*GP*GP*AP*GP*UP*UP*CP*C)-3')
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
8(1) 1QES|1|A+1QES|1|B
1093NR_all_65311.1
Exact match
1QET|1|A+1QET|1|B (1QET)
  • RNA (5'-R(*GP*GP*AP*UP*GP*UP*CP*C)-3')
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
8(1) 1QET|1|A+1QET|1|B
1094NR_all_85174.1
Exact match
Escherichia coli
1QF6|1|B (1QF6)
  • THREONINE TRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å69(1) 1QF6|1|B
1095NR_all_27378.1
Exact match
1QLN|1|R (1QLN)
  • RNA (5- R(PPP*GP*GP*G)-3)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.4 Å2(1) 1QLN|1|R
1096NR_all_03445.1
Exact match
1QVF|1|3 (1QVF)
  • Deacylated tRNA minihelix
  • X-RAY DIFFRACTION
  • Chain(s): 3; model(s): 1
3.1 Å12(1) 1QVF|1|3
1097NR_all_52004.1
Exact match
1QWA|1|A (1QWA)
  • 18S ribosomal RNA, 5'ETS
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
21(1) 1QWA|1|A
1098NR_all_45183.1
Exact match
1QWB|4|A (1QWB)
  • sNRE26
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
26(1) 1QWB|4|A
1099NR_all_32799.1
Exact match
Escherichia coli
1QZC|1|A (1QZC)
  • 16S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
9.0 Å44(1) 1QZC|1|A
1100NR_all_91237.1
Exact match
Escherichia coli
1QZC|1|C (1QZC)
  • 23S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): C; model(s): 1
9.0 Å27(1) 1QZC|1|C
1101NR_all_31224.1
Exact match
1R2P|9|A (1R2P)
  • 34-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 9
34(1) 1R2P|9|A
1102NR_all_22464.1
Exact match
1R3E|1|C (1R3E)
  • 5'-R(*CP*UP*GP*UP*GP*UP*(FHU)P*CP*GP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.1 Å16(1) 1R3E|1|C
1103NR_all_43901.1
Exact match
1R3E|1|D+1R3E|1|E (1R3E)
  • 5'-R(*CP*UP*GP*UP*GP*UP*UP*CP*GP*AP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, D, E, H; model(s): 1
2.1 Å17(1) 1R3E|1|D+1R3E|1|E
1104NR_all_42834.1
Exact match
1R3X|1|C (1R3X)
  • RNA (5'-R(*UP*CP*UP*CP*UP*CP*UP*U)-3')
  • SOLUTION NMR
  • Chain(s): C; model(s): 1
8(1) 1R3X|1|C
1105NR_all_13558.1
Exact match
1R4H|1|A (1R4H)
  • 5'-R(*GP*GP*GP*CP*AP*AP*GP*CP*CP*C)-3'
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
10(1) 1R4H|1|A
1106NR_all_85024.1
Exact match
1R7W|12|A (1R7W)
  • 34-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 12
34(1) 1R7W|12|A
1107NR_all_36505.1
Exact match
1R7Z|5|A (1R7Z)
  • 34-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
34(1) 1R7Z|5|A
1108NR_all_01598.1
Exact match
1R9F|1|B (1R9F)
  • 5'-R(*CP*GP*UP*AP*CP*GP*CP*GP*GP*AP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å20(1) 1R9F|1|B
1109NR_all_42973.1
Exact match
1R9F|1|C (1R9F)
  • 5'-R(*UP*CP*GP*AP*AP*GP*UP*AP*UP*UP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.9 Å20(1) 1R9F|1|C
1110NR_all_42294.1
Exact match
1RAW|1|A (1RAW)
  • RNA APTAMER
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
36(1) 1RAW|1|A
1111NR_all_17965.1
Exact match
Enterovirus B
1RFR|3|A (1RFR)
  • stemloop-D RNA of the 5'-cloverleaf of c[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
30(1) 1RFR|3|A
1112NR_all_84854.1
Exact match
1RGO|1|D (1RGO)
  • RNA (5'-R(*UP*UP*AP*UP*UP*UP*AP*UP*U)-3'[...]
  • SOLUTION NMR
  • Chain(s): D; model(s): 1
9(1) 1RGO|1|D
1113NR_all_82596.1
Exact match
1RHT|1|A (1RHT)
  • RNA (5'-R(P*GP*GP*GP*AP*CP*UP*GP*AP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
24(1) 1RHT|1|A
1114NR_all_33176.1
Exact match
1RKJ|1|B (1RKJ)
  • 5'-R(*GP*GP*AP*UP*GP*CP*CP*UP*CP*CP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
21(1) 1RKJ|1|B
1115NR_all_30691.1
Exact match
1RMN|1|A (1RMN)
  • RNA (49-MER)
  • FLUORESCENCE TRANSFER
  • Chain(s): A; model(s): 1
49(1) 1RMN|1|A
1116NR_all_51826.1
Exact match
1RNA|1|A+1RNA|1|B (1RNA)
  • RNA (5'-R(*UP*UP*AP*UP*AP*UP*AP*UP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, A, B, D, H; model(s): 1
2.3 Å14(1) 1RNA|1|A+1RNA|1|B
1117NR_all_47507.1
Exact match
1RNG|1|A (1RNG)
  • RNA (5'-R(*GP*GP*CP*GP*CP*UP*UP*GP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
12(1) 1RNG|1|A
1118NR_all_31404.1
Exact match
1RNK|1|A (1RNK)
  • RNA PSEUDOKNOT
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
34(1) 1RNK|1|A
1119NR_all_66678.1
Exact match
1ROQ|1|A (1ROQ)
  • 5'-R(*GP*GP*UP*AP*UP*CP*AP*CP*GP*GP*UP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 1ROQ|1|A
1120NR_all_95110.1
Exact match
1RPU|1|C+1RPU|1|D (1RPU)
  • 5'-R(P*CP*GP*UP*AP*CP*GP*CP*GP*UP*CP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, C, D, H; model(s): 1
2.5 Å42(1) 1RPU|1|C+1RPU|1|D
1121NR_all_31642.1
Exact match
1RY1|1|N+1RY1|1|M (1RY1)
  • RNA (31-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): 6, D, H, M, N; model(s): 1
12.0 Å31(1) 1RY1|1|N+1RY1|1|M
1122NR_all_71924.1
Exact match
1RY1|1|O+1RY1|1|P (1RY1)
  • RNA (5'-R(P*GP*UP*UP*CP*UP*GP*GP*GP*CP*U[...]
  • ELECTRON MICROSCOPY
  • Chain(s): 6, D, H, O, P; model(s): 1
12.0 Å24(1) 1RY1|1|O+1RY1|1|P
1123NR_all_05253.1
Exact match
1RY1|1|Q+1RY1|1|R (1RY1)
  • RNA (5'-R(P*CP*GP*AP*UP*CP*GP*GP*GP*UP*G[...]
  • ELECTRON MICROSCOPY
  • Chain(s): 6, D, H, Q, R; model(s): 1
12.0 Å12(1) 1RY1|1|Q+1RY1|1|R
1124NR_all_06780.1
Exact match
1S03|1|A (1S03)
  • 47-MER
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å47(1) 1S03|1|A
1125NR_all_07004.1
Exact match
1S03|1|B (1S03)
  • 47-MER
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å47(1) 1S03|1|B
1126NR_all_01648.1
Exact match
1S2F|1|A (1S2F)
  • 5'-R(*GP*GP*GP*GP*AP*GP*UP*GP*GP*UP*UP*U[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 1S2F|1|A
1127NR_all_50024.1
Exact match
1S34|1|A (1S34)
  • 5'-R(*GP*GP*GP*GP*AP*GP*UP*GP*GP*UP*UP*U[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 1S34|1|A
1128NR_all_85719.1
Exact match
1S76|1|R (1S76)
  • RNA (5'-R(P*AP*CP*AP*CP*GP*GP*CP*GP*A)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.9 Å9(1) 1S76|1|R
1129NR_all_98913.1
Exact match
1S77|1|R (1S77)
  • RNA (5'-R(*AP*CP*AP*CP*GP*GP*CP*GP*AP*(3[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.7 Å9(1) 1S77|1|R
1130NR_all_86572.1
Exact match
1S9S|4|A (1S9S)
  • MLV Psi encapsidation site
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
101(1) 1S9S|4|A
1131NR_all_15581.1
Exact match
Rattus norvegicus
1SCL|4|A (1SCL)
  • RNA SARCIN-RICIN LOOP
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
29(1) 1SCL|4|A
1132NR_all_03470.1
Exact match
Thermus thermophilus
1SER|1|T (1SER)
  • TRNASER
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.9 Å62(1) 1SER|1|T
1133NR_all_56046.1
Exact match
1SI3|1|B (1SI3)
  • 5'-R(*CP*GP*UP*GP*AP*CP*UP*CP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å9(1) 1SI3|1|B
1134NR_all_53829.1
Exact match
1SY4|5|A (1SY4)
  • U6 Intramolecular Stem-Loop RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
24(1) 1SY4|5|A
1135NR_all_28891.1
Exact match
1SZY|1|A (1SZY)
  • 5'-R(P*GP*GP*CP*AP*GP*GP*GP*CP*UP*CP*AP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
21(1) 1SZY|1|A
1136NR_all_72697.1
Exact match
1T0E|1|A+1T0E|1|C (1T0E)
  • 5'-R(*GP*GP*UP*GP*GP*UP*GP*AP*AP*GP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, A, C, D, H; model(s): 1
1.7 Å21(1) 1T0E|1|A+1T0E|1|C
1137NR_all_47291.1
Exact match
1T0K|1|D+1T0K|1|C (1T0K)
  • 5'-R(*G*GP*AP*CP*GP*CP*AP*GP*AP*GP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, C, D, H; model(s): 1
3.2 Å15(1) 1T0K|1|D+1T0K|1|C
1138NR_all_51584.1
Exact match
Escherichia coli
1T1M|1|A (1T1M)
  • dodecamer fragment of double helix from [...]
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
12.0 Å12(1) 1T1M|1|A
1139NR_all_93863.1
Exact match
Escherichia coli
1T1M|1|B (1T1M)
  • 42-mer fragment of double helix from 16S[...]
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
12.0 Å42(1) 1T1M|1|B
1140NR_all_43326.1
Exact match
1T28|1|A (1T28)
  • 34-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
34(1) 1T28|1|A
1141NR_all_54250.1
Exact match
1T4X|1|A+1T4X|1|B (1T4X)
  • RNA (5'-R(*CP*GP*CP*GP*CP*G)-3')
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
6(1) 1T4X|1|A+1T4X|1|B
1142NR_all_84251.1
Exact match
1TBK|1|A (1TBK)
  • VS ribozyme stem-loop V
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
17(1) 1TBK|1|A
1143NR_all_88604.1
Exact match
1TFN|1|A (1TFN)
  • RNA (5'-R(*GP*GP*GP*AP*CP*UP*GP*AP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
24(1) 1TFN|1|A
1144NR_all_12093.1
Exact match
1TFW|1|G+1TFW|1|J (1TFW)
  • 5'-R(*GP*CP*GP*GP*AP*UP*CP*CP*GP*CP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, D, G, H, J; model(s): 1
2.2 Å13(1) 1TFW|1|G+1TFW|1|J
1145NR_all_84898.1
Exact match
1TFY|1|G+1TFY|1|J (1TFY)
  • 5'-R(*CP*GP*GP*AP*UP*CP*CP*GP*CP*AP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): 6, D, G, H, J; model(s): 1
3.2 Å11(1) 1TFY|1|G+1TFY|1|J
1146NR_all_24575.1
Exact match
1TJZ|15|A (1TJZ)
  • VS Ribozyme
  • SOLUTION NMR
  • Chain(s): A; model(s): 15
22(1) 1TJZ|15|A
1147NR_all_84600.1
Exact match
1TLR|1|A (1TLR)
  • RNA TETRALOOP RECEPTOR (5'-R(GGCCUAAGACU[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 1TLR|1|A
1148NR_all_63125.1
Exact match
1TOB|1|A (1TOB)
  • RNA (5'-R(GGCACGAGGUUUAGCUACACUCGUGCC)-3[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 1TOB|1|A
1149NR_all_80667.1
Exact match
1TRJ|1|B (1TRJ)
  • Helix 39 of 18S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
11.7 Å41(1) 1TRJ|1|B
1150NR_all_10777.1
Exact match
1TRJ|1|C (1TRJ)
  • Helix 40 of 18S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): C; model(s): 1
11.7 Å27(1) 1TRJ|1|C
1151NR_all_47980.1
Exact match
1TUT|1|A+1TUT|1|B (1TUT)
  • 5'-R(*GP*AP*GP*GP*AP*AP*GP*GP*CP*GP*A)-3[...]
  • SOLUTION NMR
  • Chain(s): 6, A, B, D, H; model(s): 1
11(1) 1TUT|1|A+1TUT|1|B
1152NR_all_32905.1
Exact match
1TXS|4|A (1TXS)
  • Enteroviral 5'-UTR
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
38(1) 1TXS|4|A
1153NR_all_83386.1
Exact match
Escherichia coli
1U0B|1|A (1U0B)
  • Cysteinyl-tRNA synthetase
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å74(1) 1U0B|1|A
1154NR_all_84907.1
Exact match
1U3K|7|A (1U3K)
  • ABISS7
  • SOLUTION NMR
  • Chain(s): A; model(s): 7
38(1) 1U3K|7|A
1155NR_all_45478.1
Exact match
1U6P|16|B (1U6P)
  • 101-MER
  • SOLUTION NMR
  • Chain(s): B; model(s): 16
100(1) 1U6P|16|B
1156NR_all_72627.1
Exact match
1U9S|1|A (1U9S)
  • RIBONUCLEASE P
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å155(1) 1U9S|1|A
1157NR_all_78769.1
Exact match
1ULL|3|A (1ULL)
  • RNA (5'-R (GP*GP*CP*UP*GP*GP*AP*CP*UP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
35(1) 1ULL|3|A
1158NR_all_06358.1
Exact match
1UON|1|C+1UON|1|B (1UON)
  • 5'-R(*UP*AP*GP*CP*CP*CP*CP*CP*)-3'
  • ELECTRON MICROSCOPY
  • Chain(s): 6, B, C, D, H; model(s): 1
7.6 Å8(1) 1UON|1|C+1UON|1|B
1159NR_all_67852.1
Exact match
1URN|1|P (1URN)
  • RNA (5'-R(*AP*AP*UP*CP*CP*AP*UP*UP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
1.9 Å20(1) 1URN|1|P
1160NR_all_96260.1
Exact match
1UTD|1|1 (1UTD)
  • 5'-R(*GP*UP*UP*UP*GP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): 1; model(s): 1
2.1 Å3(1) 1UTD|1|1
1161NR_all_91774.1
Exact match
Human immunodeficiency virus 1
1UTS|2|B (1UTS)
  • RNA (5'-(*GP*GP*CP*AP*GP*AP*UP*CP*UP*GP*[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 2
29(1) 1UTS|2|B
1162NR_all_35232.1
Exact match
Human immunodeficiency virus 1
1UUD|1|B (1UUD)
  • RNA (5'-(*GP*GP*CP*AP*GP*AP*UP*CP*UP*GP*[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
29(1) 1UUD|1|B
1163NR_all_42491.1
Exact match
Human immunodeficiency virus 1
1UUI|1|B (1UUI)
  • 5'-R(*GP*GP*CP*AP*GP*AP*UP*CP*UP*GP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
29(1) 1UUI|1|B
1164NR_all_99225.1
Exact match
1UUU|7|A (1UUU)
  • RNA (5'-R(*GP*GP*CP*GP*UP*AP*CP*GP*UP*UP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 7
19(1) 1UUU|7|A
1165NR_all_35535.1
Exact match
1VQ6|1|4 (1VQ6)
  • 5'-R(*CP*(5AA)*(HFA))-3'
  • X-RAY DIFFRACTION
  • Chain(s): 4; model(s): 1
2.7 Å1(1) 1VQ6|1|4
1166NR_all_28222.1
Exact match
1VQL|1|4 (1VQL)
  • 5'-R(*CP*CP*(PPU)*(TSE)*(DA)*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): 4; model(s): 1
2.3 Å4(1) 1VQL|1|4
1167NR_all_56657.1
Exact match
1VQM|1|4 (1VQM)
  • 5'-R(*CP*CP*(PPU)P*(PO2)P*(DA)P*C*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): 4; model(s): 1
2.3 Å4(1) 1VQM|1|4
1168NR_all_63152.1
Exact match
1VQN|1|4 (1VQN)
  • 5'-R(*CP*CP*(PPU)*(LOF))-3'
  • X-RAY DIFFRACTION
  • Chain(s): 4; model(s): 1
2.4 Å2(1) 1VQN|1|4
1169NR_all_72539.1
Exact match
1WKS|1|A (1WKS)
  • 5'-R(*GP*GP*CP*UP*UP*UP*GP*GP*AP*UP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
17(1) 1WKS|1|A
1170NR_all_41538.1
Exact match
1WNE|1|B+1WNE|1|C (1WNE)
  • 5'-R(*CP*AP*UP*GP*GP*GP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): 6, B, C, D, H; model(s): 1
3.0 Å8(1) 1WNE|1|B+1WNE|1|C
1171NR_all_06580.1
Exact match
1WWD|1|B (1WWD)
  • 5'-R(P*AP*AP*CP*AP*GP*U)-3'
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
6(1) 1WWD|1|B
1172NR_all_28253.1
Exact match
1WWE|1|B (1WWE)
  • 5'-R(P*UP*UP*UP*UP*GP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
7(1) 1WWE|1|B
1173NR_all_12201.1
Exact match
1WWF|1|B (1WWF)
  • 5'-R(P*CP*CP*UP*CP*CP*GP*U)-3'
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
7(1) 1WWF|1|B
1174NR_all_28933.1
Exact match
1WWG|1|B (1WWG)
  • 5'-R(P*UP*AP*UP*CP*UP*G)-3'
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
6(1) 1WWG|1|B
1175NR_all_40066.1
Exact match
Thermus thermophilus
1X18|1|A (1X18)
  • 5'-R(P*CP*GP*AP*UP*GP*GP*CP*GP*AP*AP*G)-[...]
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
13.5 Å11(1) 1X18|1|A
1176NR_all_44641.1
Exact match
Thermus thermophilus
1X18|1|B (1X18)
  • RNA (31-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
13.5 Å31(1) 1X18|1|B
1177NR_all_52383.1
Exact match
Thermus thermophilus
1X18|1|C (1X18)
  • 5'-R(P*UP*UP*CP*CP*CP*GP*GP*GP*CP*CP*UP*[...]
  • ELECTRON MICROSCOPY
  • Chain(s): C; model(s): 1
13.5 Å20(1) 1X18|1|C
1178NR_all_66919.1
Exact match
Thermus thermophilus
1X18|1|D (1X18)
  • 5'-R(P*UP*GP*UP*UP*GP*GP*GP*UP*UP*AP*AP*[...]
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
13.5 Å24(1) 1X18|1|D
1179NR_all_07784.1
Exact match
1XHP|1|A (1XHP)
  • U6 snRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
32(1) 1XHP|1|A
1180NR_all_08212.1
Exact match
1XJR|1|A (1XJR)
  • s2m RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.7 Å46(1) 1XJR|1|A
1181NR_all_82938.1
Exact match
1XNQ|1|X+1XNQ|1|W (1XNQ)
  • Anticodon tRNA
  • X-RAY DIFFRACTION
  • Chain(s): 6, D, H, W, X; model(s): 1
3.1 Å10(1) 1XNQ|1|X+1XNQ|1|W
1182NR_all_56744.1
Exact match
1XNR|1|X+1XNR|1|W (1XNR)
  • Anticodon tRNA
  • X-RAY DIFFRACTION
  • Chain(s): 6, D, H, W, X; model(s): 1
3.1 Å10(1) 1XNR|1|X+1XNR|1|W
1183NR_all_30667.1
Exact match
1XOK|1|A (1XOK)
  • alfalfa mosaic virus RNA 3' UTR
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å27(1) 1XOK|1|A
1184NR_all_98387.1
Exact match
1XWP|1|A (1XWP)
  • 5'-R(*GP*GP*AP*GP*AP*UP*CP*GP*CP*AP*CP*U[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(1) 1XWP|1|A
1185NR_all_42712.1
Exact match
1XWU|1|A (1XWU)
  • 5'-R(*CP*GP*AP*AP*AP*CP*AP*UP*AP*GP*AP*U[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 1XWU|1|A
1186NR_all_48365.1
Exact match
1Y1Y|1|P (1Y1Y)
  • 5'-R(P*AP*GP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
4.0 Å4(1) 1Y1Y|1|P
1187NR_all_69516.1
Exact match
Vibrio vulnificus
1Y26|1|X (1Y26)
  • Vibrio vulnificus A-riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.1 Å71(1) 1Y26|1|X
1188NR_all_70496.1
Exact match
Bacillus subtilis
1Y27|1|X (1Y27)
  • Bacillus subtilis xpt
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.4 Å68(1) 1Y27|1|X
1189NR_all_45664.1
Exact match
1YG3|1|A (1YG3)
  • ScYLV RNA pseudoknot
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 1YG3|1|A
1190NR_all_22999.1
Exact match
1YG4|1|A (1YG4)
  • ScYLV RNA pseudoknot
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 1YG4|1|A
1191NR_all_62450.1
Exact match
1YNC|1|A (1YNC)
  • apolipoprotein B mRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
31(1) 1YNC|1|A
1192NR_all_99580.1
Exact match
1YNG|6|A (1YNG)
  • apolipoprotein B mRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 6
31(1) 1YNG|6|A
1193NR_all_78207.1
Exact match
1YSH|1|A (1YSH)
  • RNA (28-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
9.5 Å28(1) 1YSH|1|A
1194NR_all_57918.1
Exact match
1YSH|1|B (1YSH)
  • RNA (101-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
9.5 Å101(1) 1YSH|1|B
1195NR_all_98897.1
Exact match
1YSH|1|F (1YSH)
  • RNA (34-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): F; model(s): 1
9.5 Å34(1) 1YSH|1|F
1196NR_all_46023.1
Exact match
1YSV|1|A (1YSV)
  • 27-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 1YSV|1|A
1197NR_all_08150.1
Exact match
1YVP|1|G (1YVP)
  • Y RNA sequence, first strand
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.2 Å5(1) 1YVP|1|G
1198NR_all_10769.1
Exact match
1YVP|1|H (1YVP)
  • Y RNA sequence, first strand
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.2 Å7(1) 1YVP|1|H
1199NR_all_29659.1
Exact match
1YZ9|1|C+1YZ9|1|D+1YZ9|1|E+1YZ9|1|F (1YZ9)
  • 5'-R(*CP*GP*AP*AP*CP*UP*UP*CP*GP*CP*G)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, H; model(s): 1
2.1 Å11(1) 1YZ9|1|C+1YZ9|1|D+1YZ9|1|E+1YZ9|1|F
1200NR_all_38795.1
Exact match
1YZD|1|A+1YZD|1|B (1YZD)
  • RNA 5'-R(*GP*CP*AP*GP*AP*(A5M)P*UP*UP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, H; model(s): 1
2.4 Å15(1) 1YZD|1|A+1YZD|1|B
1201NR_all_28395.1
Exact match
1Z2J|1|A (1Z2J)
  • HIV-1 frameshift site RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
45(1) 1Z2J|1|A
1202NR_all_96357.1
Exact match
1Z30|1|A (1Z30)
  • 5'-R(*GP*GP*CP*GP*UP*UP*CP*GP*UP*UP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
18(1) 1Z30|1|A
1203NR_all_18111.1
Exact match
1Z31|1|A (1Z31)
  • human telomerase PJ6 hairpin
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
32(1) 1Z31|1|A
1204NR_all_89129.1
Exact match
1Z7F|1|B+1Z7F|1|C (1Z7F)
  • 5'-R(*GP*CP*AP*GP*AP*CP*UP*UP*AP*AP*AP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, H; model(s): 1
2.1 Å16(1) 1Z7F|1|B+1Z7F|1|C
1205NR_all_10635.1
Exact match
1ZBN|1|A (1ZBN)
  • BIV mRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
28(1) 1ZBN|1|A
1206NR_all_86256.1
Exact match
1ZC5|1|A (1ZC5)
  • HIV-1 frameshift RNA signal
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
41(1) 1ZC5|1|A
1207NR_all_59748.1
Exact match
Thermus thermophilus
1ZC8|1|A (1ZC8)
  • TLD 16S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
13.0 Å59(1) 1ZC8|1|A
1208NR_all_84353.1
Exact match
Thermus thermophilus
1ZC8|1|B (1ZC8)
  • H2 16S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
13.0 Å16(1) 1ZC8|1|B
1209NR_all_34216.1
Exact match
Thermus thermophilus
1ZC8|1|C (1ZC8)
  • H2b d mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): C; model(s): 1
13.0 Å31(1) 1ZC8|1|C
1210NR_all_48921.1
Exact match
Thermus thermophilus
1ZC8|1|F (1ZC8)
  • H5 16S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): F; model(s): 1
13.0 Å29(1) 1ZC8|1|F
1211NR_all_09737.1
Exact match
Thermus thermophilus
1ZC8|1|G (1ZC8)
  • protein kinase 4 mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): G; model(s): 1
13.0 Å30(1) 1ZC8|1|G
1212NR_all_78535.1
Exact match
Thermus thermophilus
1ZC8|1|H (1ZC8)
  • protein kinase 2 mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): H; model(s): 1
13.0 Å59(1) 1ZC8|1|H
1213NR_all_54091.1
Exact match
Thermus thermophilus
1ZC8|1|I (1ZC8)
  • protein kinase 3
  • ELECTRON MICROSCOPY
  • Chain(s): I; model(s): 1
13.0 Å49(1) 1ZC8|1|I
1214NR_all_16133.1
Exact match
Thermus thermophilus
1ZC8|1|J (1ZC8)
  • protein kinase 4 mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): J; model(s): 1
13.0 Å52(1) 1ZC8|1|J
1215NR_all_59512.1
Exact match
1ZIF|6|A (1ZIF)
  • RNA (5'-R(*GP*GP*GP*CP*GP*AP*AP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 6
12(1) 1ZIF|6|A
1216NR_all_56729.1
Exact match
1ZIG|1|A (1ZIG)
  • RNA (5'-R(*GP*GP*GP*CP*GP*AP*GP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
12(1) 1ZIG|1|A
1217NR_all_26929.1
Exact match
1ZIH|2|A (1ZIH)
  • RNA (5'-R(*GP*GP*GP*CP*GP*CP*AP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
12(1) 1ZIH|2|A
1218NR_all_91367.1
Exact match
Escherichia coli
1ZN1|1|B (1ZN1)
  • ribosomal 23S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
14.1 Å59(1) 1ZN1|1|B
1219NR_all_55496.1
Exact match
205D|1|A+205D|1|B (205D)
  • RNA (5'-R(*GP*GP*AP*CP*UP*UP*UP*GP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, H; model(s): 1
2.6 Å12(1) 205D|1|A+205D|1|B
1220NR_all_89779.1
Exact match
219D|1|B (219D)
  • RNA (5'-R(*CP*CP*AP*UP*UP*AP*UP*AP*GP*C)[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
10(1) 219D|1|B
1221NR_all_19715.1
Exact match
255D|1|A (255D)
  • RNA (5'-R(*GP*GP*AP*CP*UP*UP*CP*GP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.0 Å12(1) 255D|1|A
1222NR_all_36371.1
Exact match
283D|1|A (283D)
  • RNA (5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å12(1) 283D|1|A
1223NR_all_08420.1
Exact match
2A43|1|A (2A43)
  • RNA Pseudoknot
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.3 Å26(1) 2A43|1|A
1224NR_all_03631.1
Exact match
2A64|1|A (2A64)
  • ribonuclease P RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.3 Å298(1) 2A64|1|A
1225NR_all_95023.1
Exact match
Escherichia coli
2A8V|1|D (2A8V)
  • 5'-R(P*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å3(1) 2A8V|1|D
1226NR_all_93829.1
Exact match
2A9X|1|2 (2A9X)
  • BIV TAR RNA
  • SOLUTION NMR
  • Chain(s): 2; model(s): 1
28(1) 2A9X|1|2
1227NR_all_50566.1
Exact match
2AD9|1|B (2AD9)
  • 5'-R(*CP*UP*CP*UP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
6(1) 2AD9|1|B
1228NR_all_98259.1
Exact match
2ADB|1|B (2ADB)
  • 5'-R(*CP*UP*CP*UP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
6(1) 2ADB|1|B
1229NR_all_91357.1
Exact match
2ADC|19|B (2ADC)
  • 5'-R(*CP*UP*CP*UP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): B; model(s): 19
6(1) 2ADC|19|B
1230NR_all_32559.1
Exact match
2ADC|19|C (2ADC)
  • 5'-R(*CP*UP*CP*UP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): C; model(s): 19
6(1) 2ADC|19|C
1231NR_all_12506.1
Exact match
2AHT|1|A (2AHT)
  • 27-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 2AHT|1|A
1232NR_all_67463.1
Exact match
2AP0|9|A (2AP0)
  • C27A Sugarcane Yellow Leaf Virus RNA pse[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 9
27(1) 2AP0|9|A
1233NR_all_09346.1
Exact match
2AP5|1|A (2AP5)
  • C27A Sugarcane Yellow Leaf Virus RNA pse[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 2AP5|1|A
1234NR_all_37298.1
Exact match
2ASB|1|B (2ASB)
  • ribosomal RNA (5'- GAACUCAAUAG -3')
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.5 Å11(1) 2ASB|1|B
1235NR_all_02518.1
Exact match
2AU4|1|A (2AU4)
  • Class I RNA aptamer to GTP
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
41(1) 2AU4|1|A
1236NR_all_44263.1
Exact match
2AWQ|3|A (2AWQ)
  • 5'-R(*GP*GP*GP*GP*AP*(PSU)P*UP*GP*AP*AP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
16(1) 2AWQ|3|A
1237NR_all_21689.1
Exact match
2B3J|1|G (2B3J)
  • anticodon stem-loop of t-RNA-Arg2 (nucle[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.0 Å7(1) 2B3J|1|G
1238NR_all_49799.1
Exact match
2B63|1|R (2B63)
  • 31-MER
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.8 Å27(1) 2B63|1|R
1239NR_all_70457.1
Exact match
2B6G|1|B (2B6G)
  • 5'-R(*GP*GP*AP*GP*GP*CP*UP*CP*UP*GP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
19(1) 2B6G|1|B
1240NR_all_99512.1
Exact match
2B7G|1|A (2B7G)
  • 5'-R(*GP*GP*AP*GP*GP*CP*UP*CP*UP*GP*GP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
19(1) 2B7G|1|A
1241NR_all_54448.1
Exact match
2BBV|1|N (2BBV)
  • RNA (5'-R(*UP*CP*UP*UP*AP*UP*AP*UP*CP*U)[...]
  • X-RAY DIFFRACTION
  • Chain(s): N; model(s): 1
2.8 Å10(1) 2BBV|1|N
1242NR_all_00896.1
Exact match
2BX2|1|R (2BX2)
  • RNA (5'-R(*UP*UP*UP*AP*CP*AP*GP*UP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.9 Å14(1) 2BX2|1|R
1243NR_all_60317.1
Exact match
2C06|1|C (2C06)
  • 5'-R(*AP*UP*AP*CP*AP)-3'
  • SOLUTION NMR
  • Chain(s): C; model(s): 1
5(1) 2C06|1|C
1244NR_all_37879.1
Exact match
synthetic construct
2C0B|1|R (2C0B)
  • 5'-R(*UP*UP*UP*AP*CP*AP*GP*UP*AP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.2 Å10(1) 2C0B|1|R
1245NR_all_29005.1
Exact match
Escherichia coli
2C4R|1|R (2C4R)
  • SSRNA MOLECULE: 5'-R(*AP*CP*AP*GP*UP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.6 Å10(1) 2C4R|1|R
1246NR_all_18247.1
Exact match
Saccharomyces cerevisiae
2CJK|1|B (2CJK)
  • 5'-R(*UP*AP*UP*AP*UP*AP*UP*AP)-3'
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
8(1) 2CJK|1|B
1247NR_all_35312.1
Exact match
2D17|2|A+2D17|2|B (2D17)
  • 5'-R(*CP*GP*GP*CP*AP*AP*GP*AP*GP*GP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1, 2
16(1) 2D17|2|A+2D17|2|B
1248NR_all_46633.1
Exact match
2D18|1|A+2D18|1|B (2D18)
  • 5'-R(*GP*CP*UP*GP*AP*AP*GP*UP*GP*CP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
17(1) 2D18|1|A+2D18|1|B
1249NR_all_21206.1
Exact match
2D19|1|B+2D19|1|A (2D19)
  • 5'-R(*GP*CP*UP*GP*AP*AP*GP*UP*GP*CP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
17(1) 2D19|1|B+2D19|1|A
1250NR_all_45065.1
Exact match
2D1A|1|A+2D1A|1|B (2D1A)
  • RNA
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
39(1) 2D1A|1|A+2D1A|1|B
1251NR_all_50359.1
Exact match
2DD2|1|A+2DD2|1|B (2DD2)
  • 5'-R(*GP*GP*UP*GP*AP*AP*GP*GP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
10(1) 2DD2|1|A+2DD2|1|B
1252NR_all_59959.1
Exact match
2DD3|1|A+2DD3|1|B (2DD3)
  • 5'-R(*GP*GP*UP*GP*AP*AP*GP*GP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
10(1) 2DD3|1|A+2DD3|1|B
1253NR_all_83181.1
Exact match
2DLC|1|Y (2DLC)
  • T-RNA (76-MER)
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.4 Å64(1) 2DLC|1|Y
1254NR_all_10954.1
Exact match
2E9R|1|A+2E9R|1|B (2E9R)
  • 5'-R(*CP*AP*UP*GP*GP*GP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, H; model(s): 1
2.8 Å9(1) 2E9R|1|A+2E9R|1|B
1255NR_all_62003.1
Exact match
2E9Z|1|B+2E9Z|1|C (2E9Z)
  • 5'-R(*CP*AP*UP*GP*GP*GP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, H; model(s): 1
3.0 Å9(1) 2E9Z|1|B+2E9Z|1|C
1256NR_all_24509.1
Exact match
2ERR|1|B (2ERR)
  • UGCAUGU
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
7(1) 2ERR|1|B
1257NR_all_22969.1
Exact match
2ES5|1|A (2ES5)
  • 5'-R(*GP*GP*AP*GP*AP*GP*GP*CP*UP*CP*UP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 2ES5|1|A
1258NR_all_87573.1
Exact match
2ESE|1|B (2ESE)
  • 5'-R(*GP*GP*AP*GP*AP*GP*GP*CP*UP*CP*UP*G[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
23(1) 2ESE|1|B
1259NR_all_94355.1
Exact match
2EUY|2|A (2EUY)
  • U65 box H/ACA snoRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
34(1) 2EUY|2|A
1260NR_all_16360.1
Exact match
2EVY|1|A (2EVY)
  • Poliovirus 5'NTR cloverleaf stem loop D [...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 2EVY|1|A
1261NR_all_78107.1
Exact match
Thermus thermophilus
2F4V|1|Z (2F4V)
  • 5'-R(P*UP*UP*CP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
3.8 Å4(1) 2F4V|1|Z
1262NR_all_33071.1
Exact match
2F4X|1|A+2F4X|1|B (2F4X)
  • 5'-R(P*GP*GP*UP*UP*GP*CP*UP*GP*AP*AP*GP*[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
24(1) 2F4X|1|A+2F4X|1|B
1263NR_all_65601.1
Exact match
2F87|1|A (2F87)
  • SRP RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
12(1) 2F87|1|A
1264NR_all_32676.1
Exact match
2F8K|1|B (2F8K)
  • 5'-R(*UP*AP*AP*UP*CP*UP*UP*UP*GP*AP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å16(1) 2F8K|1|B
1265NR_all_59799.1
Exact match
2F8S|1|C+2F8S|1|D (2F8S)
  • 5'-R(P*AP*GP*AP*CP*AP*GP*CP*AP*UP*AP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, H; model(s): 1
3.0 Å22(1) 2F8S|1|C+2F8S|1|D
1266NR_all_89224.1
Exact match
2F8T|1|C+2F8T|1|D (2F8T)
  • 26-MER
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, H; model(s): 1
3.1 Å26(1) 2F8T|1|C+2F8T|1|D
1267NR_all_81978.1
Exact match
2FDT|7|A (2FDT)
  • 36-mer
  • SOLUTION NMR
  • Chain(s): A; model(s): 7
36(1) 2FDT|7|A
1268NR_all_63427.1
Exact match
2FEY|4|A (2FEY)
  • stem-loop IV of Tetrahymena telomerase R[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
43(1) 2FEY|4|A
1269NR_all_51632.1
Exact match
Bos taurus
2FTC|1|R (2FTC)
  • Mitochondrial 16S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): R; model(s): 1
12.1 Å1443(1) 2FTC|1|R
1270NR_all_07051.1
Exact match
2FY1|1|B (2FY1)
  • S1A stem-loop RNA
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
21(1) 2FY1|1|B
1271NR_all_76611.1
Exact match
2G1G|1|A (2G1G)
  • 5'-R(*AP*CP*GP*GP*GP*CP*UP*CP*AP*UP*(T6A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 2G1G|1|A
1272NR_all_36771.1
Exact match
2G1W|1|A (2G1W)
  • 5'-R(*GP*GP*GP*GP*UP*GP*GP*CP*UP*CP*CP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 2G1W|1|A
1273NR_all_26733.1
Exact match
2G4B|1|B (2G4B)
  • 5'-R(P*UP*UP*UP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å7(1) 2G4B|1|B
1274NR_all_79446.1
Exact match
2G91|1|A+2G91|1|B (2G91)
  • 5'-R(*GP*GP*UP*GP*CP*GP*CP*(CBR)P*C-3'
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, H; model(s): 1
1.5 Å8(1) 2G91|1|A+2G91|1|B
1275NR_all_39119.1
Exact match
2G92|1|A+2G92|1|B (2G92)
  • 5'-R(*CP*GP*CP*(NF2)P*AP*AP*UP*UP*AP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, H; model(s): 1
1.6 Å11(1) 2G92|1|A+2G92|1|B
1276NR_all_81464.1
Exact match
2GJE|1|R (2GJE)
  • guide RNA 40-mer
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.4 Å13(1) 2GJE|1|R
1277NR_all_78802.1
Exact match
2GJE|1|S (2GJE)
  • RNA tetramer
  • X-RAY DIFFRACTION
  • Chain(s): S; model(s): 1
3.4 Å5(1) 2GJE|1|S
1278NR_all_43215.1
Exact match
2GM0|1|A+2GM0|1|B (2GM0)
  • RNA (35-MER)
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
35(1) 2GM0|1|A+2GM0|1|B
1279NR_all_20250.1
Exact match
Triticum sp.
2GO5|1|9 (2GO5)
  • ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 9; model(s): 1
7.4 Å90(1) 2GO5|1|9
1280NR_all_48836.1
Exact match
2GRW|1|A (2GRW)
  • 5'-GGACCUCUCGAAAGAGAUGUCC-3'
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 2GRW|1|A
1281NR_all_32399.1
Exact match
2GTT|1|W (2GTT)
  • RNA (99-MER)
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
3.5 Å99(1) 2GTT|1|W
1282NR_all_80684.1
Exact match
2GTT|1|X (2GTT)
  • RNA (99-MER)
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.5 Å99(1) 2GTT|1|X
1283NR_all_53424.1
Exact match
2GUN|1|B (2GUN)
  • 5'-R(*GP*AP*AP*GP*AP*AP*GP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å10(1) 2GUN|1|B
1284NR_all_57276.1
Exact match
2GV3|6|A (2GV3)
  • 5'-R(*GP*GP*CP*CP*AP*GP*AP*CP*UP*CP*CP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 6
22(1) 2GV3|6|A
1285NR_all_97787.1
Exact match
2GV4|3|A (2GV4)
  • Short RNA strand 5'-GGACCUCUCGAAAGAGUGGU[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
22(1) 2GV4|3|A
1286NR_all_11169.1
Exact match
2GVO|3|A (2GVO)
  • GUANOSINE-5'-MONOPHOSPHATE
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
18(1) 2GVO|3|A
1287NR_all_76177.1
Exact match
2GXB|1|E+2GXB|1|F (2GXB)
  • 5'-R(P*(DU)P*CP*GP*CP*GP*CP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, H; model(s): 1
2.3 Å6(1) 2GXB|1|E+2GXB|1|F
1288NR_all_42907.1
Exact match
2H49|1|A+2H49|1|B (2H49)
  • 5'-R(*GP*GP*CP*UP*AP*AP*GP*AP*C)-3'
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
9(1) 2H49|1|A+2H49|1|B
1289NR_all_04723.1
Exact match
2HEM|1|A (2HEM)
  • 5'-R(P*GP*GP*GP*AP*AP*GP*GP*CP*GP*CP*UP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
24(1) 2HEM|1|A
1290NR_all_21686.1
Exact match
2HGH|1|B (2HGH)
  • 55-MER
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
55(1) 2HGH|1|B
1291NR_all_21811.1
Exact match
2HNS|1|A (2HNS)
  • 5'-R(*GP*GP*CP*GP*UP*GP*AP*UP*CP*AP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 2HNS|1|A
1292NR_all_03515.1
Exact match
2HT1|1|M (2HT1)
  • 5'-R(*UP*CP*UP*CP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): M; model(s): 1
3.5 Å5(1) 2HT1|1|M
1293NR_all_25696.1
Exact match
2HUA|1|A (2HUA)
  • CSFV IRES Domain IIa
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
40(1) 2HUA|1|A
1294NR_all_99751.1
Exact match
2HVY|1|E (2HVY)
  • H/ACA RNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.3 Å61(1) 2HVY|1|E
1295NR_all_46722.1
Exact match
2I2Y|1|B (2I2Y)
  • (5'-R(*CP*AP*UP*C)-3')
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
4(1) 2I2Y|1|B
1296NR_all_86924.1
Exact match
2IHX|1|B (2IHX)
  • uPsi RNA
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
75(1) 2IHX|1|B
1297NR_all_01620.1
Exact match
2IRN|1|A+2IRN|1|B (2IRN)
  • 5'-R(P*GP*CP*UP*GP*AP*GP*GP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
9(1) 2IRN|1|A+2IRN|1|B
1298NR_all_83754.1
Exact match
2IRO|1|A+2IRO|1|B (2IRO)
  • 5'-R(P*GP*CP*GP*GP*AP*UP*GP*CP*U)-3'
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
9(1) 2IRO|1|A+2IRO|1|B
1299NR_all_96380.1
Exact match
2IX1|1|B (2IX1)
  • 5'-D(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP *AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å13(1) 2IX1|1|B
1300NR_all_15848.1
Exact match
Hepatitis B virus
2IXY|1|A (2IXY)
  • 5'-R(*GP*GP*CP*CP*UP*CP*CP*AP*AP*GP *CP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 2IXY|1|A
1301NR_all_40734.1
Exact match
2IXZ|1|A (2IXZ)
  • 5'-R(*GP*CP*UP*GP*UP*GP*CP*CP)-3'
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
8(1) 2IXZ|1|A
1302NR_all_10425.1
Exact match
Escherichia coli
2J28|1|8 (2J28)
  • 4.5S SIGNAL RECOGNITION PARTICLE RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 8; model(s): 1
9.5 Å74(1) 2J28|1|8
1303NR_all_44609.1
Exact match
Haloarcula marismortui
2J37|1|Z (2J37)
  • RIBOSOMAL RNA
  • ELECTRON MICROSCOPY
  • Chain(s): Z; model(s): 1
8.7 Å280(1) 2J37|1|Z
1304NR_all_37861.1
Exact match
2JA6|1|P (2JA6)
  • 5'-R(*UP*UP*CP*GP*AP*CP*CP*AP*GP*GP*AP)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
4.0 Å10(1) 2JA6|1|P
1305NR_all_06823.1
Exact match
synthetic construct
2JA8|1|P (2JA8)
  • 5'-R(*UP*UP*CP*GP*AP*CP*CP*AP*GP*AP*UP)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.8 Å10(1) 2JA8|1|P
1306NR_all_77683.1
Exact match
2JEA|1|C (2JEA)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.3 Å7(1) 2JEA|1|C
1307NR_all_33835.1
Exact match
Escherichia coli
2JLT|1|A (2JLT)
  • R06
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å17(1) 2JLT|1|A
1308NR_all_39077.1
Exact match
2JR4|4|A (2JR4)
  • 5'-R(*CP*CP*UP*CP*CP*CP*UP*UP*AP*CP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
17(1) 2JR4|4|A
1309NR_all_76431.1
Exact match
2JRG|1|A (2JRG)
  • 5'-R(*CP*CP*UP*CP*CP*CP*UP*(CM0)P*AP*CP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(1) 2JRG|1|A
1310NR_all_90197.1
Exact match
2JRQ|6|A (2JRQ)
  • 5'-R(*CP*CP*UP*CP*CP*CP*UP*(CM0)P*AP*CP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 6
16(1) 2JRQ|6|A
1311NR_all_40327.1
Exact match
2JSE|1|A (2JSE)
  • RNA (5'-R(*GP*GP*AP*GP*UP*GP*GP*CP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 2JSE|1|A
1312NR_all_06213.1
Exact match
2JSG|1|A (2JSG)
  • 5'-R(*CP*CP*UP*CP*CP*CP*UP*UP*AP*CP*(6MZ[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 2JSG|1|A
1313NR_all_49489.1
Exact match
2JTP|16|A (2JTP)
  • SIV17-50 RNA (34-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 16
34(1) 2JTP|16|A
1314NR_all_99058.1
Exact match
2JUK|8|A (2JUK)
  • HIV-1 frameshift site RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 8
22(1) 2JUK|8|A
1315NR_all_21583.1
Exact match
2JWV|1|A (2JWV)
  • RNA (29-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
29(1) 2JWV|1|A
1316NR_all_14006.1
Exact match
2JXQ|1|A+2JXQ|1|B (2JXQ)
  • RNA (5'-R(*GP*CP*AP*GP*AP*GP*AP*GP*CP*G)[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
10(1) 2JXQ|1|A+2JXQ|1|B
1317NR_all_69024.1
Exact match
2JXS|1|A+2JXS|1|B (2JXS)
  • 5'-R(*GP*CP*AP*GP*AP*AP*GP*AP*GP*CP*G)-3[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
11(1) 2JXS|1|A+2JXS|1|B
1318NR_all_43728.1
Exact match
2JXV|1|A (2JXV)
  • RNA (33-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
33(1) 2JXV|1|A
1319NR_all_94699.1
Exact match
2JYM|1|A (2JYM)
  • RNA (5'-R(*GP*GP*CP*UP*CP*GP*CP*AP*GP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 2JYM|1|A
1320NR_all_23183.1
Exact match
2K3Z|1|A+2K3Z|1|B (2K3Z)
  • RNA_(5'-R(*GP*UP*CP*GP*AP*GP*CP*UP*G)-3'[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
9(1) 2K3Z|1|A+2K3Z|1|B
1321NR_all_62715.1
Exact match
2K41|1|A+2K41|1|B (2K41)
  • RNA_(5'-R(*GP*UP*CP*GP*UP*GP*CP*UP*G)-3'[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
9(1) 2K41|1|A+2K41|1|B
1322NR_all_88506.1
Exact match
2K5Z|3|A (2K5Z)
  • Duck HBV apical loop
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
29(1) 2K5Z|3|A
1323NR_all_03988.1
Exact match
2K65|1|A+2K65|1|B (2K65)
  • 5'-R(*GP*GP*CP*AP*CP*UP*G)-3'
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
7(1) 2K65|1|A+2K65|1|B
1324NR_all_67461.1
Exact match
2K66|1|A (2K66)
  • 5'-R(*GP*GP*AP*GP*UP*AP*UP*GP*UP*GP*AP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 2K66|1|A
1325NR_all_54932.1
Exact match
2K7E|1|A+2K7E|1|B (2K7E)
  • RNA (5'-R(*GP*CP*GP*GP*UP*GP*UP*AP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
12(1) 2K7E|1|A+2K7E|1|B
1326NR_all_56385.1
Exact match
2KD4|1|A+2KD4|1|B (2KD4)
  • 5'-R(*GP*CP*CP*GP*CP*GP*GP*C)-2'
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
8(1) 2KD4|1|A+2KD4|1|B
1327NR_all_03015.1
Exact match
2KD8|1|A (2KD8)
  • 5'-R(*GP*GP*AP*UP*GP*GP*UP*UP*GP*GP*GP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 2KD8|1|A
1328NR_all_00786.1
Exact match
2KDQ|1|B (2KDQ)
  • HIV-1 TAR RNA
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
29(1) 2KDQ|1|B
1329NR_all_31185.1
Exact match
2KFY|1|B (2KFY)
  • 5'-R(*AP*GP*GP*GP*AP*U)-3'
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
6(1) 2KFY|1|B
1330NR_all_59493.1
Exact match
2KG0|1|B (2KG0)
  • 5'-R(*AP*GP*GP*GP*AP*U)-3'
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
6(1) 2KG0|1|B
1331NR_all_17058.1
Exact match
2KG1|1|B (2KG1)
  • 5'-R(*AP*GP*GP*GP*AP*U)-3'
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
6(1) 2KG1|1|B
1332NR_all_30036.1
Exact match
2KGP|1|A (2KGP)
  • RNA (25-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
25(1) 2KGP|1|A
1333NR_all_06591.1
Exact match
2KH9|1|B (2KH9)
  • 5'-R(*AP*GP*AP*GP*AP*U)-3'
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
6(1) 2KH9|1|B
1334NR_all_38065.1
Exact match
2KHY|9|A (2KHY)
  • RNA (38-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 9
38(1) 2KHY|9|A
1335NR_all_64884.1
Exact match
2KM8|1|A (2KM8)
  • 5'-R(P*UP*AP*UP*AP*UP*AP*UP*AP*AP*UP*AP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
13(1) 2KM8|1|A
1336NR_all_44411.1
Exact match
Human immunodeficiency virus 2
2KMJ|4|A (2KMJ)
  • RNA (28-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
28(1) 2KMJ|4|A
1337NR_all_13470.1
Exact match
2KOC|1|A (2KOC)
  • RNA (5'-R(P*GP*GP*CP*AP*CP*UP*UP*CP*GP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 2KOC|1|A
1338NR_all_82766.1
Exact match
2KPC|6|A (2KPC)
  • RNA (5'-R(*UP*GP*AP*GP*CP*AP*CP*AP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 6
17(1) 2KPC|6|A
1339NR_all_72946.1
Exact match
2KPD|10|A (2KPD)
  • RNA (5'-R(*UP*GP*AP*GP*CP*UP*CP*AP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 10
17(1) 2KPD|10|A
1340NR_all_88352.1
Exact match
2KPV|3|A (2KPV)
  • RNA (34-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
34(1) 2KPV|3|A
1341NR_all_80875.1
Exact match
Turnip crinkle virus
2KRL|10|A (2KRL)
  • RNA (102-MER)
  • SOLUTION NMR, SOLUTION SCATTERING
  • Chain(s): A; model(s): 10
102(1) 2KRL|10|A
1342NR_all_14975.1
Exact match
2KRP|1|A (2KRP)
  • RNA (5'-R(*CP*UP*CP*GP*GP*CP*UP*AP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
17(1) 2KRP|1|A
1343NR_all_65186.1
Exact match
2KRQ|1|A (2KRQ)
  • RNA (5'-R(*CP*UP*CP*GP*GP*CP*UP*IP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 2KRQ|1|A
1344NR_all_63200.1
Exact match
2KRV|1|A (2KRV)
  • RNA (5'-R(*CP*UP*CP*GP*GP*(RSP)P*UP*IP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(1) 2KRV|1|A
1345NR_all_44431.1
Exact match
2KRW|1|A (2KRW)
  • RNA (5'-R(*CP*UP*CP*GP*GP*(N)P*UP*AP*CP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 2KRW|1|A
1346NR_all_83774.1
Exact match
2KRY|1|A (2KRY)
  • RNA (5'-R(*(PSU)P*CP*GP*GP*GP*CP*CP*(RSQ[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(1) 2KRY|1|A
1347NR_all_22508.1
Exact match
2KRZ|1|A (2KRZ)
  • RNA (5'-R(*(PSU)P*CP*GP*GP*GP*CP*CP*CP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 2KRZ|1|A
1348NR_all_85064.1
Exact match
Hepatitis C virus
2KTZ|1|A (2KTZ)
  • HCV IRES Domain IIa RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
38(1) 2KTZ|1|A
1349NR_all_13046.1
Exact match
Hepatitis C virus
2KU0|4|A (2KU0)
  • HCV IRES Domain IIa RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
38(1) 2KU0|4|A
1350NR_all_76472.1
Exact match
Drosophila melanogaster
2KUW|2|A (2KUW)
  • K10 TLS RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
48(1) 2KUW|2|A
1351NR_all_32754.1
Exact match
2KVN|19|A (2KVN)
  • RNA (5'-R(*GP*GP*UP*GP*AP*UP*UP*GP*AP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 19
17(1) 2KVN|19|A
1352NR_all_28654.1
Exact match
2KX5|1|A (2KX5)
  • HIV TAR RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
29(1) 2KX5|1|A
1353NR_all_76247.1
Exact match
Homo sapiens
2KX8|1|A (2KX8)
  • 7SK
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
42(1) 2KX8|1|A
1354NR_all_45331.1
Exact match
2KXN|1|A (2KXN)
  • 5'-R(*AP*AP*GP*AP*AP*C)-3'
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
6(1) 2KXN|1|A
1355NR_all_40109.1
Exact match
2KXZ|1|A+2KXZ|1|B (2KXZ)
  • 5'-R(*GP*AP*CP*AP*AP*GP*UP*GP*UP*CP*A)-3[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
11(1) 2KXZ|1|A+2KXZ|1|B
1356NR_all_61864.1
Exact match
2KY0|1|A+2KY0|1|B (2KY0)
  • 5'-R(*GP*AP*CP*GP*AP*GP*CP*GP*UP*CP*A)-3[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
11(1) 2KY0|1|A+2KY0|1|B
1357NR_all_78444.1
Exact match
2KY1|1|A+2KY1|1|B (2KY1)
  • 5'-R(*GP*AP*CP*UP*AP*GP*AP*GP*UP*CP*A)-3[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
11(1) 2KY1|1|A+2KY1|1|B
1358NR_all_56623.1
Exact match
2KY2|1|A+2KY2|1|B (2KY2)
  • 5'-R(*GP*GP*UP*AP*GP*GP*CP*CP*A)-3'
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
9(1) 2KY2|1|A+2KY2|1|B
1359NR_all_93941.1
Exact match
2KYD|1|A+2KYD|1|B (2KYD)
  • RNA (5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
16(1) 2KYD|1|A+2KYD|1|B
1360NR_all_60207.1
Exact match
2KYE|1|A (2KYE)
  • RNA (5'-R(*GP*AP*GP*AP*GP*(PSU)P*(PSU)P*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
11(1) 2KYE|1|A
1361NR_all_53209.1
Exact match
Bacillus subtilis
2KZL|2|A (2KZL)
  • RNA (55-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
55(1) 2KZL|2|A
1362NR_all_87597.1
Exact match
Homo sapiens
2L2J|14|A (2L2J)
  • RNA (42-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 14
42(1) 2L2J|14|A
1363NR_all_73308.1
Exact match
Homo sapiens
2L2K|1|A (2L2K)
  • RNA (42-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
42(1) 2L2K|1|A
1364NR_all_99287.1
Exact match
Rattus norvegicus
2L3C|1|B (2L3C)
  • RNA (34-MER)
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
34(1) 2L3C|1|B
1365NR_all_03882.1
Exact match
2L3E|11|A (2L3E)
  • 35-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 11
35(1) 2L3E|11|A
1366NR_all_30586.1
Exact match
Rattus norvegicus
2L3J|1|B (2L3J)
  • RNA (71-MER)
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
71(1) 2L3J|1|B
1367NR_all_35362.1
Exact match
2L41|1|B (2L41)
  • RNA (5'-R(P*UP*CP*UP*U)-3')
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
4(1) 2L41|1|B
1368NR_all_23717.1
Exact match
Homo sapiens
2L5D|3|B (2L5D)
  • 5'-R(*UP*GP*AP*CP*A)-3'
  • SOLUTION NMR
  • Chain(s): B; model(s): 3
5(1) 2L5D|3|B
1369NR_all_48491.1
Exact match
2L6I|1|A (2L6I)
  • RNA (5'-R(*GP*AP*UP*CP*UP*CP*UP*UP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 2L6I|1|A
1370NR_all_39445.1
Exact match
2L8C|1|A+2L8C|1|B (2L8C)
  • RNA (5'-R(*CP*CP*GP*CP*UP*GP*CP*GP*G)-3'[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
9(1) 2L8C|1|A+2L8C|1|B
1371NR_all_82774.1
Exact match
2L8F|1|A+2L8F|1|B (2L8F)
  • RNA (5'-R(*GP*UP*GP*AP*AP*GP*CP*CP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
11(1) 2L8F|1|A+2L8F|1|B
1372NR_all_29847.1
Exact match
2L8H|3|A (2L8H)
  • HIV TAR RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
29(1) 2L8H|3|A
1373NR_all_00317.1
Exact match
2L8U|1|A+2L8U|1|B (2L8U)
  • RNA (5'-R(*CP*CP*GP*CP*UP*GP*CP*GP*G)-3'[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
9(1) 2L8U|1|A+2L8U|1|B
1374NR_all_68992.1
Exact match
2L8W|1|A+2L8W|1|B (2L8W)
  • RNA (5'-R(*CP*CP*GP*CP*UP*GP*CP*GP*G)-3'[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
9(1) 2L8W|1|A+2L8W|1|B
1375NR_all_80173.1
Exact match
2L94|1|A (2L94)
  • RNA_(45-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
45(1) 2L94|1|A
1376NR_all_72370.1
Exact match
2L9E|2|A (2L9E)
  • RNA (5'-R(*GP*CP*AP*GP*AP*CP*UP*(70U)P*U[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
15(1) 2L9E|2|A
1377NR_all_18912.1
Exact match
2LA5|6|A (2LA5)
  • RNA (36-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 6
36(1) 2LA5|6|A
1378NR_all_10812.1
Exact match
2LBJ|5|A (2LBJ)
  • RNA (5'-R(*GP*GP*GP*CP*CP*UP*UP*GP*CP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
17(1) 2LBJ|5|A
1379NR_all_13392.1
Exact match
2LBK|1|A (2LBK)
  • RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*UP*CP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
17(1) 2LBK|1|A
1380NR_all_43408.1
Exact match
2LBL|3|A (2LBL)
  • RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*UP*CP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
17(1) 2LBL|3|A
1381NR_all_51186.1
Exact match
2LBR|1|A (2LBR)
  • RNA (5'-R(*GP*GP*GP*GP*AP*CP*UP*GP*UP*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(1) 2LBR|1|A
1382NR_all_41221.1
Exact match
Murine leukemia virus
2LC8|1|A (2LC8)
  • RNA (56-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
56(1) 2LC8|1|A
1383NR_all_52148.1
Exact match
Human immunodeficiency virus 1
2LDL|1|A (2LDL)
  • RNA (27-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 2LDL|1|A
1384NR_all_87104.1
Exact match
2LDT|4|A (2LDT)
  • RNA (31-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
31(1) 2LDT|4|A
1385NR_all_97147.1
Exact match
2LEB|1|B (2LEB)
  • RNA (5'-R(*UP*CP*CP*AP*GP*U)-3')
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
6(1) 2LEB|1|B
1386NR_all_29618.1
Exact match
2LEC|1|B (2LEC)
  • RNA (5'-R(*UP*GP*GP*AP*GP*U)-3')
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
6(1) 2LEC|1|B
1387NR_all_36729.1
Exact match
Pan troglodytes
2LHP|1|A (2LHP)
  • RNA (37-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
37(1) 2LHP|1|A
1388NR_all_02664.1
Exact match
Yersinia enterocolitica
2LI4|1|A (2LI4)
  • RNA (32-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
32(1) 2LI4|1|A
1389NR_all_79142.1
Exact match
2LI8|1|B (2LI8)
  • RNA (5'-R(*AP*GP*GP*AP*GP*AP*U)-3')
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
7(1) 2LI8|1|B
1390NR_all_80099.1
Exact match
2LJJ|1|A (2LJJ)
  • IV-B RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
27(1) 2LJJ|1|A
1391NR_all_97142.1
Exact match
Saccharomyces cerevisiae
2LK3|1|A (2LK3)
  • RNA (5'-R(*GP*GP*CP*UP*UP*AP*GP*AP*UP*CP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
24(1) 2LK3|1|A
1392NR_all_23876.1
Exact match
Saccharomyces cerevisiae
2LKR|3|A (2LKR)
  • RNA (111-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
111(1) 2LKR|3|A
1393NR_all_07880.1
Exact match
2LP9|1|A (2LP9)
  • RNA (5'-R(*GP*AP*GP*GP*AP*CP*AP*UP*AP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 2LP9|1|A
1394NR_all_81284.1
Exact match
2LPA|1|A (2LPA)
  • RNA (5'-R(*GP*AP*GP*GP*AP*CP*AP*UP*AP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
15(1) 2LPA|1|A
1395NR_all_56057.1
Exact match
2LQZ|3|A (2LQZ)
  • RNA (27-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
27(1) 2LQZ|3|A
1396NR_all_28320.1
Exact match
Saccharomyces cerevisiae
2LU0|7|A (2LU0)
  • RNA (49-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 7
49(1) 2LU0|7|A
1397NR_all_29611.1
Exact match
Homo sapiens
2LUB|1|A (2LUB)
  • RNA (37-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
37(1) 2LUB|1|A
1398NR_all_52795.1
Exact match
2LUN|8|A (2LUN)
  • RNA (28-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 8
28(1) 2LUN|8|A
1399NR_all_05686.1
Exact match
2LVY|1|B+2LVY|1|A (2LVY)
  • RNA (5'-R(*GP*CP*GP*UP*AP*GP*CP*GP*T)-3'[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
8(1) 2LVY|1|B+2LVY|1|A
1400NR_all_71895.1
Exact match
2LWK|8|A (2LWK)
  • RNA (32-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 8
32(1) 2LWK|8|A
1401NR_all_94472.1
Exact match
2LX1|1|A+2LX1|1|B (2LX1)
  • RNA (5'-R(*GP*AP*CP*GP*AP*GP*UP*GP*UP*CP[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
11(1) 2LX1|1|A+2LX1|1|B
1402NR_all_79081.1
Exact match
2M12|2|A (2M12)
  • RNA (5'-R(*GP*GP*GP*UP*GP*UP*AP*UP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
23(1) 2M12|2|A
1403NR_all_27009.1
Exact match
2M1O|1|A+2M1O|1|B (2M1O)
  • RNA (5'-R(P*GP*GP*GP*UP*GP*UP*A)-3')
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
7(1) 2M1O|1|A+2M1O|1|B
1404NR_all_95796.1
Exact match
Saccharomyces cerevisiae
2M1V|1|A (2M1V)
  • RNA (29-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
29(1) 2M1V|1|A
1405NR_all_10023.1
Exact match
2M21|7|A (2M21)
  • 5'-R(*GP*GP*CP*GP*AP*UP*AP*CP*AP*CP*UP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 7
21(1) 2M21|7|A
1406NR_all_43385.1
Exact match
2M22|6|A (2M22)
  • 5'-R(*GP*GP*CP*AP*GP*AP*UP*CP*UP*GP*UP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 6
23(1) 2M22|6|A
1407NR_all_14174.1
Exact match
Saccharomyces cerevisiae
2M23|1|A (2M23)
  • RNA (29-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
29(1) 2M23|1|A
1408NR_all_04787.1
Exact match
Saccharomyces cerevisiae
2M24|9|A (2M24)
  • RNA (29-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 9
29(1) 2M24|9|A
1409NR_all_28467.1
Exact match
2M4W|7|A (2M4W)
  • RNA (5'-R(*GP*GP*AP*AP*UP*CP*GP*AP*AP*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 7
17(1) 2M4W|7|A
1410NR_all_71956.1
Exact match
Azotobacter vinelandii
2M57|5|A (2M57)
  • RNA_(35-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
35(1) 2M57|5|A
1411NR_all_62394.1
Exact match
synthetic construct
2M58|2|A (2M58)
  • RNA (59-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
58(1) 2M58|2|A
1412NR_all_32689.1
Exact match
2M5U|1|A (2M5U)
  • RNA_(5'-R(*GP*GP*CP*AP*GP*AP*UP*UP*CP*UP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 2M5U|1|A
1413NR_all_43721.1
Exact match
2M8D|1|A (2M8D)
  • RNA (5'-R(*UP*GP*AP*AP*GP*GP*AP*C)-3')
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
8(1) 2M8D|1|A
1414NR_all_11528.1
Exact match
2M8K|5|A (2M8K)
  • RNA (48-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
48(1) 2M8K|5|A
1415NR_all_87508.1
Exact match
2MB0|1|A (2MB0)
  • RNA_(5'-R(*AP*UP*CP*AP*AP*A)-3')
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
6(1) 2MB0|1|A
1416NR_all_14079.1
Exact match
2MF0|6|G (2MF0)
  • RNA_(72-MER)
  • SOLUTION NMR
  • Chain(s): G; model(s): 6
72(1) 2MF0|6|G
1417NR_all_17314.1
Exact match
2MF1|16|G (2MF1)
  • RNA_(72-MER)
  • SOLUTION NMR
  • Chain(s): G; model(s): 16
72(1) 2MF1|16|G
1418NR_all_39433.1
Exact match
Enterovirus E
2MFD|1|A (2MFD)
  • 5'-R(P*GP*GP*CP*GP*UP*UP*CP*GP*CP*UP*UP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
19(1) 2MFD|1|A
1419NR_all_49554.1
Exact match
2MFH|3|B (2MFH)
  • RsmZ(36-44) RNA
  • SOLUTION NMR
  • Chain(s): B; model(s): 3
9(1) 2MFH|3|B
1420NR_all_36964.1
Exact match
2MFH|3|D (2MFH)
  • RsmZ(36-44) RNA
  • SOLUTION NMR
  • Chain(s): D; model(s): 3
9(1) 2MFH|3|D
1421NR_all_32342.1
Exact match
2MGZ|1|C (2MGZ)
  • RNA (5'-R(*UP*GP*CP*AP*UP*GP*GP*UP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): C; model(s): 1
12(1) 2MGZ|1|C
1422NR_all_24404.1
Exact match
2MHI|6|A (2MHI)
  • Medaka telomerase RNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 6
53(1) 2MHI|6|A
1423NR_all_66855.1
Exact match
2MI0|12|A (2MI0)
  • 5'-R(*GP*AP*GP*CP*AP*GP*CP*AP*UP*CP*GP*U[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 12
22(1) 2MI0|12|A
1424NR_all_90658.1
Exact match
2MI0|12|B (2MI0)
  • 5'-R(*GP*CP*GP*GP*CP*AP*GP*UP*UP*GP*AP*C[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 12
21(1) 2MI0|12|B
1425NR_all_12803.1
Exact match
2MIY|5|A (2MIY)
  • RNA_(59-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
59(1) 2MIY|5|A
1426NR_all_01339.1
Exact match
2MJH|1|B (2MJH)
  • 5'-CUACUCAUAU-3'
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
10(1) 2MJH|1|B
1427NR_all_88048.1
Exact match
2MKI|2|B (2MKI)
  • RNA (5'-R(*CP*UP*UP*UP*A)-3')
  • SOLUTION NMR
  • Chain(s): B; model(s): 2
5(1) 2MKI|2|B
1428NR_all_73195.1
Exact match
2MKK|7|B (2MKK)
  • RNA (5'-R(*UP*UP*UP*UP*A)-3')
  • SOLUTION NMR
  • Chain(s): B; model(s): 7
5(1) 2MKK|7|B
1429NR_all_20602.1
Exact match
synthetic construct
2MKN|1|B+2MKN|1|C (2MKN)
  • RNA (5'-R(*GP*CP*CP*GP*UP*GP*GP*UP*CP*UP[...]
  • SOLUTION NMR
  • Chain(s): B, C, D, E, F, H; model(s): 1
19(1) 2MKN|1|B+2MKN|1|C
1430NR_all_14163.1
Exact match
unidentified
2MN0|2|A (2MN0)
  • 5'-R(*GP*GP*AP*GP*AP*GP*(H2U)P*GP*GP*AP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
14(1) 2MN0|2|A
1431NR_all_45368.1
Exact match
2MNC|1|A (2MNC)
  • RNA (5'-R(*GP*GP*GP*UP*UP*GP*AP*CP*CP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
16(1) 2MNC|1|A
1432NR_all_72402.1
Exact match
2MQO|1|B (2MQO)
  • RNA (5'-R(*CP*AP*CP*AP*CP*A)-3')
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
6(1) 2MQO|1|B
1433NR_all_28678.1
Exact match
2MQP|4|B (2MQP)
  • RNA (5'-R(*AP*CP*AP*CP*AP*C)-3')
  • SOLUTION NMR
  • Chain(s): B; model(s): 4
6(1) 2MQP|4|B
1434NR_all_60917.1
Exact match
2MQQ|1|B (2MQQ)
  • RNA (5'-R(*AP*CP*AP*CP*A)-3')
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
5(1) 2MQQ|1|B
1435NR_all_88343.1
Exact match
2MQQ|1|C (2MQQ)
  • RNA (5'-R(*AP*CP*AP*CP*A)-3')
  • SOLUTION NMR
  • Chain(s): C; model(s): 1
5(1) 2MQQ|1|C
1436NR_all_66174.1
Exact match
Murine leukemia virus
2MQT|2|A (2MQT)
  • RNA (68-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
68(1) 2MQT|2|A
1437NR_all_88351.1
Exact match
Murine leukemia virus
2MQV|1|B (2MQV)
  • RNA (68-MER)
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
68(1) 2MQV|1|B
1438NR_all_43244.1
Exact match
Murine leukemia virus
2MS0|8|B (2MS0)
  • tRNApro
  • SOLUTION NMR
  • Chain(s): B; model(s): 8
71(1) 2MS0|8|B
1439NR_all_45079.1
Exact match
Murine leukemia virus
2MS1|1|B (2MS1)
  • tRNApro
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
71(1) 2MS1|1|B
1440NR_all_64488.1
Exact match
2MS5|1|A+2MS5|1|S (2MS5)
  • RNA_(5'-R(P*CP*CP*GP*CP*AP*GP*CP*GP*G)-3[...]
  • SOLUTION NMR
  • Chain(s): A, D, E, F, H, S; model(s): 1
9(1) 2MS5|1|A+2MS5|1|S
1441NR_all_65047.1
Exact match
Neurospora crassa
2MTJ|1|A (2MTJ)
  • RNA (47-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
47(1) 2MTJ|1|A
1442NR_all_07351.1
Exact match
Neurospora crassa
2MTK|5|A (2MTK)
  • RNA (47-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
47(1) 2MTK|5|A
1443NR_all_30107.1
Exact match
synthetic construct
2MTV|1|B (2MTV)
  • RNA_(5'-R(*UP*GP*(6MZ)P*CP*AP*C)-3')
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
5(1) 2MTV|1|B
1444NR_all_43426.1
Exact match
synthetic construct
2MVS|1|1+2MVS|1|2 (2MVS)
  • N-6_Methyl_Adenosine_RNA
  • SOLUTION NMR
  • Chain(s): 1, 2, D, E, F, H; model(s): 1
9(1) 2MVS|1|1+2MVS|1|2
1445NR_all_64202.1
Exact match
synthetic construct
2MVY|1|1+2MVY|1|2 (2MVY)
  • RNA
  • SOLUTION NMR
  • Chain(s): 1, 2, D, E, F, H; model(s): 1
10(1) 2MVY|1|1+2MVY|1|2
1446NR_all_18787.1
Exact match
synthetic construct
2MXJ|1|A (2MXJ)
  • RNA_(11-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
11(1) 2MXJ|1|A
1447NR_all_93978.1
Exact match
synthetic construct
2MXK|1|B+2MXK|1|A (2MXK)
  • RNA (5'-R(*UP*GP*GP*GP*AP*GP*UP*GP*CP*A)[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, E, F, H; model(s): 1
10(1) 2MXK|1|B+2MXK|1|A
1448NR_all_41092.1
Exact match
synthetic construct
2MXL|1|A (2MXL)
  • RNA (39-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
39(1) 2MXL|1|A
1449NR_all_16778.1
Exact match
synthetic construct
2MXY|1|B (2MXY)
  • 5'-R(*AP*UP*UP*UP*UP*UP*C)-3'
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
7(1) 2MXY|1|B
1450NR_all_35618.1
Exact match
synthetic construct
2MZ1|1|B (2MZ1)
  • 5'-R(*UP*UP*UP*UP*C)-3'
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
5(1) 2MZ1|1|B
1451NR_all_96665.1
Exact match
synthetic construct
2N0R|1|A (2N0R)
  • RNA (5'-R(*GP*CP*UP*GP*AP*GP*CP*UP*CP*GP[...]
  • SOLID-STATE NMR
  • Chain(s): A; model(s): 1
23(1) 2N0R|1|A
1452NR_all_92729.1
Exact match
Human immunodeficiency virus 1
2N1Q|5|A (2N1Q)
  • RNA_(155-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
155(1) 2N1Q|5|A
1453NR_all_26375.1
Exact match
synthetic construct
2N2O|1|A (2N2O)
  • RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 2N2O|1|A
1454NR_all_83550.1
Exact match
synthetic construct
2N2P|1|A (2N2P)
  • RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 2N2P|1|A
1455NR_all_12586.1
Exact match
synthetic construct
2N3O|1|B (2N3O)
  • RNA (5'-R(*GP*GP*GP*AP*CP*CP*UP*GP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
23(1) 2N3O|1|B
1456NR_all_91379.1
Exact match
synthetic construct
2N3Q|8|A (2N3Q)
  • RNA (62-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 8
62(1) 2N3Q|8|A
1457NR_all_45460.1
Exact match
Neurospora crassa
2N3R|5|A (2N3R)
  • RNA (62-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
62(1) 2N3R|5|A
1458NR_all_43318.1
Exact match
2N4L|6|A (2N4L)
  • RNA (53-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 6
53(1) 2N4L|6|A
1459NR_all_82659.1
Exact match
Neisseria meningitidis
2N6S|1|A (2N6S)
  • RNA (36-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
36(1) 2N6S|1|A
1460NR_all_81170.1
Exact match
Neisseria meningitidis
2N6T|1|A (2N6T)
  • RNA (42-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
42(1) 2N6T|1|A
1461NR_all_10877.1
Exact match
Neisseria meningitidis
2N6W|6|A (2N6W)
  • RNA (68-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 6
68(1) 2N6W|6|A
1462NR_all_67614.1
Exact match
Neisseria meningitidis
2N6X|3|A (2N6X)
  • RNA (43-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
43(1) 2N6X|3|A
1463NR_all_17677.1
Exact match
synthetic construct
2N7C|1|B (2N7C)
  • RNA_(5'-R(*AP*CP*AP*UP*CP*A)-3')
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
6(1) 2N7C|1|B
1464NR_all_22001.1
Exact match
2N7M|4|X (2N7M)
  • RNA (92-MER)
  • SOLUTION NMR
  • Chain(s): X; model(s): 4
92(1) 2N7M|4|X
1465NR_all_01761.1
Exact match
synthetic construct
2N7X|15|A (2N7X)
  • RNA (5'-R(*GP*GP*UP*AP*GP*UP*UP*UP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 15
23(1) 2N7X|15|A
1466NR_all_94843.1
Exact match
synthetic construct
2N82|3|A (2N82)
  • RNA (5'-R(*GP*GP*UP*AP*GP*UP*UP*UP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
23(1) 2N82|3|A
1467NR_all_82371.1
Exact match
synthetic construct
2N8L|1|B (2N8L)
  • RNA (5'-R(P*GP*CP*AP*CP*AP*CP*CP*C)-3')
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
8(1) 2N8L|1|B
1468NR_all_04322.1
Exact match
synthetic construct
2N8M|1|B (2N8M)
  • RNA (5'-R(P*UP*CP*GP*GP*AP*CP*U)-3')
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
7(1) 2N8M|1|B
1469NR_all_82460.1
Exact match
Apis mellifera
2N8V|1|X (2N8V)
  • RNA (70-MER)
  • SOLUTION NMR
  • Chain(s): X; model(s): 1
70(1) 2N8V|1|X
1470NR_all_59301.1
Exact match
synthetic construct
2NBX|1|A (2NBX)
  • IRES RNA (108-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
108(1) 2NBX|1|A
1471NR_all_20761.1
Exact match
synthetic construct
2NBY|6|A (2NBY)
  • IRES RNA (39-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 6
39(1) 2NBY|6|A
1472NR_all_27745.1
Exact match
synthetic construct
2NBZ|1|A (2NBZ)
  • IRES RNA 40-MER
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
40(1) 2NBZ|1|A
1473NR_all_14960.1
Exact match
synthetic construct
2NC0|1|A (2NC0)
  • IRES RNA (28-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
28(1) 2NC0|1|A
1474NR_all_04451.1
Exact match
synthetic construct
2NC1|1|A (2NC1)
  • IRES RNA (67-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
67(1) 2NC1|1|A
1475NR_all_37659.1
Exact match
2NCI|1|A (2NCI)
  • RNA (28-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
28(1) 2NCI|1|A
1476NR_all_89051.1
Exact match
Saccharomyces cerevisiae
2NOQ|1|D+2NOQ|1|C (2NOQ)
  • 18S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): C, D, E, F, H; model(s): 1
7.3 Å15(1) 2NOQ|1|D+2NOQ|1|C
1477NR_all_80987.1
Exact match
2NUE|1|C (2NUE)
  • 46-MER
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å46(1) 2NUE|1|C
1478NR_all_26402.1
Exact match
2NUG|1|E+2NUG|1|F+2NUG|1|C+2NUG|1|D (2NUG)
  • 5'-R(P*AP*GP*UP*GP*GP*CP*CP*UP*UP*GP*C)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, F, H; model(s): 1
1.7 Å13(1) 2NUG|1|E+2NUG|1|F+2NUG|1|C+2NUG|1|D
1479NR_all_22333.1
Exact match
2O32|1|A (2O32)
  • 5'-R(*(PSU)P*CP*UP*CP*(OMG)P*(OMG)P*CP*C[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 2O32|1|A
1480NR_all_63081.1
Exact match
2O33|20|A (2O33)
  • U2 snRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 20
20(1) 2O33|20|A
1481NR_all_48589.1
Exact match
2O3V|1|A+2O3V|1|B (2O3V)
  • RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, H; model(s): 1
2.8 Å22(1) 2O3V|1|A+2O3V|1|B
1482NR_all_70328.1
Exact match
2O81|1|A+2O81|1|B (2O81)
  • 5'-R(*GP*CP*(IG)P*GP*AP*(IC)P*GP*CP*A)-3[...]
  • SOLUTION NMR
  • Chain(s): A, B, C, D, H; model(s): 1
7(1) 2O81|1|A+2O81|1|B
1483NR_all_64534.1
Exact match
2O83|1|A+2O83|1|B (2O83)
  • 5'-R(*GP*GP*(IC)P*GP*AP*(IG)P*CP*CP*A)-3[...]
  • SOLUTION NMR
  • Chain(s): A, B, C, D, H; model(s): 1
7(1) 2O83|1|A+2O83|1|B
1484NR_all_10403.1
Exact match
Thermus thermophilus
2OB7|1|A (2OB7)
  • transfer-messenger RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
13.6 Å328(1) 2OB7|1|A
1485NR_all_73746.1
Exact match
2OE5|1|B+2OE5|1|A (2OE5)
  • RNA (5'-R(*GP*GP*UP*AP*CP*UP*AP*AP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, H; model(s): 1
1.5 Å17(1) 2OE5|1|B+2OE5|1|A
1486NR_all_60142.1
Exact match
2OIU|1|P (2OIU)
  • L1 Ribozyme RNA Ligase
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
2.6 Å71(1) 2OIU|1|P
1487NR_all_36247.1
Exact match
2OIU|1|Q (2OIU)
  • L1 Ribozyme RNA Ligase
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
2.6 Å71(1) 2OIU|1|Q
1488NR_all_18515.1
Exact match
2OJ7|1|A (2OJ7)
  • 5'-R(P*GP*CP*UP*GP*UP*UP*GP*U)-3'
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
8(1) 2OJ7|1|A
1489NR_all_26035.1
Exact match
2OJ8|1|A (2OJ8)
  • 5'-R(P*GP*CP*UP*GP*UP*UP*GP*U)-3'
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
8(1) 2OJ8|1|A
1490NR_all_83599.1
Exact match
Thermus thermophilus
2OM7|1|A (2OM7)
  • Fragment of 16S rRNA (h14)
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
7.3 Å12(1) 2OM7|1|A
1491NR_all_11040.1
Exact match
Thermus thermophilus
2OM7|1|B (2OM7)
  • Fragment of 16S rRNA (h15)
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
7.3 Å10(1) 2OM7|1|B
1492NR_all_22009.1
Exact match
Thermus thermophilus
2OM7|1|D (2OM7)
  • 16S ribosomal RNA (H5)
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
7.3 Å13(1) 2OM7|1|D
1493NR_all_78730.1
Exact match
Thermus thermophilus
2OM7|1|F (2OM7)
  • Fragment of23S rRNA (H95)
  • ELECTRON MICROSCOPY
  • Chain(s): F; model(s): 1
7.3 Å29(1) 2OM7|1|F
1494NR_all_42833.1
Exact match
Thermus thermophilus
2OM7|1|G (2OM7)
  • Fragment of23S rRNA (H68)
  • ELECTRON MICROSCOPY
  • Chain(s): G; model(s): 1
7.3 Å54(1) 2OM7|1|G
1495NR_all_22252.1
Exact match
Thermus thermophilus
2OM7|1|H (2OM7)
  • Fragment of23S rRNA (H89)
  • ELECTRON MICROSCOPY
  • Chain(s): H; model(s): 1
7.3 Å42(1) 2OM7|1|H
1496NR_all_04153.1
Exact match
Thermus thermophilus
2OM7|1|I (2OM7)
  • Fragment of23S rRNA (H42-44)
  • ELECTRON MICROSCOPY
  • Chain(s): I; model(s): 1
7.3 Å58(1) 2OM7|1|I
1497NR_all_90313.1
Exact match
Thermus thermophilus
2OM7|1|J (2OM7)
  • Fragment of23S rRNA (H76)
  • ELECTRON MICROSCOPY
  • Chain(s): J; model(s): 1
7.3 Å73(1) 2OM7|1|J
1498NR_all_60168.1
Exact match
2OOM|3|A (2OOM)
  • RNA 16-mer
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
16(1) 2OOM|3|A
1499NR_all_26735.1
Exact match
2P89|3|A (2P89)
  • U65 H/ACA snoRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
34(1) 2P89|3|A
1500NR_all_00085.1
Exact match
2PCV|5|A (2PCV)
  • U65 Box H/ACA snoRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 5
35(1) 2PCV|5|A
1501NR_all_55381.1
Exact match
2PCW|1|A (2PCW)
  • U65 box H/ACA snoRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
35(1) 2PCW|1|A
1502NR_all_68957.1
Exact match
2PJP|1|B (2PJP)
  • SECIS RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å23(1) 2PJP|1|B
1503NR_all_66026.1
Exact match
2PN9|1|A+2PN9|1|B (2PN9)
  • 5'-R(*GP*GP*AP*GP*CP*CP*UP*GP*GP*GP*AP*G[...]
  • SOLUTION NMR
  • Chain(s): A, B, C, D, H; model(s): 1
16(1) 2PN9|1|A+2PN9|1|B
1504NR_all_32733.1
Exact match
2PO1|1|C (2PO1)
  • 10-mer poly(A)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.9 Å7(1) 2PO1|1|C
1505NR_all_23233.1
Exact match
2Q66|1|X (2Q66)
  • 5'-R(P*AP*AP*AP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
1.8 Å5(1) 2Q66|1|X
1506NR_all_09747.1
Exact match
2QH2|1|A (2QH2)
  • Human telomerase RNA CR7 terminal hairpi[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
24(1) 2QH2|1|A
1507NR_all_98616.1
Exact match
2QH3|1|A (2QH3)
  • Human U64 H/ACA snoRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 2QH3|1|A
1508NR_all_33897.1
Exact match
2QH4|19|A (2QH4)
  • Human U85 C/D-H/ACA scaRNA
  • SOLUTION NMR
  • Chain(s): A; model(s): 19
18(1) 2QH4|19|A
1509NR_all_73487.1
Exact match
2QK9|1|B (2QK9)
  • 5'-R(*AP*GP*UP*GP*CP*GP*AP*CP*AP*CP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.6 Å18(1) 2QK9|1|B
1510NR_all_99291.1
Exact match
2QKB|1|C (2QKB)
  • 5'-R(*GP*GP*AP*GP*UP*GP*CP*GP*AP*CP*AP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.4 Å19(1) 2QKB|1|C
1511NR_all_33684.1
Exact match
2R1G|1|A (2R1G)
  • 16S RIBOSOMAL RNA HELIX 1
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
12.5 Å24(1) 2R1G|1|A
1512NR_all_74884.1
Exact match
2R1G|1|D (2R1G)
  • 16S RIBOSOMAL RNA HELIX 28
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
12.5 Å28(1) 2R1G|1|D
1513NR_all_38243.1
Exact match
2R1G|1|E (2R1G)
  • 16S RIBOSOMAL RNA HELIX 44
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
12.5 Å11(1) 2R1G|1|E
1514NR_all_79547.1
Exact match
2R1G|1|F (2R1G)
  • 16S RIBOSOMAL RNA HELIX 45
  • ELECTRON MICROSCOPY
  • Chain(s): F; model(s): 1
12.5 Å29(1) 2R1G|1|F
1515NR_all_05459.1
Exact match
2R1G|1|X (2R1G)
  • 16S RIBOSOMAL RNA HELIX 44
  • ELECTRON MICROSCOPY
  • Chain(s): X; model(s): 1
12.5 Å11(1) 2R1G|1|X
1516NR_all_46239.1
Exact match
2R7S|1|X (2R7S)
  • RNA (5'-R(*UP*GP*UP*GP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.2 Å6(1) 2R7S|1|X
1517NR_all_46386.1
Exact match
2R7T|1|X (2R7T)
  • RNA (5'-R(*UP*GP*UP*GP*AP*AP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.0 Å7(1) 2R7T|1|X
1518NR_all_37940.1
Exact match
2R7U|1|X (2R7U)
  • RNA (5'-R(*AP*A*AP*AP*GP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
3.1 Å5(1) 2R7U|1|X
1519NR_all_70523.1
Exact match
2R7V|1|X (2R7V)
  • RNA (5'-R(*G*GP*CP*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.8 Å5(1) 2R7V|1|X
1520NR_all_52785.1
Exact match
2R7Z|1|P (2R7Z)
  • 5'-R(*UP*UP*UP*GP*AP*GP*GP*AP*GP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.8 Å10(1) 2R7Z|1|P
1521NR_all_50660.1
Exact match
2R92|1|T+2R92|1|P (2R92)
  • RNA (5'-R(*CP*UP*UP*GP*AP*CP*GP*CP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, H, P, T; model(s): 1
3.8 Å10(1) 2R92|1|T+2R92|1|P
1522NR_all_83556.1
Exact match
2R93|1|R (2R93)
  • RNA (5'-R(*UP*GP*AP*UP*UP*CP*UP*CP*UP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
4.0 Å14(1) 2R93|1|R
1523NR_all_48282.1
Exact match
2RFK|1|E+2RFK|1|D+2RFK|1|F (2RFK)
  • guide RNA 2
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, H; model(s): 1
2.9 Å26(1) 2RFK|1|E+2RFK|1|D+2RFK|1|F
1524NR_all_75716.1
Exact match
2RLU|1|A (2RLU)
  • RNA (5'-R(*GP*GP*UP*UP*GP*CP*GP*GP*GP*UP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
19(1) 2RLU|1|A
1525NR_all_56484.1
Exact match
2RN1|3|A (2RN1)
  • RNA (5'-R(P*GP*AP*GP*CP*CP*CP*UP*GP*GP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
16(1) 2RN1|3|A
1526NR_all_65694.1
Exact match
2RO2|1|A (2RO2)
  • RNA (5'-R(*GP*GP*GP*AP*GP*AP*CP*CP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 2RO2|1|A
1527NR_all_20137.1
Exact match
2RPK|1|A (2RPK)
  • RNA (5'-R(*GP*GP*GP*AP*UP*CP*CP*AP*UP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
20(1) 2RPK|1|A
1528NR_all_04048.1
Exact match
2RPT|2|A (2RPT)
  • RNA (5'-R(*GP*GP*CP*CP*CP*GP*CP*CP*GP*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 2
20(1) 2RPT|2|A
1529NR_all_66903.1
Exact match
2RQC|1|B (2RQC)
  • 5'-R(*UP*GP*UP*GP*UP*G)-3'
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
6(1) 2RQC|1|B
1530NR_all_95193.1
Exact match
2RRA|1|B (2RRA)
  • 5'-R(*GP*AP*AP*GP*AP*A)-3'
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
6(1) 2RRA|1|B
1531NR_all_51689.1
Exact match
2RRC|4|A (2RRC)
  • 5'-R(P*GP*GP*AP*CP*CP*CP*(AP7)P*CP*CP*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 4
21(1) 2RRC|4|A
1532NR_all_69284.1
Exact match
2RS2|1|B (2RS2)
  • RNA (5'-R(*GP*UP*AP*GP*U)-3')
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
5(1) 2RS2|1|B
1533NR_all_92379.1
Exact match
2RU3|1|B (2RU3)
  • RNA (5'-R(*GP*UP*GP*UP*GP*C)-3')
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
6(1) 2RU3|1|B
1534NR_all_93004.1
Exact match
Danio rerio
2RVO|3|A (2RVO)
  • RNA (34-MER)
  • SOLUTION NMR
  • Chain(s): A; model(s): 3
34(1) 2RVO|3|A
1535NR_all_97434.1
Exact match
2TOB|1|A (2TOB)
  • RNA (5'-R(*AP*CP*UP*UP*GP*GP*UP*UP*UP*AP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
20(1) 2TOB|1|A
1536NR_all_29777.1
Exact match
2TPK|1|A (2TPK)
  • RNA (MRNA PSEUDOKNOT)
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
36(1) 2TPK|1|A
1537NR_all_71302.1
Exact match
2UXB|1|Y+2UXB|1|X (2UXB)
  • ANTICODON STEM-LOOP OF TRANSFER RNA WITH[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, F, H, X, Y; model(s): 1
3.1 Å7(1) 2UXB|1|Y+2UXB|1|X
1538NR_all_07184.1
Exact match
synthetic construct
2UXC|1|X+2UXC|1|Y (2UXC)
  • A-SITE MESSENGER RNA FRAGMENT CGGG
  • X-RAY DIFFRACTION
  • Chain(s): D, F, H, X, Y; model(s): 1
2.9 Å9(1) 2UXC|1|X+2UXC|1|Y
1539NR_all_12173.1
Exact match
2UXD|1|Y+2UXD|1|X (2UXD)
  • A-SITE MESSENGER RNA FRAGMENT CGGG
  • X-RAY DIFFRACTION
  • Chain(s): D, F, H, X, Y; model(s): 1
3.2 Å8(1) 2UXD|1|Y+2UXD|1|X
1540NR_all_29312.1
Exact match
Escherichia coli
2V6W|1|A+2V6W|1|B (2V6W)
  • 5'-R(*GP*GP*AP*GP*AP*GP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
1.8 Å7(1) 2V6W|1|A+2V6W|1|B
1541NR_all_65010.1
Exact match
Homo sapiens
2V7R|1|A+2V7R|1|B (2V7R)
  • HUMAN TRNAGLY MICROHELIX
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
1.2 Å7(1) 2V7R|1|A+2V7R|1|B
1542NR_all_79104.1
Exact match
Escherichia coli
2VAZ|1|A (2VAZ)
  • RPSO MRNA OPERATOR
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
10.0 Å82(1) 2VAZ|1|A
1543NR_all_30422.1
Exact match
Saccharomyces cerevisiae
2VNU|1|B (2VNU)
  • 5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å10(1) 2VNU|1|B
1544NR_all_49650.1
Exact match
Homo sapiens
2VOP|1|B (2VOP)
  • 5'-R(*AP*UP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.8 Å5(1) 2VOP|1|B
1545NR_all_99944.1
Exact match
Escherichia coli
2VRT|1|G (2VRT)
  • 5'-R(*UP*UP*GP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
3.5 Å3(1) 2VRT|1|G
1546NR_all_03143.1
Exact match
Escherichia coli
2VRT|1|H (2VRT)
  • 5'-R(*UP*UP*GP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
3.5 Å3(1) 2VRT|1|H
1547NR_all_01515.1
Exact match
2VUM|1|P (2VUM)
  • 5'-R(*AP*AP*AP*GP*AP*CP*CP*AP*GP*GP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.4 Å10(1) 2VUM|1|P
1548NR_all_06107.1
Exact match
Homo sapiens
2VUQ|1|A+2VUQ|1|B (2VUQ)
  • 5'-R(*GP*CP*AP*UP*UP*GP*GP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
1.2 Å7(1) 2VUQ|1|A+2VUQ|1|B
1549NR_all_12174.1
Exact match
Triticum aestivum
2WWB|1|D (2WWB)
  • 5.8S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
6.5 Å63(1) 2WWB|1|D
1550NR_all_78722.1
Exact match
Triticum aestivum
2WWB|1|E (2WWB)
  • 25S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
6.5 Å34(1) 2WWB|1|E
1551NR_all_99842.1
Exact match
Triticum aestivum
2WWB|1|F (2WWB)
  • 25S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): F; model(s): 1
6.5 Å25(1) 2WWB|1|F
1552NR_all_11900.1
Exact match
Triticum aestivum
2WWB|1|G (2WWB)
  • 25S RRNA
  • ELECTRON MICROSCOPY
  • Chain(s): G; model(s): 1
6.5 Å14(1) 2WWB|1|G
1553NR_all_39330.1
Exact match
Saccharomyces cerevisiae
2X7N|1|A (2X7N)
  • SARCIN-RICIN LOOP
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
11.8 Å28(1) 2X7N|1|A
1554NR_all_62870.1
Exact match
synthetic construct
2XB2|1|E (2XB2)
  • RNA POLY-U-RIBONUCLEOTIDE
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.4 Å8(1) 2XB2|1|E
1555NR_all_43421.1
Exact match
synthetic construct
2XB2|1|R (2XB2)
  • RNA POLY-U-RIBONUCLEOTIDE
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.4 Å7(1) 2XB2|1|R
1556NR_all_45692.1
Exact match
2XBM|1|E+2XBM|1|F (2XBM)
  • 5'-(*G3AP*GP*AP*AP*CP*CP*UP*GP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, H; model(s): 1
2.9 Å8(1) 2XBM|1|E+2XBM|1|F
1557NR_all_71000.1
Exact match
2XC7|1|P (2XC7)
  • 5'-(AP*UP*CP*GP)-3'
  • SOLUTION NMR
  • Chain(s): P; model(s): 1
4(1) 2XC7|1|P
1558NR_all_27904.1
Exact match
2XD0|1|W (2XD0)
  • TOXI
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
3.0 Å35(1) 2XD0|1|W
1559NR_all_75614.1
Exact match
Homo sapiens
2XEB|1|A+2XEB|1|B (2XEB)
  • 5'-R(P*GP*AP*UP*CP*GP*UP*AP*GP*CP*CP*AP*[...]
  • SOLUTION NMR
  • Chain(s): A, B, D, F, H; model(s): 1
19(1) 2XEB|1|A+2XEB|1|B
1560NR_all_84157.1
Exact match
synthetic construct
2XFM|1|B (2XFM)
  • 5'-R(*AP*CP*CP*GP*AP*CP*UP*(OMU)P)-3'
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
7(1) 2XFM|1|B
1561NR_all_11258.1
Exact match
2XGJ|1|C (2XGJ)
  • RNA (5'-(*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å5(1) 2XGJ|1|C
1562NR_all_74135.1
Exact match
2XGJ|1|D (2XGJ)
  • RNA (5'-(*AP*AP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.9 Å5(1) 2XGJ|1|D
1563NR_all_80967.1
Exact match
Escherichia coli
2XKV|1|B (2XKV)
  • 4.5S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
13.5 Å96(1) 2XKV|1|B
1564NR_all_24558.1
Exact match
Saccharomyces cerevisiae
2XNR|1|C (2XNR)
  • 5'-R(*UP*UP*CP*UP*UP*AP*UP*UP*CP*UP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.6 Å5(1) 2XNR|1|C
1565NR_all_00973.1
Exact match
Mus musculus
2XS2|1|B (2XS2)
  • 5'-R(*UP*UP*GP*UP*UP*CP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.4 Å7(1) 2XS2|1|B
1566NR_all_12819.1
Exact match
Mus musculus
2XS7|1|B (2XS7)
  • 5'-R(*UP*UP*GP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.5 Å5(1) 2XS7|1|B
1567NR_all_75793.1
Exact match
synthetic construct
2XZO|1|D (2XZO)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.4 Å7(1) 2XZO|1|D
1568NR_all_87252.1
Exact match
2Y8W|1|B (2Y8W)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å19(1) 2Y8W|1|B
1569NR_all_78183.1
Exact match
2Y8Y|1|B (2Y8Y)
  • 5'-R(*UP*CP*CP*CP*CP*AP*CP*GP*CP*GP*UP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.4 Å18(1) 2Y8Y|1|B
1570NR_all_98018.1
Exact match
Homo sapiens
2Y95|1|A (2Y95)
  • 5'-R(*GP*GP*CP*GP*CP*AP*UP*CP*GP*GP*CP*G[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
14(1) 2Y95|1|A
1571NR_all_85410.1
Exact match
Homo sapiens
2YH1|1|B (2YH1)
  • 5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP)-3'
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
9(1) 2YH1|1|B
1572NR_all_35537.1
Exact match
Thermus aquaticus
2Z9Q|1|A (2Z9Q)
  • tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
11.7 Å61(1) 2Z9Q|1|A
1573NR_all_42560.1
Exact match
2ZI0|1|C+2ZI0|1|D (2ZI0)
  • RNA (5'-D(P*AP*GP*AP*CP*AP*GP*CP*AP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, H; model(s): 1
2.8 Å20(1) 2ZI0|1|C+2ZI0|1|D
1574NR_all_94226.1
Exact match
2ZKO|1|C+2ZKO|1|D (2ZKO)
  • RNA (5'-R(P*AP*GP*AP*CP*AP*GP*CP*AP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, H; model(s): 1
1.7 Å21(1) 2ZKO|1|C+2ZKO|1|D
1575NR_all_78506.1
Exact match
2ZY6|1|A (2ZY6)
  • phenylalanyl transfer RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.8 Å38(1) 2ZY6|1|A
1576NR_all_98075.1
Exact match
2ZZM|1|B (2ZZM)
  • RNA (84-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.7 Å84(1) 2ZZM|1|B
1577NR_all_12322.1
Exact match
333D|1|A (333D)
  • RNA (5'-R(*CP*GP*CP*AP*IP*GP*CP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.5 Å7(1) 333D|1|A
1578NR_all_99060.1
Exact match
353D|1|A+353D|1|B (353D)
  • RNA (5'-R(*AP*UP*CP*CP*CP*CP*CP*GP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
2.4 Å12(1) 353D|1|A+353D|1|B
1579NR_all_63943.1
Exact match
Escherichia coli
354D|1|A+354D|1|B (354D)
  • RNA (5'-R(*CP*CP*GP*AP*UP*GP*GP*UP*AP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
1.5 Å12(1) 354D|1|A+354D|1|B
1580NR_all_73526.1
Exact match
361D|1|A (361D)
  • RNA (5'-R(*CP*UP*GP*GP*GP*CP*GP*GP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å20(1) 361D|1|A
1581NR_all_70550.1
Exact match
361D|1|B (361D)
  • RNA (5'-R(*CP*UP*GP*GP*GP*CP*GP*GP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å20(1) 361D|1|B
1582NR_all_96653.1
Exact match
387D|1|A (387D)
  • RNA Pseudoknot
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å26(1) 387D|1|A
1583NR_all_45442.1
Exact match
397D|1|A+397D|1|B (397D)
  • RNA (5'-R(*GP*GP*CP*CP*AP*GP*AP*UP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
1.3 Å15(1) 397D|1|A+397D|1|B
1584NR_all_93513.1
Exact match
3ADI|1|D+3ADI|1|E (3ADI)
  • RNA (5'-R(P*CP*UP*CP*GP*AP*UP*AP*AP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, H; model(s): 1
3.2 Å10(1) 3ADI|1|D+3ADI|1|E
1585NR_all_39323.1
Exact match
3ADL|1|B+3ADL|1|C (3ADL)
  • RNA (5'-R(P*CP*GP*CP*GP*CP*GP*CP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, H; model(s): 1
2.2 Å10(1) 3ADL|1|B+3ADL|1|C
1586NR_all_65768.1
Exact match
3AEV|1|C (3AEV)
  • RNA (5'-R(*GP*GP*AP*UP*CP*AP*CP*CP*UP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å11(1) 3AEV|1|C
1587NR_all_75304.1
Exact match
3AHU|1|X (3AHU)
  • 5'-R(*AP*GP*AP*GP*AP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.2 Å6(1) 3AHU|1|X
1588NR_all_13919.1
Exact match
3AM1|1|B (3AM1)
  • ASL-truncated tRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å81(1) 3AM1|1|B
1589NR_all_75747.1
Exact match
3AVT|1|T (3AVT)
  • RNA (5'-R(*AP*UP*CP*GP*CP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): T; model(s): 1
2.6 Å4(1) 3AVT|1|T
1590NR_all_29245.1
Exact match
3AVU|1|T+3AVU|1|G (3AVU)
  • RNA (5'-R(*AP*UP*CP*GP*UP*GP*GP*AP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, F, G, H, T; model(s): 1
2.9 Å9(1) 3AVU|1|T+3AVU|1|G
1591NR_all_26115.1
Exact match
3AVV|1|T+3AVV|1|G (3AVV)
  • RNA (5'-R(*AP*AP*CP*GP*AP*UP*GP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, F, G, H, T; model(s): 1
3.1 Å11(1) 3AVV|1|T+3AVV|1|G
1592NR_all_55371.1
Exact match
3AVW|1|T+3AVW|1|G (3AVW)
  • RNA (5'-R(*AP*UP*CP*GP*UP*GP*GP*AP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, F, G, H, T; model(s): 1
2.6 Å12(1) 3AVW|1|T+3AVW|1|G
1593NR_all_51980.1
Exact match
3AVX|1|T+3AVX|1|G (3AVX)
  • RNA (5'-R(*AP*AP*CP*GP*AP*UP*GP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, F, G, H, T; model(s): 1
2.4 Å13(1) 3AVX|1|T+3AVX|1|G
1594NR_all_09827.1
Exact match
3AVY|1|T+3AVY|1|G (3AVY)
  • RNA (5'-R(*AP*AP*CP*GP*AP*UP*UP*UP*UP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, F, G, H, T; model(s): 1
2.6 Å14(1) 3AVY|1|T+3AVY|1|G
1595NR_all_21191.1
Exact match
3BNT|1|A (3BNT)
  • A site of human mitochondrial ribosome
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.3 Å21(1) 3BNT|1|A
1596NR_all_09764.1
Exact match
3BOY|1|D (3BOY)
  • 5'-R(*UP*UP*UP*AP*GP*UP*UP*UP*UP*UP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.7 Å22(1) 3BOY|1|D
1597NR_all_76670.1
Exact match
3BSB|1|C (3BSB)
  • 5'-R(*UP*UP*UP*AP*AP*UP*GP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å9(1) 3BSB|1|C
1598NR_all_17852.1
Exact match
3CGR|1|B+3CGR|1|A (3CGR)
  • RNA (5'-R(*CP*GP*CP*AP*CP*UP*AP*AP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
2.1 Å13(1) 3CGR|1|B+3CGR|1|A
1599NR_all_46216.1
Exact match
3CGS|1|B+3CGS|1|A (3CGS)
  • RNA (5'-R(*CP*GP*CP*UP*AP*CP*UP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
1.7 Å13(1) 3CGS|1|B+3CGS|1|A
1600NR_all_17773.1
Exact match
3CIY|1|C+3CIY|1|D (3CIY)
  • 46-MER
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, H; model(s): 1
3.4 Å46(1) 3CIY|1|C+3CIY|1|D
1601NR_all_96160.1
Exact match
3CJZ|1|A+3CJZ|1|B (3CJZ)
  • RNA (5'-R(*GP*GP*AP*CP*GP*(M2G)P*AP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
1.8 Å12(1) 3CJZ|1|A+3CJZ|1|B
1602NR_all_98916.1
Exact match
3CZW|1|X (3CZW)
  • RNA (5'-R(*G*UP*GP*GP*UP*CP*UP*GP*AP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
1.4 Å15(1) 3CZW|1|X
1603NR_all_33763.1
Exact match
3D0M|1|X (3D0M)
  • RNA (5'-R(*GP*UP*GP*GP*UP*CP*UP*GP*AP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.0 Å16(1) 3D0M|1|X
1604NR_all_76733.1
Exact match
3DD2|1|B (3DD2)
  • RNA (26-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å15(1) 3DD2|1|B
1605NR_all_17203.1
Exact match
Escherichia coli
3DEG|1|E (3DEG)
  • 30S RNA helix 8
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
10.9 Å16(1) 3DEG|1|E
1606NR_all_05581.1
Exact match
Escherichia coli
3DEG|1|F (3DEG)
  • 30S RNA helix 14
  • ELECTRON MICROSCOPY
  • Chain(s): F; model(s): 1
10.9 Å12(1) 3DEG|1|F
1607NR_all_18034.1
Exact match
Escherichia coli
3DEG|1|G (3DEG)
  • 50S RNA helix 42-44
  • ELECTRON MICROSCOPY
  • Chain(s): G; model(s): 1
10.9 Å70(1) 3DEG|1|G
1608NR_all_50559.1
Exact match
Escherichia coli
3DEG|1|J (3DEG)
  • 50S RNA helix 71
  • ELECTRON MICROSCOPY
  • Chain(s): J; model(s): 1
10.9 Å18(1) 3DEG|1|J
1609NR_all_15428.1
Exact match
Escherichia coli
3DEG|1|K (3DEG)
  • 50S RNA helix 92
  • ELECTRON MICROSCOPY
  • Chain(s): K; model(s): 1
10.9 Å15(1) 3DEG|1|K
1610NR_all_82016.1
Exact match
3DHS|1|A (3DHS)
  • RNase P RNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.6 Å215(1) 3DHS|1|A
1611NR_all_91663.1
Exact match
Canis lupus
3DKN|1|D+3DKN|1|E (3DKN)
  • RNA (5'-R(P*CP*GP*UP*GP*CP*CP*AP*AP*GP*C[...]
  • ELECTRON MICROSCOPY
  • Chain(s): D, E, F, H; model(s): 1
8.7 Å20(1) 3DKN|1|D+3DKN|1|E
1612NR_all_44181.1
Exact match
Canis lupus
3DKN|1|F (3DKN)
  • RNA (32-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): F; model(s): 1
8.7 Å32(1) 3DKN|1|F
1613NR_all_39268.1
Exact match
3E2E|1|R (3E2E)
  • RNA (5'-R(*GP*GP*GP*AP*GP*UP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.0 Å7(1) 3E2E|1|R
1614NR_all_30439.1
Exact match
3EGZ|1|B (3EGZ)
  • Tetracycline aptamer and artificial ribo[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å65(1) 3EGZ|1|B
1615NR_all_71214.1
Exact match
Escherichia coli
3EQ4|1|Y (3EQ4)
  • tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): Y; model(s): 1
12.0 Å85(1) 3EQ4|1|Y
1616NR_all_62752.1
Exact match
3EQT|1|C+3EQT|1|D (3EQT)
  • 5'-R(*GP*CP*GP*CP*GP*CP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, H; model(s): 1
2.0 Å8(1) 3EQT|1|C+3EQT|1|D
1617NR_all_40973.1
Exact match
3ERC|1|G (3ERC)
  • RNA/DNA chimera (5'-D(CP*)R(UP*UP*)-D(C)[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
3.2 Å2(1) 3ERC|1|G
1618NR_all_48843.1
Exact match
3ERC|1|I (3ERC)
  • RNA/DNA chimera (5'-D(CP*CP*)R(UP*UP*)D([...]
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
3.2 Å2(1) 3ERC|1|I
1619NR_all_80904.1
Exact match
3FHT|1|C (3FHT)
  • RNA (5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.2 Å6(1) 3FHT|1|C
1620NR_all_15144.1
Exact match
3FHT|1|D (3FHT)
  • RNA (5'-R(*UP*UP*UP*UP*UP*UP*UP*UP*UP*U)[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.2 Å6(1) 3FHT|1|D
1621NR_all_55153.1
Exact match
3FS0|1|B+3FS0|1|A (3FS0)
  • 5'-R(*CP*CP*AP*GP*UP*CP*GP*GP*AP*AP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
2.3 Å11(1) 3FS0|1|B+3FS0|1|A
1622NR_all_55295.1
Exact match
3FTE|1|C+3FTE|1|D (3FTE)
  • 5'-R(P*AP*AP*CP*CP*GP*UP*AP*GP*GP*GP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, H; model(s): 1
3.0 Å22(1) 3FTE|1|C+3FTE|1|D
1623NR_all_25813.1
Exact match
3FTF|1|C+3FTF|1|D (3FTF)
  • 5'-R(P*AP*AP*CP*CP*GP*UP*AP*GP*GP*GP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, F, H; model(s): 1
2.8 Å22(1) 3FTF|1|C+3FTF|1|D
1624NR_all_69076.1
Exact match
3G0H|1|E (3G0H)
  • 5'-R(P*UP*UP*UP*UP*UP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.7 Å7(1) 3G0H|1|E
1625NR_all_49451.1
Exact match
3G9Y|1|C (3G9Y)
  • RNA (5'-R(*AP*GP*GP*UP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.4 Å8(1) 3G9Y|1|C
1626NR_all_82961.1
Exact match
3GIB|1|H (3GIB)
  • 5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.4 Å9(1) 3GIB|1|H
1627NR_all_24791.1
Exact match
3GS5|1|A (3GS5)
  • RNA (25-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.8 Å27(1) 3GS5|1|A
1628NR_all_24663.1
Exact match
3GS5|1|C (3GS5)
  • RNA (36-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å36(1) 3GS5|1|C
1629NR_all_93052.1
Exact match
3GTG|1|R (3GTG)
  • RNA (5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.8 Å12(1) 3GTG|1|R
1630NR_all_74183.1
Exact match
3GTL|1|R (3GTL)
  • RNA (5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.4 Å12(1) 3GTL|1|R
1631NR_all_48000.1
Exact match
3GTO|1|R (3GTO)
  • RNA (5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
4.0 Å12(1) 3GTO|1|R
1632NR_all_28179.1
Exact match
3GTP|1|R (3GTP)
  • RNA (5'-R(*AP*UP*CP*GP*AP*GP*AP*GP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.9 Å13(1) 3GTP|1|R
1633NR_all_69936.1
Exact match
3GTQ|1|R (3GTQ)
  • RNA (5'-R(P*AP*UP*CP*GP*AP*GP*AP*GP*GP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.8 Å11(1) 3GTQ|1|R
1634NR_all_80567.1
Exact match
3GVN|1|A+3GVN|1|B (3GVN)
  • 5'-R(*GP*GP*UP*GP*AP*GP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, F, H; model(s): 1
1.2 Å7(1) 3GVN|1|A+3GVN|1|B
1635NR_all_86975.1
Exact match
3H3V|1|P (3H3V)
  • 5'-D(*CP*AP*GP*CP*TP*AP*CP*TP*TP*GP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
4.0 Å8(1) 3H3V|1|P
1636NR_all_34126.1
Exact match
3HAX|1|E (3HAX)
  • H/ACA RNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.1 Å60(1) 3HAX|1|E
1637NR_all_42461.1
Exact match
3HAY|1|E (3HAY)
  • H/ACA RNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
5.0 Å69(1) 3HAY|1|E
1638NR_all_44916.1
Exact match
3HJF|1|Y (3HJF)
  • 5'-R(*CP*AP*AP*CP*CP*UP*AP*CP*UP*AP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
3.1 Å15(1) 3HJF|1|Y
1639NR_all_79502.1
Exact match
3HJY|1|D+3HJY|1|C+3HJY|1|E (3HJY)
  • RNA (25-MER)
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, H; model(s): 1
3.7 Å25(1) 3HJY|1|D+3HJY|1|C+3HJY|1|E
1640NR_all_57417.1
Exact match
3HO1|1|Y (3HO1)
  • 5'-R(P*CP*CP*UP*AP*CP*UP*AP*CP*CP*UP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): Y; model(s): 1
2.6 Å12(1) 3HO1|1|Y
1641NR_all_33750.1
Exact match
3HOV|1|P (3HOV)
  • 5'-R(*UP*GP*CP*AP*UP*UP*UP*CP*GP*AP*CP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.5 Å10(1) 3HOV|1|P
1642NR_all_40852.1
Exact match
3HOY|1|P (3HOY)
  • 5'-R(*UP*AP*UP*AP*UP*GP*CP*A*UP*AP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.4 Å10(1) 3HOY|1|P
1643NR_all_63409.1
Exact match
3HOZ|1|P (3HOZ)
  • 5'-R(*UP*GP*CP*AP*UP*UP*U*CP*AP*AP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.7 Å11(1) 3HOZ|1|P
1644NR_all_23301.1
Exact match
3HSB|1|X (3HSB)
  • RNA (5'-R(*AP*GP*AP*GP*AP*GP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.2 Å7(1) 3HSB|1|X
1645NR_all_38973.1
Exact match
3I4M|1|P (3I4M)
  • RNA (5'-R(*UP*GP*CP*AP*UP*C*UP*UP*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.7 Å10(1) 3I4M|1|P
1646NR_all_83504.1
Exact match
3I4N|1|P (3I4N)
  • RNA (5'-R(*UP*GP*CP*AP*UP*C*UP*UP*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.9 Å10(1) 3I4N|1|P
1647NR_all_01806.1
Exact match
3IAB|1|R (3IAB)
  • P3 domain of the RNA component of RNase [...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.7 Å46(1) 3IAB|1|R
1648NR_all_07832.1
Exact match
3IBK|1|A (3IBK)
  • RNA (5'-R(*(5BU)P*AP*GP*GP*GP*UP*UP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.2 Å11(1) 3IBK|1|A
1649NR_all_70081.1
Exact match
3IBK|1|B (3IBK)
  • RNA (5'-R(*(5BU)P*AP*GP*GP*GP*UP*UP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å11(1) 3IBK|1|B
1650NR_all_78175.1
Exact match
3ICE|1|G (3ICE)
  • 5'-R(P*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.8 Å6(1) 3ICE|1|G
1651NR_all_65401.1
Exact match
3IEV|1|D (3IEV)
  • 5'-R(P*AP*UP*CP*AP*CP*CP*UP*CP*CP*UP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
1.9 Å12(1) 3IEV|1|D
1652NR_all_44994.1
Exact match
Leishmania tarentolae
3IY8|1|A (3IY8)
  • Leishmania tarentolae mitochondrial smal[...]
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
14.1 Å540(1) 3IY8|1|A
1653NR_all_51668.1
Exact match
Leishmania tarentolae
3IY9|1|A (3IY9)
  • Leishmania Tarentolae Mitochondrial Larg[...]
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
14.1 Å1027(1) 3IY9|1|A
1654NR_all_17064.1
Exact match
Saccharomyces cerevisiae
3IZD|1|A (3IZD)
  • rRNA expansion segment ES27L in an 'out'[...]
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
8.6 Å151(1) 3IZD|1|A
1655NR_all_58975.1
Exact match
Bos taurus
3IZY|1|N (3IZY)
  • tRNA-Phe
  • ELECTRON MICROSCOPY
  • Chain(s): N; model(s): 1
10.8 Å76(1) 3IZY|1|N
1656NR_all_69815.1
Exact match
Escherichia coli
3IZZ|1|A (3IZZ)
  • Helix 5, 14, 15 (Small Subunit)
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
10.8 Å59(1) 3IZZ|1|A
1657NR_all_50467.1
Exact match
Escherichia coli
3IZZ|1|B (3IZZ)
  • Helix 69, 71, 89, 92, 95 (Large Subunit)
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
10.8 Å118(1) 3IZZ|1|B
1658NR_all_85143.1
Exact match
Escherichia coli
3IZZ|1|D (3IZZ)
  • Helix 18 (Small Subunit)
  • ELECTRON MICROSCOPY
  • Chain(s): D; model(s): 1
10.8 Å60(1) 3IZZ|1|D
1659NR_all_40208.1
Exact match
Tobacco mosaic virus
3J06|1|R (3J06)
  • 5'-R(P*AP*UP*G)-3'
  • ELECTRON MICROSCOPY
  • Chain(s): R; model(s): 1
3.3 Å3(1) 3J06|1|R
1660NR_all_01159.1
Exact match
Escherichia coli
3J0D|1|F (3J0D)
  • ribosomal 23S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): F; model(s): 1
11.1 Å19(1) 3J0D|1|F
1661NR_all_69065.1
Exact match
Oryctolagus cuniculus
3J0L|1|1 (3J0L)
  • 60S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): 1; model(s): 1
9.8 Å50(1) 3J0L|1|1
1662NR_all_25280.1
Exact match
Oryctolagus cuniculus
3J0Q|1|9 (3J0Q)
  • 60S ribosomal RNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): 9; model(s): 1
10.6 Å19(1) 3J0Q|1|9
1663NR_all_33550.1
Exact match
Oryctolagus cuniculus
3J0Q|1|y (3J0Q)
  • mRNA fragment
  • ELECTRON MICROSCOPY
  • Chain(s): y; model(s): 1
10.6 Å3(1) 3J0Q|1|y
1664NR_all_09979.1
Exact match
Saccharomyces cerevisiae
3J16|1|J (3J16)
  • 28S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): J; model(s): 1
7.2 Å233(1) 3J16|1|J
1665NR_all_20398.1
Exact match
Saccharomyces cerevisiae
3J16|1|K (3J16)
  • 18S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): K; model(s): 1
7.2 Å155(1) 3J16|1|K
1666NR_all_11905.1
Exact match
Escherichia coli
3J2C|1|M (3J2C)
  • 16S rRNA head domain
  • ELECTRON MICROSCOPY
  • Chain(s): M; model(s): 1
13.2 Å462(1) 3J2C|1|M
1667NR_all_41448.1
Exact match
Escherichia coli
3J2C|1|O (3J2C)
  • 16S rRNA body domain
  • ELECTRON MICROSCOPY
  • Chain(s): O; model(s): 1
13.2 Å144(1) 3J2C|1|O
1668NR_all_18404.1
Exact match
Escherichia coli
3J45|1|3 (3J45)
  • 23S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 3; model(s): 1
9.5 Å18(1) 3J45|1|3
1669NR_all_52305.1
Exact match
Escherichia coli
3J45|1|4 (3J45)
  • 23S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 4; model(s): 1
9.5 Å61(1) 3J45|1|4
1670NR_all_38367.1
Exact match
Escherichia coli
3J46|1|3 (3J46)
  • 23S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 3; model(s): 1
10.1 Å44(1) 3J46|1|3
1671NR_all_26520.1
Exact match
Escherichia coli
3J46|1|p (3J46)
  • P-tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): p; model(s): 1
10.1 Å76(1) 3J46|1|p
1672NR_all_20384.1
Exact match
Escherichia coli
3J5S|1|A (3J5S)
  • 23S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
7.5 Å174(1) 3J5S|1|A
1673NR_all_89241.1
Exact match
Escherichia coli
3J5S|1|B (3J5S)
  • 16S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): B; model(s): 1
7.5 Å32(1) 3J5S|1|B
1674NR_all_16888.1
Exact match
Saccharomyces cerevisiae
3J6B|1|e (3J6B)
  • E-site tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): e; model(s): 1
3.2 Å20(1) 3J6B|1|e
1675NR_all_33067.1
Exact match
Plasmodium falciparum
3J7A|1|A (3J7A)
  • 18S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
3.2 Å1608(1) 3J7A|1|A
1676NR_all_73958.1
Exact match
Sus scrofa
3J7R|1|S5 (3J7R)
  • A/P tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): S5; model(s): 1
3.9 Å74(1) 3J7R|1|S5
1677NR_all_39469.1
Exact match
Sus scrofa
3J7R|1|S6 (3J7R)
  • P/E tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): S6; model(s): 1
3.9 Å76(1) 3J7R|1|S6
1678NR_all_03720.1
Exact match
Sus scrofa
3J92|1|2 (3J92)
  • tRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
3.6 Å74(1) 3J92|1|2
1679NR_all_58889.1
Exact match
3J9B|1|E (3J9B)
  • RNA (5'-R(*UP*UP*UP*UP*UP*A)-3')
  • ELECTRON MICROSCOPY
  • Chain(s): E; model(s): 1
4.3 Å5(1) 3J9B|1|E
1680NR_all_31938.1
Exact match
Homo sapiens
3J9M|1|AA (3J9M)
  • 12S rRNA
  • ELECTRON MICROSCOPY
  • Chain(s): AA; model(s): 1
3.5 Å923(1) 3J9M|1|AA
1681NR_all_52833.1
Exact match
Bacillus subtilis
3J9W|1|AX (3J9W)
  • tRNA-Asp
  • ELECTRON MICROSCOPY
  • Chain(s): AX; model(s): 1
3.9 Å77(1) 3J9W|1|AX
1682NR_all_63319.1
Exact match
Kluyveromyces lactis
3JAP|1|1 (3JAP)
  • Met-tRNAi (U31:A39 variant)
  • ELECTRON MICROSCOPY
  • Chain(s): 1; model(s): 1
4.9 Å75(1) 3JAP|1|1
1683NR_all_37313.1
Exact match
Cypovirus 1
3JB7|1|t+3JB7|1|m (3JB7)
  • RNA (5'-R(P*GP*GP*GP*GP*GP*G)-3')
  • ELECTRON MICROSCOPY
  • Chain(s): D, E, H, m, t; model(s): 1
4.0 Å6(1) 3JB7|1|t+3JB7|1|m
1684NR_all_87230.1
Exact match
Schizosaccharomyces pombe
3JB9|1|C (3JB9)
  • U5 snRNA
  • ELECTRON MICROSCOPY
  • Chain(s): C; model(s): 1
3.6 Å105(1) 3JB9|1|C
1685NR_all_76442.1
Exact match
Schizosaccharomyces pombe
3JB9|1|N+3JB9|1|P (3JB9)
  • U6 snRNA
  • ELECTRON MICROSCOPY
  • Chain(s): D, E, H, N, P; model(s): 1
3.6 Å90(1) 3JB9|1|N+3JB9|1|P
1686NR_all_09916.1
Exact match
synthetic construct
3JBU|1|X (3JBU)
  • mRNA
  • ELECTRON MICROSCOPY
  • Chain(s): X; model(s): 1
3.6 Å11(1) 3JBU|1|X
1687NR_all_97214.1
Exact match
synthetic construct
3JBV|1|W (3JBV)
  • RNA (75-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): W; model(s): 1
3.3 Å75(1) 3JBV|1|W
1688NR_all_84639.1
Exact match
Homo sapiens
3JCR|1|N (3JCR)
  • U6 snRNA
  • ELECTRON MICROSCOPY
  • Chain(s): N; model(s): 1
7.0 Å37(1) 3JCR|1|N
1689NR_all_81791.1
Exact match
Leishmania donovani
3JCS|1|2 (3JCS)
  • 26S delta ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 2; model(s): 1
2.8 Å1093(1) 3JCS|1|2
1690NR_all_40535.1
Exact match
Leishmania donovani
3JCS|1|3 (3JCS)
  • 26S gamma ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 3; model(s): 1
2.8 Å184(1) 3JCS|1|3
1691NR_all_35448.1
Exact match
Leishmania donovani
3JCS|1|5 (3JCS)
  • 26S epsilon ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 5; model(s): 1
2.8 Å80(1) 3JCS|1|5
1692NR_all_03414.1
Exact match
Leishmania donovani
3JCS|1|6 (3JCS)
  • 26S zeta ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 6; model(s): 1
2.8 Å61(1) 3JCS|1|6
1693NR_all_45853.1
Exact match
Saccharomyces cerevisiae
3JCT|1|6 (3JCT)
  • ITS2-1 miscRNA
  • ELECTRON MICROSCOPY
  • Chain(s): 6; model(s): 1
3.1 Å65(1) 3JCT|1|6
1694NR_all_63865.1
Exact match
Bos taurus
3JD5|1|A (3JD5)
  • 28S ribosomal RNA, mitochondial
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
7.0 Å952(1) 3JD5|1|A
1695NR_all_76204.1
Exact match
3K5Q|1|B (3K5Q)
  • 5'-R(P*UP*GP*UP*AP*CP*UP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å9(1) 3K5Q|1|B
1696NR_all_26816.1
Exact match
3K5Z|1|B (3K5Z)
  • 5'-R(*UP*GP*UP*AP*CP*CP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.4 Å9(1) 3K5Z|1|B
1697NR_all_14980.1
Exact match
3K61|1|B (3K61)
  • 5'-R(*UP*GP*UP*AP*AP*AP*AP*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å9(1) 3K61|1|B
1698NR_all_85762.1
Exact match
3K62|1|B (3K62)
  • 5'-R(*UP*GP*UP*GP*UP*UP*AP*UP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å9(1) 3K62|1|B
1699NR_all_52626.1
Exact match
3K64|1|B (3K64)
  • 5'-R(*UP*GP*UP*GP*UP*CP*AP*UP*U)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å9(1) 3K64|1|B
1700NR_all_35816.1
Exact match
3KMQ|1|B+3KMQ|1|C (3KMQ)
  • RNA (5'-R(P*GP*GP*GP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, H; model(s): 1
2.1 Å5(1) 3KMQ|1|B+3KMQ|1|C
1701NR_all_40545.1
Exact match
3KNC|1|B (3KNC)
  • 5'-R(*CP*GP*CP*UP*AP*CP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å8(1) 3KNC|1|B
1702NR_all_60357.1
Exact match
3KOA|1|B+3KOA|1|C (3KOA)
  • RNA (5'-R(P*AP*UP*GP*GP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, H; model(s): 1
2.4 Å6(1) 3KOA|1|B+3KOA|1|C
1703NR_all_01810.1
Exact match
3KS8|1|E+3KS8|1|F (3KS8)
  • 5'-R(*AP*GP*AP*AP*GP*GP*AP*GP*GP*GP*AP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, E, F, H; model(s): 1
2.4 Å18(1) 3KS8|1|E+3KS8|1|F
1704NR_all_63265.1
Exact match
Bacillus subtilis
3LA5|1|A (3LA5)
  • Adenosine RIboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.7 Å71(1) 3LA5|1|A
1705NR_all_35088.1
Exact match
3LOA|1|B+3LOA|1|A (3LOA)
  • 5'-R(*GP*GP*GP*(5BU)P*GP*GP*UP*GP*AP*AP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, H; model(s): 1
2.3 Å22(1) 3LOA|1|B+3LOA|1|A
1706NR_all_86182.1
Exact match
Spodoptera frugiperda
3LOB|1|R (3LOB)
  • RNA (5'-R(*UP*UP*U*AP*UP*CP*UP*(P))-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.6 Å7(1) 3LOB|1|R
1707NR_all_44340.1
Exact match
3LRR|1|C+3LRR|1|D (3LRR)
  • RNA (5'-R(*(ATP)P*UP*AP*UP*AP*UP*AP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, H; model(s): 1
2.2 Å11(1) 3LRR|1|C+3LRR|1|D
1708NR_all_80872.1
Exact match
3M3Y|1|R (3M3Y)
  • RNA (5'-R(*AP*UP*GP*GP*AP*GP*AP*GP*GP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.2 Å11(1) 3M3Y|1|R
1709NR_all_63879.1
Exact match
3M4O|1|R (3M4O)
  • RNA (5'-R(*AP*UP*GP*GP*AP*GP*AP*GP*GP*A)[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.6 Å10(1) 3M4O|1|R
1710NR_all_13395.1
Exact match
3MDG|1|C (3MDG)
  • RNA (5'-R(*UP*UP*GP*UP*AP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.2 Å6(1) 3MDG|1|C
1711NR_all_33509.1
Exact match
3MDI|1|C (3MDI)
  • RNA (5'-R(*UP*GP*UP*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.1 Å6(1) 3MDI|1|C
1712NR_all_86272.1
Exact match
3MEI|1|A+3MEI|1|B (3MEI)
  • RNA (5'-R(*CP*CP*GP*CP*CP*GP*CP*GP*CP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, H; model(s): 1
2.0 Å22(1) 3MEI|1|A+3MEI|1|B
1713NR_all_33458.1
Exact match
Homo sapiens
3MIJ|1|A (3MIJ)
  • RNA (5'-R(*UP*AP*GP*GP*GP*UP*UP*AP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.6 Å12(1) 3MIJ|1|A
1714NR_all_38078.1
Exact match
3MJ0|1|B (3MJ0)
  • RNA (5'-R(*CP*GP*UP*UP*AP*CP*GP*CP*(OMU)[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å8(1) 3MJ0|1|B
1715NR_all_88566.1
Exact match
Escherichia coli
3MOJ|1|A (3MOJ)
  • RNA (69-MER)
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
2.9 Å69(1) 3MOJ|1|A
1716NR_all_96977.1
Exact match
3MQK|1|D+3MQK|1|E (3MQK)
  • RNA (5'-R(P*GP*UP*UP*CP*GP*AP*UP*CP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): D, E, H; model(s): 1
2.8 Å13(1) 3MQK|1|D+3MQK|1|E
1717NR_all_42221.1
Exact match
3NCU|1|C+3NCU|1|D (3NCU)
  • 5'-R(*(GDP)P*AP*CP*GP*CP*UP*AP*GP*CP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): C, D, E, H; model(s): 1
2.6 Å11(1) 3NCU|1|C+3NCU|1|D
1718NR_all_29649.1
Exact match
3ND3|1|A (3ND3)
  • 5'-R(*AP*GP*AP*GP*AP*AP*GP*AP*UP*UP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.4 Å16(1) 3ND3|1|A
1719NR_all_82939.1
Exact match
3ND4|1|A (3ND4)
  • 5'-R(*AP*GP*AP*GP*AP*AP*GP*AP*UP*CP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.5 Å16(1) 3ND4|1|A
1720NR_all_55424.1
Exact match
Homo sapiens
3NKB|1|B (3NKB)
  • The hepatitis delta virus ribozyme
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å64(1) 3NKB|1|B
1721NR_all_97629.1
Exact match
3NL0|1|B+3NL0|1|C (3NL0)
  • 5'-R(P*UP*GP*GP*GP*CP*CP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, H; model(s): 1
2.6 Å7(1) 3NL0|1|B+3NL0|1|C
1722NR_all_72277.1
Exact match
3NMA|1|B+3NMA|1|C (3NMA)
  • 5'-R(*GP*GP*C)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, H; model(s): 1
2.6 Å3(1) 3NMA|1|B+3NMA|1|C
1723NR_all_69142.1
Exact match
Homo sapiens
3NMR|1|B (3NMR)
  • RNA (5'-R(*GP*UP*UP*GP*UP*UP*UP*UP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å6(1) 3NMR|1|B
1724NR_all_42633.1
Exact match
Homo sapiens
3NNA|1|B (3NNA)
  • RNA (5'-R(*GP*UP*UP*GP*UP*UP*UP*UP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.9 Å5(1) 3NNA|1|B
1725NR_all_50067.1
Exact match
Homo sapiens
3NNC|1|B (3NNC)
  • RNA (5'-R(*UP*GP*UP*GP*UP*GP*UP*UP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.2 Å7(1) 3NNC|1|B
1726NR_all_51631.1
Exact match
Homo sapiens
3NNH|1|E (3NNH)
  • RNA (5'-R(*GP*UP*UP*GP*UP*UP*UP*UP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.8 Å11(1) 3NNH|1|E
1727NR_all_49747.1
Exact match
Homo sapiens
3NNH|1|F (3NNH)
  • RNA (5'-R(*GP*UP*UP*GP*UP*UP*UP*UP*GP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.8 Å11(1) 3NNH|1|F
1728NR_all_36867.1
Exact match
Fusobacterium nucleatum
3P49|1|A (3P49)
  • GLYCINE RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.6 Å169(1) 3P49|1|A
1729NR_all_06254.1
Exact match
3P4C|1|A (3P4C)
  • 5'-R(*(CFZ)P*GP*(AF2)P*AP*(UFT)P*UP*(CFZ[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.2 Å6(1) 3P4C|1|A
1730NR_all_56893.1
Exact match
3P59|1|E+3P59|1|A+3P59|1|C+3P59|1|G+3P59|1|B+3P59|1|D+3P59|1|F+3P59|1|H (3P59)
  • RNA (5'-R(*CP*CP*GP*GP*AP*GP*GP*AP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, E, F, G, H; model(s): 1
2.2 Å14(1) 3P59|1|E+3P59|1|A+3P59|1|C+3P59|1|G+3P59|1|B+3P59|1|D+3P59|1|F+3P59|1|H
1731NR_all_15037.1
Exact match
3PF4|1|R (3PF4)
  • hexaribonucleotide (rGUCUUUA)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
1.4 Å8(1) 3PF4|1|R
1732NR_all_44457.1
Exact match
3PHP|1|A (3PHP)
  • RNA (5'-R(*GP*GP*UP*UP*CP*CP*GP*AP*GP*GP[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
23(1) 3PHP|1|A
1733NR_all_16650.1
Exact match
3PKM|1|G (3PKM)
  • 5'-R(*AP*UP*UP*AP*CP*AP*AP*UP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
3.1 Å9(1) 3PKM|1|G
1734NR_all_22156.1
Exact match
3PKM|1|R (3PKM)
  • 5'-R(P*UP*UP*AP*CP*AP*AP*UP*AP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.1 Å9(1) 3PKM|1|R
1735NR_all_16585.1
Exact match
3PO2|1|P (3PO2)
  • RNA product strand
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.3 Å15(1) 3PO2|1|P
1736NR_all_06721.1
Exact match
3PO3|1|P (3PO3)
  • RNA product strand
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.3 Å5(1) 3PO3|1|P
1737NR_all_85950.1
Exact match
3PTX|1|R (3PTX)
  • RNA (45-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.0 Å45(1) 3PTX|1|R
1738NR_all_25547.1
Exact match
3PU0|1|R (3PU0)
  • RNA (45-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.1 Å45(1) 3PU0|1|R
1739NR_all_29179.1
Exact match
3PU1|1|R (3PU1)
  • RNA (45-MER)
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.1 Å45(1) 3PU1|1|R
1740NR_all_10913.1
Exact match
3Q0L|1|C (3Q0L)
  • 5'-R(UP*GP*UP*AP*AP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.5 Å8(1) 3Q0L|1|C
1741NR_all_43560.1
Exact match
3Q0L|1|D (3Q0L)
  • 5'-R(UP*GP*UP*AP*AP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
2.5 Å8(1) 3Q0L|1|D
1742NR_all_97666.1
Exact match
3Q0Q|1|B (3Q0Q)
  • 5'-R(UP*GP*UP*AP*AP*AP*UP*A)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.0 Å8(1) 3Q0Q|1|B
1743NR_all_70557.1
Exact match
3Q1R|1|D (3Q1R)
  • TRNA 5' LEADER
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
4.2 Å5(1) 3Q1R|1|D
1744NR_all_27264.1
Exact match
3Q2T|1|E (3Q2T)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.1 Å5(1) 3Q2T|1|E
1745NR_all_03885.1
Exact match
3Q2T|1|F (3Q2T)
  • RNA
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.1 Å5(1) 3Q2T|1|F
1746NR_all_56560.1
Exact match
3QJJ|1|Q (3QJJ)
  • RNA (5'-R(*GP*UP*UP*GP*AP*AP*AP*UP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): Q; model(s): 1
2.8 Å12(1) 3QJJ|1|Q
1747NR_all_34353.1
Exact match
3QJJ|1|R (3QJJ)
  • RNA (5'-R(*GP*UP*UP*GP*AP*AP*AP*UP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.8 Å12(1) 3QJJ|1|R
1748NR_all_61711.1
Exact match
3QJP|1|R (3QJP)
  • RNA (5'-R(P*UP*AP*GP*UP*UP*UP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.3 Å8(1) 3QJP|1|R
1749NR_all_68652.1
Exact match
3QRP|1|B+3QRP|1|C (3QRP)
  • RNA (5'-R(*GP*UP*CP*CP*CP*CP*AP*CP*(PGP)[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H; model(s): 1
2.4 Å8(1) 3QRP|1|B+3QRP|1|C
1750NR_all_23218.1
Exact match
3QRR|1|B (3QRR)
  • RNA (5'-R(*GP*UP*CP*CP*CP*CP*AP*CP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.1 Å17(1) 3QRR|1|B
1751NR_all_80680.1
Exact match
3R1D|1|E (3R1D)
  • RNA (5'-R(*GP*CP*(GRB)P*GP*CP*GP*GP*CP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
1.5 Å15(1) 3R1D|1|E
1752NR_all_63209.1
Exact match
3R1E|1|A+3R1E|1|B (3R1E)
  • RNA (5'-R(*GP*CP*(GRB)P*GP*CP*GP*GP*C)-3[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
1.0 Å10(1) 3R1E|1|A+3R1E|1|B
1753NR_all_12608.1
Exact match
Aquifex aeolicus
3R2D|1|R+3R2D|1|S (3R2D)
  • 5'-R(*GP*GP*CP*UP*CP*CP*UP*UP*GP*GP*CP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, R, S; model(s): 1
2.2 Å12(1) 3R2D|1|R+3R2D|1|S
1754NR_all_14758.1
Exact match
3R4F|1|A (3R4F)
  • pRNA
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.5 Å66(1) 3R4F|1|A
1755NR_all_38781.1
Exact match
3R9W|1|B (3R9W)
  • RNA301
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.1 Å34(1) 3R9W|1|B
1756NR_all_95874.1
Exact match
3R9X|1|C (3R9X)
  • RNA301
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å35(1) 3R9X|1|C
1757NR_all_71379.1
Exact match
3RC8|1|E (3RC8)
  • RNA fragment
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.9 Å6(1) 3RC8|1|E
1758NR_all_79804.1
Exact match
3RTJ|1|D (3RTJ)
  • RNA (5'-R(*AP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å2(1) 3RTJ|1|D
1759NR_all_35883.1
Exact match
3RZO|1|R (3RZO)
  • RNA (5'-R(*GP*AP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.0 Å4(1) 3RZO|1|R
1760NR_all_84359.1
Exact match
3S14|1|R (3S14)
  • RNA (5'-R(*GP*AP*GP*AP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.9 Å6(1) 3S14|1|R
1761NR_all_78065.1
Exact match
3S15|1|R (3S15)
  • RNA (5'-R(*CP*GP*AP*GP*AP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.3 Å7(1) 3S15|1|R
1762NR_all_18318.1
Exact match
3S16|1|R (3S16)
  • RNA (5'-R(*UP*CP*GP*AP*GP*AP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.2 Å8(1) 3S16|1|R
1763NR_all_04359.1
Exact match
3S1M|1|R (3S1M)
  • RNA (5'-R(*AP*GP*AP*CP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.1 Å5(1) 3S1M|1|R
1764NR_all_96728.1
Exact match
3S1N|1|R (3S1N)
  • RNA (5'-R(*AP*GP*AP*GP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.1 Å5(1) 3S1N|1|R
1765NR_all_16634.1
Exact match
3S2D|1|R (3S2D)
  • RNA (5'-R(*AP*GP*GP*(5BU)P*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.2 Å4(1) 3S2D|1|R
1766NR_all_88937.1
Exact match
3S2H|1|R (3S2H)
  • RNA (5'-R(*AP*GP*AP*GP*GP*(2IA))-3')
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.3 Å5(1) 3S2H|1|R
1767NR_all_62516.1
Exact match
3SJ2|1|A+3SJ2|1|B (3SJ2)
  • RNA (5'-R(*UP*UP*GP*GP*GP*CP*CP*GP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
1.4 Å19(1) 3SJ2|1|A+3SJ2|1|B
1768NR_all_75875.1
Exact match
3SN2|1|B (3SN2)
  • transferrin receptor iron regulatory ele[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.0 Å29(1) 3SN2|1|B
1769NR_all_17495.1
Exact match
3SSF|1|A (3SSF)
  • 5'-R(*UP*AP*AP*AP*AP*GP*AP*AP*AP*AP*GP*G[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.6 Å21(1) 3SSF|1|A
1770NR_all_86744.1
Exact match
3SZX|1|A+3SZX|1|B (3SZX)
  • RNA (5'-R(P*UP*UP*GP*GP*GP*CP*CP*UP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.2 Å19(1) 3SZX|1|A+3SZX|1|B
1771NR_all_01981.1
Exact match
3T3O|1|B (3T3O)
  • O2'methyl-RNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å1(1) 3T3O|1|B
1772NR_all_40189.1
Exact match
Hepatitis C virus
3T4B|1|A (3T4B)
  • HCV IRES pseudoknot domain plus crystall[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.6 Å83(1) 3T4B|1|A
1773NR_all_92104.1
Exact match
Escherichia coli
3T5Q|1|C (3T5Q)
  • RNA (5'-R(P*UP*UP*AP*UP*CP*UP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
3.0 Å8(1) 3T5Q|1|C
1774NR_all_18291.1
Exact match
Escherichia coli
3T5Q|1|D (3T5Q)
  • RNA (5'-R(P*UP*AP*UP*CP*UP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å7(1) 3T5Q|1|D
1775NR_all_78848.1
Exact match
Escherichia coli
3T5Q|1|F (3T5Q)
  • RNA (5'-R(P*UP*UP*AP*UP*CP*UP*CP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
3.0 Å8(1) 3T5Q|1|F
1776NR_all_79660.1
Exact match
Escherichia coli
3T5Q|1|J (3T5Q)
  • RNA (5'-R(P*UP*UP*AP*UP*CP*UP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): J; model(s): 1
3.0 Å8(1) 3T5Q|1|J
1777NR_all_52761.1
Exact match
3TD0|1|B+3TD0|1|A (3TD0)
  • RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
1.6 Å22(1) 3TD0|1|B+3TD0|1|A
1778NR_all_21945.1
Exact match
3TS2|1|U (3TS2)
  • RNA (5'-R(*GP*GP*GP*GP*UP*CP*UP*AP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): U; model(s): 1
2.0 Å23(1) 3TS2|1|U
1779NR_all_32675.1
Exact match
3TS2|1|V (3TS2)
  • RNA (5'-R(*GP*GP*GP*GP*UP*CP*UP*AP*UP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): V; model(s): 1
2.0 Å23(1) 3TS2|1|V
1780NR_all_83775.1
Exact match
Hepatitis C virus
3TZR|1|A+3TZR|1|B (3TZR)
  • 5'-R(*CP*GP*AP*GP*GP*AP*AP*CP*UP*AP*CP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.2 Å20(1) 3TZR|1|A+3TZR|1|B
1781NR_all_78731.1
Exact match
3UZS|1|C (3UZS)
  • C13.28 RNA Aptamer
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
4.5 Å20(1) 3UZS|1|C
1782NR_all_04840.1
Exact match
3UZT|1|B (3UZT)
  • C13.18 RNA Aptamer
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.5 Å7(1) 3UZT|1|B
1783NR_all_28506.1
Exact match
Caenorhabditis elegans
3V6Y|1|B (3V6Y)
  • RNA (5'-R(*UP*AP*CP*UP*GP*UP*GP*CP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.5 Å11(1) 3V6Y|1|B
1784NR_all_97196.1
Exact match
Caenorhabditis elegans
3V71|1|B (3V71)
  • RNA (5'-R(*CP*UP*CP*UP*GP*UP*AP*UP*CP*UP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.9 Å7(1) 3V71|1|B
1785NR_all_33378.1
Exact match
Caenorhabditis elegans
3V74|1|B (3V74)
  • RNA (5'-R(*UP*CP*AP*UP*GP*UP*GP*CP*CP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å11(1) 3V74|1|B
1786NR_all_65712.1
Exact match
3VNV|1|T+3VNV|1|G (3VNV)
  • RNA (5'-R(*GP*GP*GP*UP*AP*GP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, T; model(s): 1
2.6 Å8(1) 3VNV|1|T+3VNV|1|G
1787NR_all_44691.1
Exact match
Aquifex aeolicus
3W3S|1|B (3W3S)
  • selenocysteine tRNA
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
3.1 Å98(1) 3W3S|1|B
1788NR_all_81333.1
Exact match
3WBM|1|X+3WBM|1|Y (3WBM)
  • RNA (25-MER)
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, X, Y; model(s): 1
2.0 Å25(1) 3WBM|1|X+3WBM|1|Y
1789NR_all_84179.1
Exact match
3WZI|1|C (3WZI)
  • ssRNA
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.9 Å4(1) 3WZI|1|C
1790NR_all_68262.1
Exact match
Pyrococcus furiosus
3X1L|1|I (3X1L)
  • RNA (32-MER)
  • X-RAY DIFFRACTION
  • Chain(s): I; model(s): 1
2.1 Å32(1) 3X1L|1|I
1791NR_all_06977.1
Exact match
Escherichia coli
3ZN8|1|G (3ZN8)
  • 4.5 S RNA
  • ELECTRON MICROSCOPY
  • Chain(s): G; model(s): 1
12.0 Å88(1) 3ZN8|1|G
1792NR_all_12677.1
Exact match
402D|1|A+402D|1|B (402D)
  • RNA(5'-R(*CP*GP*CP*CP*AP*GP*CP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.3 Å8(1) 402D|1|A+402D|1|B
1793NR_all_58318.1
Exact match
406D|1|A+406D|1|E (406D)
  • RNA (5'-R(*CP*AP*CP*CP*GP*GP*AP*UP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, E, F, G, H; model(s): 1
1.8 Å16(1) 406D|1|A+406D|1|E
1794NR_all_90819.1
Exact match
413D|1|A (413D)
  • RNA (5'-R(*UP*GP*AP*GP*CP*UP*UP*CP*GP*GP[...]
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
1.8 Å14(1) 413D|1|A
1795NR_all_12183.1
Exact match
421D|1|B (421D)
  • RNA (5'-R(*GP*AP*AP*GP*AP*AP*GP*AP*A)-3'[...]
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
1.8 Å9(1) 421D|1|B
1796NR_all_06457.1
Exact match
422D|1|A+422D|1|B (422D)
  • 5'-R(*GP*AP*UP*CP*AP*CP*UP*UP*CP*GP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.6 Å12(1) 422D|1|A+422D|1|B
1797NR_all_99184.1
Exact match
433D|1|A+433D|1|B (433D)
  • 5'-R(*GP*GP*UP*AP*UP*UP*GP*CP*GP*GP*UP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.1 Å14(1) 433D|1|A+433D|1|B
1798NR_all_19513.1
Exact match
438D|1|A+438D|1|B (438D)
  • RNA (5'-R(*GP*GP*GP*CP*GP*CP*UP*CP*C)-3'[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
2.5 Å9(1) 438D|1|A+438D|1|B
1799NR_all_27697.1
Exact match
439D|1|A+439D|1|B (439D)
  • RNA (5'-R(*CP*UP*GP*GP*GP*CP*GP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
1.6 Å8(1) 439D|1|A+439D|1|B
1800NR_all_02834.1
Exact match
472D|1|A+472D|1|B (472D)
  • RNA (5'-R(*GP*UP*GP*UP*UP*UP*AP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): A, B, C, D, F, G, H; model(s): 1
1.9 Å8(1) 472D|1|A+472D|1|B
1801NR_all_34537.1
Exact match
484D|2|B (484D)
  • RNA APTAMER
  • SOLUTION NMR
  • Chain(s): B; model(s): 2
27(1) 484D|2|B
1802NR_all_06099.1
Exact match
Escherichia coli
486D|1|A (486D)
  • P-SITE TRNA OF 70S RIBOSOME
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
7.5 Å64(1) 486D|1|A
1803NR_all_45112.1
Exact match
Saccharomyces cerevisiae
486D|1|C (486D)
  • A-SITE TRNA OF 70S RIBOSOME
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
7.5 Å61(1) 486D|1|C
1804NR_all_64096.1
Exact match
Thermus thermophilus
486D|1|E (486D)
  • E-SITE TRNA OF 70S RIBOSOME
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
7.5 Å64(1) 486D|1|E
1805NR_all_11210.1
Exact match
Thermus thermophilus
486D|1|F (486D)
  • PENULTIMATE STEM OF 16S RRNA IN THE 70S [...]
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
7.5 Å85(1) 486D|1|F
1806NR_all_36159.1
Exact match
Haloarcula marismortui
4A4R|1|A (4A4R)
  • 5'-R(*GMP*GP*AP*CP*CP*CP*GP*GP*CP*UP*AP*[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
21(1) 4A4R|1|A
1807NR_all_14172.1
Exact match
Thermus thermophilus
4A4S|1|A (4A4S)
  • 5'-R(*GP*GP*AP*CP*CP*CP*GP*GP*CP*UP*CP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 4A4S|1|A
1808NR_all_82922.1
Exact match
Haloarcula marismortui
4A4T|1|A (4A4T)
  • 5'-R(*GP*GP*AP*CP*CP*CP*GP*GP*CP*UP*UP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 4A4T|1|A
1809NR_all_46150.1
Exact match
Haloarcula marismortui
4A4U|1|A (4A4U)
  • 5'-R(*GP*GP*AP*CP*CP*CP*GP*GP*CP*UP*GP*A[...]
  • SOLUTION NMR
  • Chain(s): A; model(s): 1
22(1) 4A4U|1|A
1810NR_all_28840.1
Exact match
Saccharomyces cerevisiae
4A93|1|P (4A93)
  • 5'-R(*UP*UP*CP*GP*AP*CP*CP*AP*GP*GP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.4 Å9(1) 4A93|1|P
1811NR_all_27655.1
Exact match
Methanothermobacter thermautotrophicus
4ADX|1|0 (4ADX)
  • 23S ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 0; model(s): 1
6.6 Å2688(1) 4ADX|1|0
1812NR_all_96573.1
Exact match
Methanothermobacter thermautotrophicus
4ADX|1|8 (4ADX)
  • 23S Ribosomal RNA EXPANSION SEGMENTS
  • ELECTRON MICROSCOPY
  • Chain(s): 8; model(s): 1
6.6 Å133(1) 4ADX|1|8
1813NR_all_21882.1
Exact match
Methanothermobacter thermautotrophicus
4ADX|1|9 (4ADX)
  • 5S Ribosomal RNA
  • ELECTRON MICROSCOPY
  • Chain(s): 9; model(s): 1
6.6 Å121(1) 4ADX|1|9
1814NR_all_04638.1
Exact match
Caldanaerobacter subterraneus
4AOB|1|A (4AOB)
  • SAM-I RIBOSWITCH
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.0 Å94(1) 4AOB|1|A
1815NR_all_46564.1
Exact match
Bacillus thuringiensis
4ATO|1|G (4ATO)
  • TOXI
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.2 Å33(1) 4ATO|1|G
1816NR_all_43251.1
Exact match
4AY2|1|C (4AY2)
  • 5'-R-PPP(GP*GP*CP*GP*CP*GP*GP*CP*UP*UP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.8 Å19(1) 4AY2|1|C
1817NR_all_08596.1
Exact match
4B3G|1|G (4B3G)
  • RNA (5'-(AP*AP*AP*AP*AP*AP*AP*AP*AP)-3')
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.9 Å9(1) 4B3G|1|G
1818NR_all_14977.1
Exact match
4B3G|1|H (4B3G)
  • RNA (5'-(AP*AP*AP*AP*AP*AP*AP*AP*AP)-3')
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.9 Å8(1) 4B3G|1|H
1819NR_all_08464.1
Exact match
synthetic construct
4B3O|1|R (4B3O)
  • 5'-R(*AP*UP*GP*AP*3DRP*GP*GP*CP*CP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.3 Å23(1) 4B3O|1|R
1820NR_all_08767.1
Exact match
synthetic construct
4B8T|1|B (4B8T)
  • 5'-R(*AP*GP*GP*GP*UP)-3'
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
5(1) 4B8T|1|B
1821NR_all_94845.1
Exact match
Sulfolobus solfataricus
4BA2|1|R (4BA2)
  • 5'-R(*AP*AP*AP*AP)-3'
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.5 Å4(1) 4BA2|1|R
1822NR_all_06891.1
Exact match
Human respiratory syncytial virus
4BKK|1|A (4BKK)
  • RNA (161-MER)
  • ELECTRON MICROSCOPY
  • Chain(s): A; model(s): 1
161(1) 4BKK|1|A
1823NR_all_80476.1
Exact match
synthetic construct
4BOC|1|R (4BOC)
  • 5'-R(*AP*GP*UP*CP*UP*GP*CP*GP*GP*CP*GP*C[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.7 Å9(1) 4BOC|1|R
1824NR_all_28090.1
Exact match
Homo sapiens
4BS2|1|B (4BS2)
  • 5'-R(*GP*UP*GP*UP*GP*AP*AP*UP*GP*AP*AP*U[...]
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
12(1) 4BS2|1|B
1825NR_all_46866.1
Exact match
synthetic construct
4BWM|1|G (4BWM)
  • 5'-R(*AP*AP*AP*GP*GP*GP*CP*GP*CP*CP*GP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
1.8 Å14(1) 4BWM|1|G
1826NR_all_77692.1
Exact match
synthetic construct
4BXX|1|P (4BXX)
  • 5'-D(*CP*CP*CP*CP*CP*CP*CP*CP*CP*CP*CP)-[...]
  • X-RAY DIFFRACTION
  • Chain(s): P; model(s): 1
3.3 Å11(1) 4BXX|1|P
1827NR_all_64446.1
Exact match
Classical swine fever virus
4C4Q|1|N (4C4Q)
  • INTERNAL RIBOSOMAL ENTRY SITE
  • ELECTRON MICROSCOPY
  • Chain(s): N; model(s): 1
8.5 Å233(1) 4C4Q|1|N
1828NR_all_00810.1
Exact match
Escherichia coli
4C7O|1|E (4C7O)
  • SRP RNA
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.6 Å48(1) 4C7O|1|E
1829NR_all_31288.1
Exact match
4C8Y|1|C (4C8Y)
  • R1 REPEAT RNA SUBSTRATE MIMIC
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.8 Å13(1) 4C8Y|1|C
1830NR_all_91365.1
Exact match
Thermus thermophilus
4C8Z|1|C (4C8Z)
  • R1 REPEAT RNA CLEAVAGE PRODUCT
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
2.5 Å14(1) 4C8Z|1|C
1831NR_all_27775.1
Exact match
Caenorhabditis elegans
4CIO|1|B (4CIO)
  • 5'-R(*GP*GP*UP*GP*UP*GP*CP)-3'
  • SOLUTION NMR
  • Chain(s): B; model(s): 1
7(1) 4CIO|1|B
1832NR_all_92078.1
Exact match
Escherichia coli
4CXH|1|x (4CXH)
  • MESSENGER RNA
  • ELECTRON MICROSCOPY
  • Chain(s): x; model(s): 1
8.9 Å28(1) 4CXH|1|x
1833NR_all_07497.1
Exact match
Thermus thermophilus
4DR6|1|W+4DR6|1|V (4DR6)
  • 5'-R(P*UP*UP*GP*AP*GP*GP*(PSU)P*GP*G)-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, F, G, H, V, W; model(s): 1
3.3 Å8(1) 4DR6|1|W+4DR6|1|V
1834NR_all_76824.1
Exact match
Thermus thermophilus
4DR7|1|W (4DR7)
  • 5'-R(*GP*CP*CP*UP*GP*GP*AP*AP*AP*GP*(PSU[...]
  • X-RAY DIFFRACTION
  • Chain(s): W; model(s): 1
3.8 Å10(1) 4DR7|1|W
1835NR_all_22605.1
Exact match
4DWA|1|D (4DWA)
  • RNA (5'-R(*CP*UP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): D; model(s): 1
3.0 Å3(1) 4DWA|1|D
1836NR_all_13174.1
Exact match
4E58|1|D+4E58|1|C+4E58|1|E (4E58)
  • RNA duplex containing CCG repeats
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
2.0 Å7(1) 4E58|1|D+4E58|1|C+4E58|1|E
1837NR_all_55926.1
Exact match
4E59|1|A+4E59|1|B (4E59)
  • RNA duplex containing CCG repeats
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
1.5 Å8(1) 4E59|1|A+4E59|1|B
1838NR_all_70790.1
Exact match
4E5C|1|A+4E5C|1|B (4E5C)
  • 5'-R(P*GP*GP*CP*GP*GP*CP*GP*GP*CP*GP*GP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
1.7 Å19(1) 4E5C|1|A+4E5C|1|B
1839NR_all_53426.1
Exact match
4E6B|1|A+4E6B|1|B (4E6B)
  • 5'-R(P*CP*GP*GP*CP*GP*GP*CP*GP*GP*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): A, B, D, E, F, G, H; model(s): 1
1.5 Å4(1) 4E6B|1|A+4E6B|1|B
1840NR_all_33685.1
Exact match
4E6B|1|E+4E6B|1|F (4E6B)
  • 5'-R(P*CP*GP*GP*CP*GP*GP*CP*GP*GP*CP*CP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H; model(s): 1
1.5 Å4(1) 4E6B|1|E+4E6B|1|F
1841NR_all_52691.1
Exact match
4E78|1|P+4E78|1|T (4E78)
  • 5'-R(*U*AP*CP*CP*GP*(GDO))-3'
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H, P, T; model(s): 1
2.9 Å4(1) 4E78|1|P+4E78|1|T
1842NR_all_25893.1
Exact match
Tetrahymena thermophila
4ERD|1|C+4ERD|1|D (4ERD)
  • 5'-R(P*GP*GP*UP*CP*GP*AP*CP*AP*UP*CP*UP*[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
2.6 Å22(1) 4ERD|1|C+4ERD|1|D
1843NR_all_88847.1
Exact match
Homo sapiens
4F3T|1|R (4F3T)
  • RNA (5'-R(P*UP*AP*AP*AP*GP*UP*GP*CP*UP*U[...]
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.3 Å14(1) 4F3T|1|R
1844NR_all_39301.1
Exact match
Spodoptera frugiperda
4FSJ|1|R (4FSJ)
  • Random cellular RNA fragments
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.5 Å14(1) 4FSJ|1|R
1845NR_all_62747.1
Exact match
Flock house virus
4FTB|1|R (4FTB)
  • Flock House virus genomic RNA
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
2.7 Å15(1) 4FTB|1|R
1846NR_all_05128.1
Exact match
synthetic construct
4FVU|1|B+4FVU|1|C (4FVU)
  • RNA (5'-R(*GP*GP*AP*GP*GP*GP*AP*G)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
2.9 Å8(1) 4FVU|1|B+4FVU|1|C
1847NR_all_74729.1
Exact match
synthetic construct
4G0A|1|E (4G0A)
  • RNA (5'-R(P*GP*GP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
2.1 Å3(1) 4G0A|1|E
1848NR_all_24630.1
Exact match
synthetic construct
4G0A|1|F (4G0A)
  • RNA (5'-R(P*GP*GP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): F; model(s): 1
2.1 Å3(1) 4G0A|1|F
1849NR_all_32785.1
Exact match
synthetic construct
4G0A|1|G (4G0A)
  • RNA (5'-R(P*GP*GP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): G; model(s): 1
2.1 Å3(1) 4G0A|1|G
1850NR_all_47227.1
Exact match
synthetic construct
4G0A|1|H (4G0A)
  • RNA (5'-R(P*GP*GP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.1 Å3(1) 4G0A|1|H
1851NR_all_02089.1
Exact match
4G9Z|1|E+4G9Z|1|F (4G9Z)
  • RNA (5'-R(P*GP*CP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H; model(s): 1
2.0 Å4(1) 4G9Z|1|E+4G9Z|1|F
1852NR_all_06970.1
Exact match
4GG4|1|H (4GG4)
  • RNA (5'-R(*AP*GP*AP*GP*AP*GP*AP*UP*AP*AP[...]
  • X-RAY DIFFRACTION
  • Chain(s): H; model(s): 1
2.5 Å16(1) 4GG4|1|H
1853NR_all_79459.1
Exact match
synthetic construct
4GKJ|1|X+4GKJ|1|W (4GKJ)
  • tRNA ASL human mitochondrial Met
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H, W, X; model(s): 1
3.3 Å8(1) 4GKJ|1|X+4GKJ|1|W
1854NR_all_73684.1
Exact match
synthetic construct
4GKK|1|X+4GKK|1|W (4GKK)
  • tRNA ASL human mitochondrial Met
  • X-RAY DIFFRACTION
  • Chain(s): B, D, E, F, G, H, W, X; model(s): 1
3.2 Å5(1) 4GKK|1|X+4GKK|1|W
1855NR_all_26802.1
Exact match
marine metagenome
4GMA|1|Z (4GMA)
  • Adenosylcobalamin riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): Z; model(s): 1
3.9 Å192(1) 4GMA|1|Z
1856NR_all_36514.1
Exact match
4GXY|1|A (4GXY)
  • Adenosylcobalamin riboswitch
  • X-RAY DIFFRACTION
  • Chain(s): A; model(s): 1
3.1 Å161(1) 4GXY|1|A
1857NR_all_77339.1
Exact match
synthetic construct
4GZY|1|R (4GZY)
  • RNA transcript
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
3.5 Å9(1) 4GZY|1|R
1858NR_all_76241.1
Exact match
synthetic construct
4GZZ|1|R (4GZZ)
  • RNA transcript
  • X-RAY DIFFRACTION
  • Chain(s): R; model(s): 1
4.3 Å9(1) 4GZZ|1|R
1859NR_all_51034.1
Exact match
4HKQ|1|E (4HKQ)
  • RNA (5'-R(*AP*AP*CP*AP*GP*AP*GP*UP*GP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.0 Å16(1) 4HKQ|1|E
1860NR_all_03341.1
Exact match
4HOR|1|X (4HOR)
  • RNA (5'-R(*(CTP)P*CP*CP*CP*C)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
1.9 Å5(1) 4HOR|1|X
1861NR_all_65232.1
Exact match
4HOS|1|X (4HOS)
  • RNA (5'-R(*(UTP)P*UP*UP*U)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.0 Å3(1) 4HOS|1|X
1862NR_all_43542.1
Exact match
4HOT|1|X (4HOT)
  • RNA (5'-R(*(ATP)P*AP*AP*A)-3')
  • X-RAY DIFFRACTION
  • Chain(s): X; model(s): 1
2.5 Å3(1) 4HOT|1|X
1863NR_all_12137.1
Exact match
4I67|1|B (4I67)
  • 5'-R(P*GP*GP*GP*(RPC))-3'
  • X-RAY DIFFRACTION
  • Chain(s): B; model(s): 1
2.3 Å3(1) 4I67|1|B
1864NR_all_30288.1
Exact match
4IG8|1|B+4IG8|1|C (4IG8)
  • RNA (5'-R(*GP*GP*CP*UP*UP*UP*UP*GP*AP*CP[...]
  • X-RAY DIFFRACTION
  • Chain(s): B, C, D, E, F, G, H; model(s): 1
2.7 Å18(1) 4IG8|1|B+4IG8|1|C
1865NR_all_30547.1
Exact match
4II9|1|C (4II9)
  • RNA (5'-R(P*CP*CP*(A9Z))-3')
  • X-RAY DIFFRACTION
  • Chain(s): C; model(s): 1
1.7 Å2(1) 4II9|1|C
1866NR_all_80150.1
Exact match
4IJS|1|E (4IJS)
  • RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*AP*AP*A[...]
  • X-RAY DIFFRACTION
  • Chain(s): E; model(s): 1
3.2 Å10(1) 4IJS|1|E
1867NR_all_16745.1