Motif HL_60293.1 Version HL_60293.1 of this group appears in releases 3.77 to 3.96
| #S | Loop id | PDB | Disc | #Non-core | Annotation | Chain(s) | Standardized name | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 1-15 | 2-13 | 3-5 | 3-11 | 4-6 | 4-12 | 5-9 | 6-10 | 8-13 | 9-11 | 10-12 | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | HL_5DE8_001 | 5DE8 | 0.0000 | 7 | G-quadruplex | A | sc1 | U | 8 | G | 9 | G | 11 | G | 12 | G | 15 | G | 16 | A | 17 | G | 18 | G | 20 | G | 21 | G | 24 | G | 25 | G | 26 | U | 28 | G | 29 | cWW | cWH | cWH | cHW | cWH | cHW | cWH | cWH | cHW | cWH | cWH |
| 2 | HL_5DEA_002 | 5DEA | 0.4443 | 7 | G-quadruplex | C | sc1 | U | 8 | G | 9 | G | 11 | G | 12 | G | 15 | G | 16 | A | 17 | G | 18 | G | 20 | G | 21 | G | 24 | G | 25 | G | 26 | U | 28 | G | 29 | cWW | cWH | cWH | cHW | cWH | cHW | cWH | cWH | cHW | cWH | cWH |
3D structures
Complete motif including flanking bases
| Sequence | Counts |
|---|---|
| UGUGGAAGGAGUGGCUGGGUUG | 2 |
Non-Watson-Crick part of the motif
| Sequence | Counts |
|---|---|
| GUGGAAGGAGUGGCUGGGUU | 2 |
Release history
| Release | 3.77 | 3.78 | 3.79 | 3.80 | 3.81 | 3.82 | 3.83 | 3.84 | 3.85 | 3.86 | 3.87 | 3.88 | 3.89 | 3.90 | 3.91 | 3.92 | 3.93 | 3.94 | 3.95 | 3.96 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Date | 2023-12-06 | 2024-01-03 | 2024-01-03 | 2024-01-31 | 2024-02-28 | 2024-03-27 | 2024-04-24 | 2024-05-22 | 2024-06-19 | 2024-07-17 | 2024-08-14 | 2024-09-11 | 2024-10-09 | 2024-11-06 | 2024-12-04 | 2025-01-01 | 2025-01-29 | 2025-02-26 | 2025-03-26 | 2025-04-23 |
| Status | New id, 2 parents | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match |
Parent motifs
This motif has no parent motifs.
Children motifs
This motif has no children motifs.- Annotations
-
- G-quadruplex (2)
- Basepair signature
- cWW-cWH-F-cWH-cHW-cHW-cWH-cHW-cWH-F-cWH-cWH-cWH-F
- Heat map statistics
- Min 0.44 | Avg 0.22 | Max 0.44
Coloring options: