Motif HL_21400.1 Version HL_21400.1 of this group appears in releases 3.88 to 4.1
#S | Loop id | PDB | Disc | #Non-core | Annotation | Chain(s) | Standardized name for chain | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 1-18 | 2-9 | 2-15 | 3-6 | 3-16 | 4-7 | 4-13 | 5-8 | 5-14 | 6-10 | 7-11 | 8-12 | 9-17 | 10-16 | 11-13 | 12-14 | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | HL_8EYU_003 | 8EYU | 0.0000 | 5 | G-quadruplex | A | RNA (49-MER) | A | 16 | G | 17 | G | 18 | G | 20 | G | 21 | G | 22 | G | 24 | G | 25 | U | 26 | G | 27 | G | 29 | G | 30 | G | 32 | G | 33 | A | 34 | G | 35 | A | 37 | U | 38 | cWW | tWH | tSW | cWH | cHW | cWH | cHW | cWH | cHW | cWH | cWH | cWH | cWW | cWH | cWH | cWH |
3D structures
Complete motif including flanking bases
Sequence | Counts |
---|---|
AGGUGGGUGGUGUGGAGGAGUAU | 1 |
Non-Watson-Crick part of the motif
Sequence | Counts |
---|---|
GGUGGGUGGUGUGGAGGAGUA | 1 |
Release history
Release | 3.88 | 3.89 | 3.90 | 3.91 | 3.92 | 3.93 | 3.94 | 3.95 | 3.96 | 3.97 | 3.98 | 3.99 | 4.0 | 4.1 |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Date | 2024-09-11 | 2024-10-09 | 2024-11-06 | 2024-12-04 | 2025-01-01 | 2025-01-29 | 2025-02-26 | 2025-03-26 | 2025-04-23 | 2025-05-21 | 2025-06-18 | 2025-07-16 | 2025-08-13 | 2025-09-10 |
Status | New id, no parents | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match |
Parent motifs
This motif has no parent motifs.
Children motifs
This motif has no children motifs.- Annotations
-
- G-quadruplex (1)
- Basepair signature
- cWW-tWH-tSW-cWW-cWH-cHW-cWH-cWH-cHW-cWH-cHW-cWH-cWH-cWH-cWH-cWH
- Heat map statistics
- Min 0.00 | Avg 0.00 | Max 0.00
Coloring options: