Motif HL_35354.1 Version HL_35354.1 of this group appears in releases 3.82 to 4.7
| #S | Loop id | PDB | Disc | #Non-core | Chain(s) | Standardized name for chain | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 1-21 | 2-5 | 2-15 | 3-6 | 3-13 | 4-21 | 5-8 | 6-9 | 7-12 | 8-15 | 9-13 | 10-17 | 11-18 | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | HL_6E8S_001 | 6E8S | 0.0000 | 3 | A | iMango-III aptamer | A | 8 | G | 9 | G | 10 | A | 12 | G | 13 | G | 14 | A | 15 | G | 18 | G | 19 | U | 20 | A | 21 | U | 22 | G | 23 | U | 24 | G | 25 | G | 26 | U | 27 | A | 28 | U | 29 | A | 30 | U | 31 | cWW | cWH | cHW | cWH | cHW | ncWS | cWH | cWH | tWW | cWH | cWH | tWWa | tHH |
3D structures
Complete motif including flanking bases
| Sequence | Counts |
|---|---|
| AGGAAGGAUUGGUAUGUGGUAUAU | 1 |
Non-Watson-Crick part of the motif
| Sequence | Counts |
|---|---|
| GGAAGGAUUGGUAUGUGGUAUA | 1 |
Release history
| Release | 3.82 | 3.83 | 3.84 | 3.85 | 3.86 | 3.87 | 3.88 | 3.89 | 3.90 | 3.91 | 3.92 | 3.93 | 3.94 | 3.95 | 3.96 | 3.97 | 3.98 | 3.99 | 4.0 | 4.1 | 4.2 | 4.3 | 4.4 | 4.5 | 4.6 | 4.7 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Date | 2024-03-27 | 2024-04-24 | 2024-05-22 | 2024-06-19 | 2024-07-17 | 2024-08-14 | 2024-09-11 | 2024-10-09 | 2024-11-06 | 2024-12-04 | 2025-01-01 | 2025-01-29 | 2025-02-26 | 2025-03-26 | 2025-04-23 | 2025-05-21 | 2025-06-18 | 2025-07-16 | 2025-08-13 | 2025-09-10 | 2025-10-08 | 2025-11-05 | 2025-12-03 | 2025-12-31 | 2026-01-28 | 2026-02-25 |
| Status | New id, 1 parent | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match | Exact match |
Parent motifs
This motif has no parent motifs.
Children motifs
This motif has no children motifs.- Annotations
-
- (1)
- Basepair signature
- cWW-cWH-cHW-F-cWH-cHW-F-F-tHH-cWH-tWW-cWH-F-tWW-cWH-F-cWH
- Heat map statistics
- Min 0.00 | Avg 0.00 | Max 0.00
Coloring options: