JAR3D
Query RF02686-CCF-3.98 completed
Run on Motif Atlas Version 3.98
using the CaCoFold secondary structure. Run with the Rfam secondary structure.
RF02686 RAGATH-6 RNA
Input Summary
00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000011111111111111111111111111111111111111111111111111111
00000000011111111112222222222333333333344444444445555555555666666666677777777778888888888999999999900000000001111111111222222222233333333334444444444555
12345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012
((((((((.....))))))))...(((((...(((((..............)))))...))))).............(((((((((((((((....(((.....)))........(((((......)))))...)))))))))))))))...
>BABB01003568.1_701-850
AUCUGUUUAGCCAUAGCAA-UAUCGU-UGAAAUGCAAAUCAUCUACUUAUGUCGUGAGACAUUAUUUAACCACGUUAAAGUAUAAUAAUAUAAGUUAGGUAUGCCCUUAUAAAGACUUAGGUAACGCUAAGGACUAUAUUAUUAUACUUCUU
>BAAZ01000382.1_2451-2601
AAUUCAUUCGC-AAAGUAAUUAUUCUAUGAAAUGCAAAUUAUCUUCAUAUGUUGUGAAACAUAGCUUAACCACGUUAAAGUAUAAUAAUAUAAGUUAGGUAUGCCCUUAUAAAGACUUAGGUAGCGCUAAGGACUAUAUUAUUAUACUUCUU
There are no chains in PDB that we map to Rfam family RF02686.
Jump to results for:
Loop 1 Hairpin loop
Column numbers: 8-14
Scored sequences and counts
UAGCCAU 1
UCGC-AA 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_93535.1
Basepair signature:
|
100.00 | 15.76 | 3 | 1.5 |
|
| 2 |
Motif group HL_13963.3
Basepair signature:
|
50.00 | -0.13 | 4 | 2 |
|
| 3 |
Motif group HL_70782.2
Basepair signature:
|
50.00 | -9.56 | 4 | 2 |
|
| 4 |
Motif group HL_56131.2
Basepair signature:
|
50.00 | -10.44 | 3 | 2.5 |
|
| 5 |
Motif group HL_86769.4
Basepair signature:
|
50.00 | -34.49 | 4.5 | 2.5 |
|
| 6 |
Motif group HL_13189.1
Basepair signature:
|
50.00 | -37.75 | 3 | 2.5 |
|
| 7 |
Motif group HL_22135.1
Basepair signature:
|
50.00 | -39.03 | 2 | 1.5 |
|
| 8 |
Motif group HL_04783.2
Basepair signature:
|
50.00 | -40.63 | 3.5 | 2.5 |
|
| 9 |
Motif group HL_49922.4
Basepair signature:
|
50.00 | -45.70 | 2.5 | 2 |
|
| 10 |
Motif group HL_99040.1
Basepair signature:
|
50.00 | -45.89 | 3.5 | 2.5 |
|
Loop 2 Internal loop
Column numbers: 29-33, 56-60
Scored sequences and counts
GAAAU*GAAAC 1
GAAAU*GAGAC 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_63519.1
Basepair signature:
|
100.00 | 0.64 | 4 | 3 |
|
| 2 |
Motif group IL_17948.2
Basepair signature:
|
50.00 | 6.06 | 2.5 | 1.5 |
Double sheared with non-canonical cWW |
| 3 |
Motif group IL_61440.1
Basepair signature:
|
50.00 | 3.08 | 6.5 | 2.5 |
Triple sheared |
| 4 |
Motif group IL_21667.1
Basepair signature:
|
50.00 | 1.99 | 5.5 | 2.5 |
|
| 5 |
Motif group IL_01038.1
Basepair signature:
|
50.00 | -7.00 | 3.5 | 2.5 |
UAA/GAN with extra stack |
| 6 |
Motif group IL_62654.1
Basepair signature:
|
50.00 | -11.42 | 5 | 3.5 |
tSH-tHH-tHS |
| 7 |
Motif group IL_66798.2
Basepair signature:
|
50.00 | -25.15 | 5.5 | 2.5 |
AAA cross-strand stack |
Loop 3 Hairpin loop
Column numbers: 37-52
Scored sequences and counts
AAUCAUCUACUUAUGU 1
AAUUAUCUUCAUAUGU 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_88364.2
Basepair signature:
|
50.00 | -17.61 | 6.5 | 4.5 |
|
Loop 4 3-way junction loop
Column numbers: 92-97, 107-116, 131-135
Scored sequences and counts
AAGUUA*UUAUAAAGAC*GGACU 2
No Matches Found
View All Results for this LoopLoop 5 Hairpin loop
Column numbers: 99-105
Scored sequences and counts
GUAUGCC 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_04783.2
Basepair signature:
|
100.00 | 23.71 | 3 | 1 |
|
| 2 |
Motif group HL_67667.2
Basepair signature:
|
100.00 | 5.88 | 4 | 2 |
|
| 3 |
Motif group HL_50006.2
Basepair signature:
|
100.00 | 2.52 | 4 | 3 |
|
| 4 |
Motif group HL_87954.2
Basepair signature:
|
100.00 | 2.27 | 3 | 2 |
|
| 5 |
Motif group HL_30068.2
Basepair signature:
|
100.00 | 1.64 | 4 | 2 |
|
Loop 6 Hairpin loop
Column numbers: 120-127
Scored sequences and counts
GGUAACGC 1
GGUAGCGC 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_81538.2
Basepair signature:
|
100.00 | 58.01 | 1 | 1 |
GNRA with tandem sheared |
| 2 |
Motif group HL_84299.4
Basepair signature:
|
100.00 | 51.61 | 1.5 | 1.5 |
|
| 3 |
Motif group HL_93324.4
Basepair signature:
|
100.00 | 42.70 | 2.5 | 1.5 |
Pseudoknot geometry |
| 4 |
Motif group HL_25061.1
Basepair signature:
|
50.00 | 10.67 | 4.5 | 2.5 |
|
| 5 |
Motif group HL_77436.5
Basepair signature:
|
50.00 | 9.19 | 1.5 | 1.5 |
T-loop related |
| 6 |
Motif group HL_78197.1
Basepair signature:
|
50.00 | 6.19 | 2.5 | 2.5 |
|
| 7 |
Motif group HL_20167.2
Basepair signature:
|
50.00 | -1.31 | 2 | 2 |
|
| 8 |
Motif group HL_77600.2
Basepair signature:
|
50.00 | -9.78 | 2.5 | 1.5 |
|
| 9 |
Motif group HL_50318.1
Basepair signature:
|
50.00 | -11.88 | 4.5 | 3.5 |
|