RF02686 RAGATH-6 RNA

Input Summary

      00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000011111111111111111111111111111111111111111111111111111
00000000011111111112222222222333333333344444444445555555555666666666677777777778888888888999999999900000000001111111111222222222233333333334444444444555
12345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012
.........((.(.....(........)....))).............(((((....)))))...............(((((((((((((((.((((((.....)))........(((((......)))))))))))))))))))))))...
>BABB01003568.1/701-850
AUCUGUUUAGCCAUAGCAA-UAUCGU-UGAAAUGCAAAUCAUCUACUUAUGUCGUGAGACAUUAUUUAACCACGUUAAAGUAUAAUAAUAUAAGUUAGGUAUGCCCUUAUAAAGACUUAGGUAACGCUAAGGACUAUAUUAUUAUACUUCUU
>BAAZ01000382.1/2451-2601
AAUUCAUUCGC-AAAGUAAUUAUUCUAUGAAAUGCAAAUUAUCUUCAUAUGUUGUGAAACAUAGCUUAACCACGUUAAAGUAUAAUAAUAUAAGUUAGGUAUGCCCUUAUAAAGACUUAGGUAGCGCUAAGGACUAUAUUAUUAUACUUCUU

There are no chains in PDB that we map to Rfam family RF02686.

Jump to results for:

  • Loop 1IL Column numbers: 11-13, 33-34
  • Loop 2IL Column numbers: 13-19, 28-33
  • Loop 3HL Column numbers: 19-28
  • Loop 4HL Column numbers: 53-58
  • Loop 5IL Column numbers: 92-94, 134-135
  • Loop 6J3 Column numbers: 96-97, 107-116, 131-132
  • Loop 7HL Column numbers: 99-105
  • Loop 8HL Column numbers: 120-127

Loop 1 Internal loop

Column numbers: 11-13, 33-34
    Scored sequences and counts
CCA*UG 1
C-A*UG 1
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 52.39 2.5 0.5

Single stack bend

2 100.00 47.43 0.5 0.5

Single bulged C

3 100.00 43.60 1 0.5

Single stack bend

4 100.00 39.79 2 0.5

Major groove platform

5 100.00 39.35 3 1

Intercalated cWS

6 100.00 37.74 3 1

7 100.00 37.33 1 1

Multiple bulged bases

8 100.00 28.31 3 1

9 100.00 26.44 3 1

Major groove intercalation

10 100.00 22.98 2.5 1

Loop 2 Internal loop

Column numbers: 13-19, 28-33
    Scored sequences and counts
AAAGUAA*UGAAAU 1
AUAGCAA*UGAAAU 1
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 62.68 3 1

7x6 Sarcin-Ricin; G-bulge

2 100.00 27.30 6 2.5

8x6 Sarcin-Ricin with inserted A; G-bulge

3 100.00 26.17 6 2

7x6 Sarcin-Ricin with UU cWW pair; G-bulge

4 100.00 25.86 6.5 2.5

tSH-tSH-tHH-tHS

5 100.00 7.52 6 3.5

Kink-turn

6 50.00 3.14 5.5 2.5

8x6 Sarcin-Ricin with inserted Y; G-bulge

7 50.00 -7.34 2.5 2.5

8x7 Sarcin-Ricin; G-bulge

8 50.00 -9.26 5.5 3

Sarcin-Ricin target in LSU H95; G-bulge

9 50.00 -12.27 5.5 3.5

10 50.00 -15.79 5 3.5

7x7 Sarcin-Ricin with intercalated A; G-bulge

Loop 3 Hairpin loop

Column numbers: 19-28
    Scored sequences and counts
AUUAUUCUAU 1
A-UAUCGU-U 1
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 50.00 1.06 3 2

2 50.00 -1.81 3.5 2

3 50.00 -14.58 4 4

4 50.00 -18.12 5.5 3.5

5 50.00 -22.36 5 3

6 50.00 -24.80 6 4

Pseudoknot

7 50.00 -24.92 3.5 1.5

T-loop with unstacked turn

8 50.00 -43.74 5 4

Pseudoknot

9 50.00 -48.37 5 3

10 50.00 -103.61 5 3

Loop 4 Hairpin loop

Column numbers: 53-58
    Scored sequences and counts
CGUGAG 1
UGUGAA 1
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 89.10 1 0

2 100.00 66.20 3 1

3 100.00 59.84 0 0

GNRA

4 100.00 58.84 1.5 1

5 100.00 51.48 2 1

6 100.00 48.79 2 1

7 100.00 45.93 2 1

8 100.00 44.40 1 0

UNCG

9 100.00 43.71 1.5 1

10 100.00 39.30 2.5 1

Loop 5 Internal loop

Column numbers: 92-94, 134-135
    Scored sequences and counts
AAG*CU 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 99.99 2 0

2 100.00 99.95 0 0

Single stack bend

3 100.00 97.40 2 0

Multiple bulged bases

4 100.00 96.04 0 0

Single stack bend

5 100.00 91.71 0 0

Single bulged A

6 100.00 89.14 1 0

Major groove intercalation

7 100.00 86.40 4 0

8 100.00 84.50 0 0

Stack and bulge

9 100.00 77.56 2 0

Major groove platform

10 100.00 75.31 3 0

Major groove platform

Loop 6 3-way junction loop

Column numbers: 96-97, 107-116, 131-132
    Scored sequences and counts
UA*UUAUAAAGAC*GG 2
No Matches Found View All Results for this Loop

Loop 7 Hairpin loop

Column numbers: 99-105
    Scored sequences and counts
GUAUGCC 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 23.71 3 1

2 100.00 5.88 4 2

3 100.00 2.52 4 3

4 100.00 2.27 3 2

5 100.00 1.64 4 2

Loop 8 Hairpin loop

Column numbers: 120-127
    Scored sequences and counts
GGUAACGC 1
GGUAGCGC 1
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 58.01 1 1

GNRA with tandem sheared

2 100.00 51.61 1.5 1.5

3 100.00 42.70 2.5 1.5

Pseudoknot geometry

4 50.00 10.67 4.5 2.5

5 50.00 9.19 1.5 1.5

T-loop related

6 50.00 6.19 2.5 2.5

7 50.00 -1.31 2 2

8 50.00 -9.78 2.5 1.5

9 50.00 -11.88 4.5 3.5

Coloring options: