JAR3D
Query RF02686-3.98 completed
Run on Motif Atlas Version 3.98
using the Rfam secondary structure. Run with the CaCoFold secondary structure.
RF02686 RAGATH-6 RNA
Input Summary
00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000011111111111111111111111111111111111111111111111111111
00000000011111111112222222222333333333344444444445555555555666666666677777777778888888888999999999900000000001111111111222222222233333333334444444444555
12345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012
.........((.(.....(........)....))).............(((((....)))))...............(((((((((((((((.((((((.....)))........(((((......)))))))))))))))))))))))...
>BABB01003568.1/701-850
AUCUGUUUAGCCAUAGCAA-UAUCGU-UGAAAUGCAAAUCAUCUACUUAUGUCGUGAGACAUUAUUUAACCACGUUAAAGUAUAAUAAUAUAAGUUAGGUAUGCCCUUAUAAAGACUUAGGUAACGCUAAGGACUAUAUUAUUAUACUUCUU
>BAAZ01000382.1/2451-2601
AAUUCAUUCGC-AAAGUAAUUAUUCUAUGAAAUGCAAAUUAUCUUCAUAUGUUGUGAAACAUAGCUUAACCACGUUAAAGUAUAAUAAUAUAAGUUAGGUAUGCCCUUAUAAAGACUUAGGUAGCGCUAAGGACUAUAUUAUUAUACUUCUU
There are no chains in PDB that we map to Rfam family RF02686.
Jump to results for:
Loop 1 Internal loop
Column numbers: 11-13, 33-34
Scored sequences and counts
CCA*UG 1
C-A*UG 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_26793.1
Basepair signature:
|
100.00 | 52.39 | 2.5 | 0.5 |
Single stack bend |
| 2 |
Motif group IL_61258.15
Basepair signature:
|
100.00 | 47.43 | 0.5 | 0.5 |
Single bulged C |
| 3 |
Motif group IL_90729.1
Basepair signature:
|
100.00 | 43.60 | 1 | 0.5 |
Single stack bend |
| 4 |
Motif group IL_07039.3
Basepair signature:
|
100.00 | 39.79 | 2 | 0.5 |
Major groove platform |
| 5 |
Motif group IL_81831.1
Basepair signature:
|
100.00 | 39.35 | 3 | 1 |
Intercalated cWS |
| 6 |
Motif group IL_73452.2
Basepair signature:
|
100.00 | 37.74 | 3 | 1 |
|
| 7 |
Motif group IL_42771.1
Basepair signature:
|
100.00 | 37.33 | 1 | 1 |
Multiple bulged bases |
| 8 |
Motif group IL_16386.4
Basepair signature:
|
100.00 | 28.31 | 3 | 1 |
|
| 9 |
Motif group IL_66635.5
Basepair signature:
|
100.00 | 26.44 | 3 | 1 |
Major groove intercalation |
| 10 |
Motif group IL_33761.2
Basepair signature:
|
100.00 | 22.98 | 2.5 | 1 |
|
Loop 2 Internal loop
Column numbers: 13-19, 28-33
Scored sequences and counts
AAAGUAA*UGAAAU 1
AUAGCAA*UGAAAU 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_26307.2
Basepair signature:
|
100.00 | 62.68 | 3 | 1 |
7x6 Sarcin-Ricin; G-bulge |
| 2 |
Motif group IL_61286.1
Basepair signature:
|
100.00 | 27.30 | 6 | 2.5 |
8x6 Sarcin-Ricin with inserted A; G-bulge |
| 3 |
Motif group IL_24254.1
Basepair signature:
|
100.00 | 26.17 | 6 | 2 |
7x6 Sarcin-Ricin with UU cWW pair; G-bulge |
| 4 |
Motif group IL_47346.2
Basepair signature:
|
100.00 | 25.86 | 6.5 | 2.5 |
tSH-tSH-tHH-tHS |
| 5 |
Motif group IL_32016.1
Basepair signature:
|
100.00 | 7.52 | 6 | 3.5 |
Kink-turn |
| 6 |
Motif group IL_41756.4
Basepair signature:
|
50.00 | 3.14 | 5.5 | 2.5 |
8x6 Sarcin-Ricin with inserted Y; G-bulge |
| 7 |
Motif group IL_04346.10
Basepair signature:
|
50.00 | -7.34 | 2.5 | 2.5 |
8x7 Sarcin-Ricin; G-bulge |
| 8 |
Motif group IL_16458.4
Basepair signature:
|
50.00 | -9.26 | 5.5 | 3 |
Sarcin-Ricin target in LSU H95; G-bulge |
| 9 |
Motif group IL_88116.2
Basepair signature:
|
50.00 | -12.27 | 5.5 | 3.5 |
|
| 10 |
Motif group IL_29198.2
Basepair signature:
|
50.00 | -15.79 | 5 | 3.5 |
7x7 Sarcin-Ricin with intercalated A; G-bulge |
Loop 3 Hairpin loop
Column numbers: 19-28
Scored sequences and counts
AUUAUUCUAU 1
A-UAUCGU-U 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_28075.1
Basepair signature:
|
50.00 | 1.06 | 3 | 2 |
|
| 2 |
Motif group HL_78197.1
Basepair signature:
|
50.00 | -1.81 | 3.5 | 2 |
|
| 3 |
Motif group HL_98252.1
Basepair signature:
|
50.00 | -14.58 | 4 | 4 |
|
| 4 |
Motif group HL_85434.1
Basepair signature:
|
50.00 | -18.12 | 5.5 | 3.5 |
|
| 5 |
Motif group HL_26934.1
Basepair signature:
|
50.00 | -22.36 | 5 | 3 |
|
| 6 |
Motif group HL_83808.4
Basepair signature:
|
50.00 | -24.80 | 6 | 4 |
Pseudoknot |
| 7 |
Motif group HL_27670.2
Basepair signature:
|
50.00 | -24.92 | 3.5 | 1.5 |
T-loop with unstacked turn |
| 8 |
Motif group HL_93135.1
Basepair signature:
|
50.00 | -43.74 | 5 | 4 |
Pseudoknot |
| 9 |
Motif group HL_50006.2
Basepair signature:
|
50.00 | -48.37 | 5 | 3 |
|
| 10 |
Motif group HL_66103.1
Basepair signature:
|
50.00 | -103.61 | 5 | 3 |
|
Loop 4 Hairpin loop
Column numbers: 53-58
Scored sequences and counts
CGUGAG 1
UGUGAA 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_52953.3
Basepair signature:
|
100.00 | 89.10 | 1 | 0 |
|
| 2 |
Motif group HL_13963.3
Basepair signature:
|
100.00 | 66.20 | 3 | 1 |
|
| 3 |
Motif group HL_37824.7
Basepair signature:
|
100.00 | 59.84 | 0 | 0 |
GNRA |
| 4 |
Motif group HL_93535.1
Basepair signature:
|
100.00 | 58.84 | 1.5 | 1 |
|
| 5 |
Motif group HL_59843.1
Basepair signature:
|
100.00 | 51.48 | 2 | 1 |
|
| 6 |
Motif group HL_53890.2
Basepair signature:
|
100.00 | 48.79 | 2 | 1 |
|
| 7 |
Motif group HL_56676.1
Basepair signature:
|
100.00 | 45.93 | 2 | 1 |
|
| 8 |
Motif group HL_34617.5
Basepair signature:
|
100.00 | 44.40 | 1 | 0 |
UNCG |
| 9 |
Motif group HL_04783.2
Basepair signature:
|
100.00 | 43.71 | 1.5 | 1 |
|
| 10 |
Motif group HL_75660.5
Basepair signature:
|
100.00 | 39.30 | 2.5 | 1 |
|
Loop 5 Internal loop
Column numbers: 92-94, 134-135
Scored sequences and counts
AAG*CU 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_10569.1
Basepair signature:
|
100.00 | 99.99 | 2 | 0 |
|
| 2 |
Motif group IL_26793.1
Basepair signature:
|
100.00 | 99.95 | 0 | 0 |
Single stack bend |
| 3 |
Motif group IL_42771.1
Basepair signature:
|
100.00 | 97.40 | 2 | 0 |
Multiple bulged bases |
| 4 |
Motif group IL_90729.1
Basepair signature:
|
100.00 | 96.04 | 0 | 0 |
Single stack bend |
| 5 |
Motif group IL_31462.6
Basepair signature:
|
100.00 | 91.71 | 0 | 0 |
Single bulged A |
| 6 |
Motif group IL_66635.5
Basepair signature:
|
100.00 | 89.14 | 1 | 0 |
Major groove intercalation |
| 7 |
Motif group IL_33761.2
Basepair signature:
|
100.00 | 86.40 | 4 | 0 |
|
| 8 |
Motif group IL_31737.3
Basepair signature:
|
100.00 | 84.50 | 0 | 0 |
Stack and bulge |
| 9 |
Motif group IL_48076.6
Basepair signature:
|
100.00 | 77.56 | 2 | 0 |
Major groove platform |
| 10 |
Motif group IL_07039.3
Basepair signature:
|
100.00 | 75.31 | 3 | 0 |
Major groove platform |
Loop 6 3-way junction loop
Column numbers: 96-97, 107-116, 131-132
Scored sequences and counts
UA*UUAUAAAGAC*GG 2
No Matches Found
View All Results for this LoopLoop 7 Hairpin loop
Column numbers: 99-105
Scored sequences and counts
GUAUGCC 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_04783.2
Basepair signature:
|
100.00 | 23.71 | 3 | 1 |
|
| 2 |
Motif group HL_67667.2
Basepair signature:
|
100.00 | 5.88 | 4 | 2 |
|
| 3 |
Motif group HL_50006.2
Basepair signature:
|
100.00 | 2.52 | 4 | 3 |
|
| 4 |
Motif group HL_87954.2
Basepair signature:
|
100.00 | 2.27 | 3 | 2 |
|
| 5 |
Motif group HL_30068.2
Basepair signature:
|
100.00 | 1.64 | 4 | 2 |
|
Loop 8 Hairpin loop
Column numbers: 120-127
Scored sequences and counts
GGUAACGC 1
GGUAGCGC 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_81538.2
Basepair signature:
|
100.00 | 58.01 | 1 | 1 |
GNRA with tandem sheared |
| 2 |
Motif group HL_84299.4
Basepair signature:
|
100.00 | 51.61 | 1.5 | 1.5 |
|
| 3 |
Motif group HL_93324.4
Basepair signature:
|
100.00 | 42.70 | 2.5 | 1.5 |
Pseudoknot geometry |
| 4 |
Motif group HL_25061.1
Basepair signature:
|
50.00 | 10.67 | 4.5 | 2.5 |
|
| 5 |
Motif group HL_77436.5
Basepair signature:
|
50.00 | 9.19 | 1.5 | 1.5 |
T-loop related |
| 6 |
Motif group HL_78197.1
Basepair signature:
|
50.00 | 6.19 | 2.5 | 2.5 |
|
| 7 |
Motif group HL_20167.2
Basepair signature:
|
50.00 | -1.31 | 2 | 2 |
|
| 8 |
Motif group HL_77600.2
Basepair signature:
|
50.00 | -9.78 | 2.5 | 1.5 |
|
| 9 |
Motif group HL_50318.1
Basepair signature:
|
50.00 | -11.88 | 4.5 | 3.5 |
|