#SLoop idPDBDisc#Non-coreChain(s)Standardized name for chain 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 201-204-195-18
1 HL_4PLX_0024PLX0.00000ACore ENE hairpin and A-rich tract from MALAT1U47G48G49C50C51U52U53U54C55U56U57A58A59A60A61A62A63A64A65A66cWWncsSncSs

3D structures

Complete motif including flanking bases
SequenceCounts
UGGCCUUUCUUAAAAAAAAA1
Non-Watson-Crick part of the motif
SequenceCounts
GGCCUUUCUUAAAAAAAA1

Release history

Release3.33.43.53.63.73.83.93.103.23.113.123.133.143.153.163.173.183.193.203.213.223.233.243.253.263.273.283.293.303.313.323.333.343.353.363.373.383.393.403.413.423.433.443.453.463.473.483.493.503.513.523.533.543.553.563.573.583.593.603.613.623.633.643.653.663.673.683.693.703.713.723.733.743.753.763.773.783.793.803.813.823.833.843.853.863.873.883.893.903.913.923.933.943.953.963.973.983.994.04.14.24.34.44.54.64.7
Date2018-03-082018-04-062018-05-042018-06-012018-06-292018-07-272018-08-242018-09-212018-09-262018-10-192018-11-162018-12-142019-01-112019-02-082019-03-082019-04-052019-05-032019-05-312019-06-282019-07-262019-08-232019-09-192019-10-162019-11-132019-12-112020-01-082020-02-052020-03-042020-04-012020-04-292020-05-272020-06-242020-07-222020-08-192020-09-162020-10-142020-11-112020-12-092021-01-062021-02-032021-03-032021-03-312021-04-282021-05-262021-06-232021-07-212021-08-182021-09-152021-10-132021-11-102021-12-082022-01-052022-02-022022-03-022022-03-302022-04-272022-05-252022-06-222022-07-202022-08-172022-10-122022-11-092022-12-072023-01-042023-02-012023-03-012023-03-292023-04-262023-05-242023-06-212023-07-192023-08-162023-09-132023-10-112023-11-082023-12-062024-01-032024-01-032024-01-312024-02-282024-03-272024-04-242024-05-222024-06-192024-07-172024-08-142024-09-112024-10-092024-11-062024-12-042025-01-012025-01-292025-02-262025-03-262025-04-232025-05-212025-06-182025-07-162025-08-132025-09-102025-10-082025-11-052025-12-032025-12-312026-01-282026-02-25
StatusExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchNew id, no parentsExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact matchExact match

Parent motifs

This motif has no parent motifs.

Children motifs

This motif has no children motifs.
Annotations
  • (1)
  • Basepair signature
    cWW-F-cSS-F-cSS-F-F-F-F-F-F-F-F-F-F-F-F
    Heat map statistics
    Min 0.00 | Avg 0.00 | Max 0.00
    Help

    Coloring options:

    Copyright 2026 BGSU RNA group. Page generated in 7.5613 s