JAR3D
Query RF03535-CCF-3.98 completed
Run on Motif Atlas Version 3.98
using the CaCoFold secondary structure. Run with the Rfam secondary structure.
RF03535 Staphylococcus aureus small RNA TEG147
Input Summary
0000000001111111111222222222233333333334444444444555555555566
1234567890123456789012345678901234567890123456789012345678901
....(((((((((.....((((((((.......)))).))).)....))))))))).....
>CP000253.1_386294-386353
AACUGAUCCAUGAGAGUAGGAACCCCAUCAUACGGGAAUUU-CGAAAUCAUGGGUUUUUUG
>LUGM01000002.1_900415-900473
AAUCCACCUAUGAGAGUAGGAACCCCACCAUAUGGGGAUUU-CGAAAUCAUAGGUUUUUG-
>JMJF01000005.1_93013-92953
ACUCAACCCAUGAAAGUAGACACCCCACCAUAAGGGGAUGAGCGAAAUCAUGGGUUUUUUG
>AP023034.1_433520-433579
AACUGAUCCAUGAGAGUAGGAACCCCAUCAUACGGGAAUUU-CGAAAUCAUGGGUUUUUUG
There are no chains in PDB that we map to Rfam family RF03535.
Jump to results for:
Loop 1 Internal loop
Column numbers: 13-19, 43-48
Scored sequences and counts
AGAGUAG*CGAAAU 3
AAAGUAG*CGAAAU 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_26307.2
Basepair signature:
|
100.00 | 95.63 | 2 | 0 |
7x6 Sarcin-Ricin; G-bulge |
| 2 |
Motif group IL_24254.1
Basepair signature:
|
100.00 | 42.41 | 6 | 2 |
7x6 Sarcin-Ricin with UU cWW pair; G-bulge |
| 3 |
Motif group IL_41756.4
Basepair signature:
|
100.00 | 37.52 | 4 | 1 |
8x6 Sarcin-Ricin with inserted Y; G-bulge |
| 4 |
Motif group IL_47346.2
Basepair signature:
|
100.00 | 29.58 | 4 | 2 |
tSH-tSH-tHH-tHS |
| 5 |
Motif group IL_02349.4
Basepair signature:
|
100.00 | 29.33 | 4 | 2 |
8x6 Sarcin-Ricin with bulged A; G-bulge |
| 6 |
Motif group IL_29198.2
Basepair signature:
|
100.00 | 25.78 | 4 | 2 |
7x7 Sarcin-Ricin with intercalated A; G-bulge |
| 7 |
Motif group IL_61286.1
Basepair signature:
|
100.00 | 24.25 | 6 | 3 |
8x6 Sarcin-Ricin with inserted A; G-bulge |
| 8 |
Motif group IL_04346.10
Basepair signature:
|
100.00 | 20.81 | 3 | 2 |
8x7 Sarcin-Ricin; G-bulge |
| 9 |
Motif group IL_16458.4
Basepair signature:
|
100.00 | 2.74 | 7 | 3 |
Sarcin-Ricin target in LSU H95; G-bulge |
| 10 |
Motif group IL_32016.1
Basepair signature:
|
25.00 | -10.91 | 6 | 4 |
Kink-turn |
Loop 2 Internal loop
Column numbers: 19-20, 41-43
Scored sequences and counts
GG*U-C 3
GA*AGC 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_07039.3
Basepair signature:
|
100.00 | 42.90 | 2 | 1 |
Major groove platform |
| 2 |
Motif group IL_66635.5
Basepair signature:
|
100.00 | 29.37 | 1 | 1 |
Major groove intercalation |
| 3 |
Motif group IL_00225.13
Basepair signature:
|
100.00 | 26.74 | 1 | 1 |
Single bulged G |
| 4 |
Motif group IL_33761.2
Basepair signature:
|
100.00 | 19.30 | 2 | 1 |
|
| 5 |
Motif group IL_81831.1
Basepair signature:
|
100.00 | 9.10 | 4 | 1 |
Intercalated cWS |
| 6 |
Motif group IL_42771.1
Basepair signature:
|
100.00 | 7.41 | 4 | 1 |
Multiple bulged bases |
| 7 |
Motif group IL_84476.1
Basepair signature:
|
75.00 | -2.10 | 3 | 2 |
Multiple bulged bases |
| 8 |
Motif group IL_16386.4
Basepair signature:
|
25.00 | 8.53 | 4 | 1 |
|
| 9 |
Motif group IL_73452.2
Basepair signature:
|
25.00 | 5.31 | 2 | 1 |
|
| 10 |
Motif group IL_90729.1
Basepair signature:
|
25.00 | 1.73 | 2 | 1 |
Single stack bend |
Loop 3 Internal loop
Column numbers: 22-23, 37-39
Scored sequences and counts
AC*AAU 2
AC*GAU 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_26793.1
Basepair signature:
|
100.00 | 84.69 | 2 | 0 |
Single stack bend |
| 2 |
Motif group IL_42771.1
Basepair signature:
|
100.00 | 83.65 | 3.5 | 0 |
Multiple bulged bases |
| 3 |
Motif group IL_90729.1
Basepair signature:
|
100.00 | 79.32 | 0.5 | 0 |
Single stack bend |
| 4 |
Motif group IL_33761.2
Basepair signature:
|
100.00 | 75.51 | 3.5 | 0 |
|
| 5 |
Motif group IL_31737.3
Basepair signature:
|
100.00 | 75.40 | 2.5 | 0 |
Stack and bulge |
| 6 |
Motif group IL_66635.5
Basepair signature:
|
100.00 | 75.32 | 1.5 | 0 |
Major groove intercalation |
| 7 |
Motif group IL_31462.6
Basepair signature:
|
100.00 | 75.20 | 0.5 | 0 |
Single bulged A |
| 8 |
Motif group IL_07039.3
Basepair signature:
|
100.00 | 70.48 | 2 | 0 |
Major groove platform |
| 9 |
Motif group IL_48076.6
Basepair signature:
|
100.00 | 58.59 | 2.5 | 0 |
Major groove platform |
| 10 |
Motif group IL_10569.1
Basepair signature:
|
100.00 | 58.12 | 3.5 | 0 |
|
Loop 4 Hairpin loop
Column numbers: 26-34
Scored sequences and counts
CAUCAUACG 2
CACCAUAAG 1
CACCAUAUG 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_72628.1
Basepair signature:
|
75.00 | 10.83 | 3 | 3 |
|
| 2 |
Motif group HL_33983.1
Basepair signature:
|
75.00 | 7.93 | 3 | 3 |
|
| 3 |
Motif group HL_80362.1
Basepair signature:
|
50.00 | 14.79 | 3 | 3 |
|
| 4 |
Motif group HL_06059.6
Basepair signature:
|
50.00 | 1.26 | 3 | 2 |
tRNA anticodon loop |
| 5 |
Motif group HL_77082.1
Basepair signature:
|
50.00 | -1.86 | 3 | 1.5 |
Pseudoknot geometry |
| 6 |
Motif group HL_38046.1
Basepair signature:
|
50.00 | -5.85 | 5.5 | 3.5 |
|
| 7 |
Motif group HL_20743.5
Basepair signature:
|
50.00 | -8.16 | 3.5 | 3.5 |
|
| 8 |
Motif group HL_20535.2
Basepair signature:
|
50.00 | -12.55 | 4 | 2.5 |
|
| 9 |
Motif group HL_75293.5
Basepair signature:
|
50.00 | -15.51 | 4 | 3 |
|
| 10 |
Motif group HL_25847.2
Basepair signature:
|
25.00 | -2.76 | 6 | 4 |
|