RF03535 Staphylococcus aureus small RNA TEG147

Input Summary

      0000000001111111111222222222233333333334444444444555555555566
1234567890123456789012345678901234567890123456789012345678901
....(((((((((.....((((.(((.......)))..))).)....))))))))).....
>CP000253.1/386294-386353
AACUGAUCCAUGAGAGUAGGAACCCCAUCAUACGGGAAUUU-CGAAAUCAUGGGUUUUUUG
>LUGM01000002.1/900415-900473
AAUCCACCUAUGAGAGUAGGAACCCCACCAUAUGGGGAUUU-CGAAAUCAUAGGUUUUUG-
>JMJF01000005.1/93013-92953
ACUCAACCCAUGAAAGUAGACACCCCACCAUAAGGGGAUGAGCGAAAUCAUGGGUUUUUUG
>AP023034.1/433520-433579
AACUGAUCCAUGAGAGUAGGAACCCCAUCAUACGGGAAUUU-CGAAAUCAUGGGUUUUUUG

There are no chains in PDB that we map to Rfam family RF03535.

Jump to results for:

  • Loop 1IL Column numbers: 13-19, 43-48
  • Loop 2IL Column numbers: 19-20, 41-43
  • Loop 3IL Column numbers: 22-24, 36-39
  • Loop 4HL Column numbers: 26-34

Loop 1 Internal loop

Column numbers: 13-19, 43-48
    Scored sequences and counts
AGAGUAG*CGAAAU 3
AAAGUAG*CGAAAU 1
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 95.63 2 0

7x6 Sarcin-Ricin; G-bulge

2 100.00 42.41 6 2

7x6 Sarcin-Ricin with UU cWW pair; G-bulge

3 100.00 37.52 4 1

8x6 Sarcin-Ricin with inserted Y; G-bulge

4 100.00 29.58 4 2

tSH-tSH-tHH-tHS

5 100.00 29.33 4 2

8x6 Sarcin-Ricin with bulged A; G-bulge

6 100.00 25.78 4 2

7x7 Sarcin-Ricin with intercalated A; G-bulge

7 100.00 24.25 6 3

8x6 Sarcin-Ricin with inserted A; G-bulge

8 100.00 20.81 3 2

8x7 Sarcin-Ricin; G-bulge

9 100.00 2.74 7 3

Sarcin-Ricin target in LSU H95; G-bulge

10 25.00 -10.91 6 4

Kink-turn

Loop 2 Internal loop

Column numbers: 19-20, 41-43
    Scored sequences and counts
GG*U-C 3
GA*AGC 1
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 42.90 2 1

Major groove platform

2 100.00 29.37 1 1

Major groove intercalation

3 100.00 26.74 1 1

Single bulged G

4 100.00 19.30 2 1

5 100.00 9.10 4 1

Intercalated cWS

6 100.00 7.41 4 1

Multiple bulged bases

7 75.00 -2.10 3 2

Multiple bulged bases

8 25.00 8.53 4 1

9 25.00 5.31 2 1

10 25.00 1.73 2 1

Single stack bend

Loop 3 Internal loop

Column numbers: 22-24, 36-39
    Scored sequences and counts
ACC*GAAU 2
ACC*GGAU 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 65.31 2.5 0.5

2 100.00 56.03 3.5 0.5

3 100.00 55.36 3 1

4 100.00 50.11 4.5 0.5

5 100.00 44.60 3 1.5

6 100.00 32.11 3 1

Isolated non-canonical cWW pair

7 100.00 24.12 1.5 1.5

8 100.00 23.21 1.5 1

Multiple bulged bases

9 100.00 22.95 3 1

Decoding loop related

10 100.00 14.20 3.5 1.5

Loop 4 Hairpin loop

Column numbers: 26-34
    Scored sequences and counts
CAUCAUACG 2
CACCAUAAG 1
CACCAUAUG 1
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 75.00 10.83 3 3

2 75.00 7.93 3 3

3 50.00 14.79 3 3

4 50.00 1.26 3 2

tRNA anticodon loop

5 50.00 -1.86 3 1.5

Pseudoknot geometry

6 50.00 -5.85 5.5 3.5

7 50.00 -8.16 3.5 3.5

8 50.00 -12.55 4 2.5

9 50.00 -15.51 4 3

10 25.00 -2.76 6 4

Coloring options: