JAR3D
Query RF01446-CCF-3.98 completed
Run on Motif Atlas Version 3.98
using the CaCoFold secondary structure. Run with the Rfam secondary structure.
RF01446 small nucleolar RNA snR95
Input Summary
000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111122222222222222222222222
000000000111111111122222222223333333333444444444455555555556666666666777777777788888888889999999999000000000011111111112222222222333333333344444444445555555555666666666677777777778888888888999999999900000000001111111111222
123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012
........((((((.((((((......(((..(((((....((((((((........)))))))))))))..)))(((((...(((((((........)))))))......))))).............((((............................))))))))))))))))(((((((.........)))))))......................
>AB004535.1_423-644
UUUAACAACCAUGUUCACUUUCCACUUGAGAAGACACAAAAAUUGUCUUGUCGCUUUAGGAUAAUGUGUUGACUCGCAGGAACUAGUUGCAAUGAACGGCGAUUAAAUUGGUCUGUUUUUUUGUUGGUUAAGCAUGGUAGAUAACGUUUGUUCAAACAAUAGCUUAAAGUGACAUGGUUUUGCCUAUGUUUAUGGUAAAAGCAUCGAUAGAGCUGUACAUUU
>AB004534.1_35594-35815
UUUAACAACCAUGUUCACUUUCCACUUGAGAAGACACAAAAAUUGUCUUGUCGCUUUAGGAUAAUGUGUUGACUCGCAGGAACUAGUUGCAAUGAACGGCGAUUAAAUUGGUCUGUUUUUUUGUUGGUUAAGCAUGGUAGAUAACGUUUGUUCAAACAAUAGCUUAAAGUGACAUGGUUUUGCCUAUGUUUAUGGUAAAAGCAUCGAUAGAGCUGUACAUUU
There are no chains in PDB that we map to Rfam family RF01446.
Jump to results for:
- Loop 1IL Column numbers: 14-16, 171-172
- Loop 2J4 Column numbers: 21-28, 75-76, 116-130, 165-166
- Loop 3IL Column numbers: 30-33, 70-73
- Loop 4IL Column numbers: 37-42, 65-66
- Loop 5HL Column numbers: 49-58
- Loop 6IL Column numbers: 80-84, 105-112
- Loop 7HL Column numbers: 90-99
- Loop 8HL Column numbers: 133-162
- Loop 9HL Column numbers: 184-194
Loop 1 Internal loop
Column numbers: 14-16, 171-172
Scored sequences and counts
UUC*GA 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_81831.1
Basepair signature:
|
100.00 | 99.28 | 4 | 0 |
Intercalated cWS |
| 2 |
Motif group IL_73452.2
Basepair signature:
|
100.00 | 96.58 | 2 | 0 |
|
| 3 |
Motif group IL_33761.2
Basepair signature:
|
100.00 | 94.68 | 2 | 0 |
|
| 4 |
Motif group IL_48076.6
Basepair signature:
|
100.00 | 89.16 | 1 | 0 |
Major groove platform |
| 5 |
Motif group IL_89505.4
Basepair signature:
|
100.00 | 86.58 | 0 | 0 |
Single bulged U |
| 6 |
Motif group IL_90729.1
Basepair signature:
|
100.00 | 84.11 | 2 | 0 |
Single stack bend |
| 7 |
Motif group IL_51454.3
Basepair signature:
|
100.00 | 78.42 | 1 | 0 |
Minor groove platform |
| 8 |
Motif group IL_26793.1
Basepair signature:
|
100.00 | 74.72 | 3 | 0 |
Single stack bend |
| 9 |
Motif group IL_07039.3
Basepair signature:
|
100.00 | 72.82 | 3 | 0 |
Major groove platform |
| 10 |
Motif group IL_42771.1
Basepair signature:
|
100.00 | 66.26 | 3 | 1 |
Multiple bulged bases |
Loop 2 4-way junction loop
Column numbers: 21-28, 75-76, 116-130, 165-166
Scored sequences and counts
UCCACUUG*CG*UUUUUUUGUUGGUUA*UA 2
No Matches Found
View All Results for this LoopLoop 3 Internal loop
Column numbers: 30-33, 70-73
Scored sequences and counts
GAAG*UGAC 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_09705.15
Basepair signature:
|
100.00 | 83.87 | 0 | 0 |
Double sheared |
| 2 |
Motif group IL_10484.1
Basepair signature:
|
100.00 | 57.78 | 3 | 1 |
Double sheared |
| 3 |
Motif group IL_84251.1
Basepair signature:
|
100.00 | 55.65 | 4 | 1 |
|
| 4 |
Motif group IL_80398.1
Basepair signature:
|
100.00 | 46.80 | 2 | 1 |
Minor groove platform |
| 5 |
Motif group IL_48444.6
Basepair signature:
|
100.00 | 41.15 | 3 | 1 |
|
| 6 |
Motif group IL_68574.4
Basepair signature:
|
100.00 | 39.04 | 3 | 1 |
|
| 7 |
Motif group IL_85033.2
Basepair signature:
|
100.00 | 30.00 | 3 | 1 |
Tandem non-canonical cWW pairs |
| 8 |
Motif group IL_25872.4
Basepair signature:
|
100.00 | 24.79 | 4 | 1 |
|
| 9 |
Motif group IL_41344.1
Basepair signature:
|
100.00 | 18.54 | 5 | 2 |
|
| 10 |
Motif group IL_23774.1
Basepair signature:
|
100.00 | 16.85 | 3 | 1 |
UAA/GAN variation |
Loop 4 Internal loop
Column numbers: 37-42, 65-66
Scored sequences and counts
CAAAAA*UG 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_46086.1
Basepair signature:
|
100.00 | 51.56 | 2 | 1 |
|
| 2 |
Motif group IL_98347.1
Basepair signature:
|
100.00 | 38.07 | 3 | 1 |
|
| 3 |
Motif group IL_87211.1
Basepair signature:
|
100.00 | 16.73 | 3 | 2 |
|
| 4 |
Motif group IL_59302.1
Basepair signature:
|
100.00 | 7.02 | 5 | 2 |
|
| 5 |
Motif group IL_49714.1
Basepair signature:
|
100.00 | 2.14 | 6 | 2 |
Major groove intercalation |
Loop 5 Hairpin loop
Column numbers: 49-58
Scored sequences and counts
UGUCGCUUUA 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_24792.1
Basepair signature:
|
100.00 | 11.91 | 6 | 4 |
|
| 2 |
Motif group HL_08510.1
Basepair signature:
|
100.00 | 10.11 | 3 | 3 |
|
| 3 |
Motif group HL_99867.1
Basepair signature:
|
100.00 | 7.58 | 5 | 3 |
|
| 4 |
Motif group HL_87463.1
Basepair signature:
|
100.00 | 3.00 | 6 | 4 |
|
| 5 |
Motif group HL_73255.1
Basepair signature:
|
100.00 | 2.66 | 5 | 3 |
|
Loop 6 Internal loop
Column numbers: 80-84, 105-112
Scored sequences and counts
GAACU*AAAUUGGU 2
No Matches Found
View All Results for this LoopLoop 7 Hairpin loop
Column numbers: 90-99
Scored sequences and counts
CAAUGAACGG 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_50779.4
Basepair signature:
|
100.00 | 44.39 | 4 | 2 |
|
| 2 |
Motif group HL_93438.2
Basepair signature:
|
100.00 | 22.13 | 4 | 3 |
|
| 3 |
Motif group HL_36335.1
Basepair signature:
|
100.00 | 10.51 | 3 | 3 |
|
| 4 |
Motif group HL_75293.5
Basepair signature:
|
100.00 | 9.86 | 4 | 4 |
|
Loop 8 Hairpin loop
Column numbers: 133-162
Scored sequences and counts
CAUGGUAGAUAACGUUUGUUCAAACAAUAG 2
No Matches Found
View All Results for this LoopLoop 9 Hairpin loop
Column numbers: 184-194
Scored sequences and counts
CUAUGUUUAUG 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_93135.1
Basepair signature:
|
100.00 | 50.65 | 2 | 2 |
Pseudoknot |
| 2 |
Motif group HL_99769.3
Basepair signature:
|
100.00 | 27.87 | 5 | 3 |
|
| 3 |
Motif group HL_34964.1
Basepair signature:
|
100.00 | 17.33 | 6 | 4 |
|
| 4 |
Motif group HL_67079.1
Basepair signature:
|
100.00 | 16.24 | 5 | 3 |
|
| 5 |
Motif group HL_98252.1
Basepair signature:
|
100.00 | 4.75 | 5 | 3 |
|
| 6 |
Motif group HL_87463.1
Basepair signature:
|
100.00 | 4.17 | 5 | 3 |
|
| 7 |
Motif group HL_29762.1
Basepair signature:
|
100.00 | 0.05 | 5 | 4 |
|