RF01446 small nucleolar RNA snR95

Input Summary

      000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111122222222222222222222222
000000000111111111122222222223333333333444444444455555555556666666666777777777788888888889999999999000000000011111111112222222222333333333344444444445555555555666666666677777777778888888888999999999900000000001111111111222
123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012
........((((((.((((((......(((..(((((....((((((((........)))))))))))))..)))(((((...(((((((........)))))))......))))).............((((............................))))))))))))))))(((((((.........)))))))......................
>AB004535.1_423-644
UUUAACAACCAUGUUCACUUUCCACUUGAGAAGACACAAAAAUUGUCUUGUCGCUUUAGGAUAAUGUGUUGACUCGCAGGAACUAGUUGCAAUGAACGGCGAUUAAAUUGGUCUGUUUUUUUGUUGGUUAAGCAUGGUAGAUAACGUUUGUUCAAACAAUAGCUUAAAGUGACAUGGUUUUGCCUAUGUUUAUGGUAAAAGCAUCGAUAGAGCUGUACAUUU
>AB004534.1_35594-35815
UUUAACAACCAUGUUCACUUUCCACUUGAGAAGACACAAAAAUUGUCUUGUCGCUUUAGGAUAAUGUGUUGACUCGCAGGAACUAGUUGCAAUGAACGGCGAUUAAAUUGGUCUGUUUUUUUGUUGGUUAAGCAUGGUAGAUAACGUUUGUUCAAACAAUAGCUUAAAGUGACAUGGUUUUGCCUAUGUUUAUGGUAAAAGCAUCGAUAGAGCUGUACAUUU

There are no chains in PDB that we map to Rfam family RF01446.

Jump to results for:

  • Loop 1IL Column numbers: 14-16, 171-172
  • Loop 2J4 Column numbers: 21-28, 75-76, 116-130, 165-166
  • Loop 3IL Column numbers: 30-33, 70-73
  • Loop 4IL Column numbers: 37-42, 65-66
  • Loop 5HL Column numbers: 49-58
  • Loop 6IL Column numbers: 80-84, 105-112
  • Loop 7HL Column numbers: 90-99
  • Loop 8HL Column numbers: 133-162
  • Loop 9HL Column numbers: 184-194

Loop 1 Internal loop

Column numbers: 14-16, 171-172
    Scored sequences and counts
UUC*GA 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 99.28 4 0

Intercalated cWS

2 100.00 96.58 2 0

3 100.00 94.68 2 0

4 100.00 89.16 1 0

Major groove platform

5 100.00 86.58 0 0

Single bulged U

6 100.00 84.11 2 0

Single stack bend

7 100.00 78.42 1 0

Minor groove platform

8 100.00 74.72 3 0

Single stack bend

9 100.00 72.82 3 0

Major groove platform

10 100.00 66.26 3 1

Multiple bulged bases

Loop 2 4-way junction loop

Column numbers: 21-28, 75-76, 116-130, 165-166
    Scored sequences and counts
UCCACUUG*CG*UUUUUUUGUUGGUUA*UA 2
No Matches Found View All Results for this Loop

Loop 3 Internal loop

Column numbers: 30-33, 70-73
    Scored sequences and counts
GAAG*UGAC 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 83.87 0 0

Double sheared

2 100.00 57.78 3 1

Double sheared

3 100.00 55.65 4 1

4 100.00 46.80 2 1

Minor groove platform

5 100.00 41.15 3 1

6 100.00 39.04 3 1

7 100.00 30.00 3 1

Tandem non-canonical cWW pairs

8 100.00 24.79 4 1

9 100.00 18.54 5 2

10 100.00 16.85 3 1

UAA/GAN variation

Loop 4 Internal loop

Column numbers: 37-42, 65-66
    Scored sequences and counts
CAAAAA*UG 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 51.56 2 1

2 100.00 38.07 3 1

3 100.00 16.73 3 2

4 100.00 7.02 5 2

5 100.00 2.14 6 2

Major groove intercalation

Loop 5 Hairpin loop

Column numbers: 49-58
    Scored sequences and counts
UGUCGCUUUA 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 11.91 6 4

2 100.00 10.11 3 3

3 100.00 7.58 5 3

4 100.00 3.00 6 4

5 100.00 2.66 5 3

Loop 6 Internal loop

Column numbers: 80-84, 105-112
    Scored sequences and counts
GAACU*AAAUUGGU 2
No Matches Found View All Results for this Loop

Loop 7 Hairpin loop

Column numbers: 90-99
    Scored sequences and counts
CAAUGAACGG 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 44.39 4 2

2 100.00 22.13 4 3

3 100.00 10.51 3 3

4 100.00 9.86 4 4

Loop 8 Hairpin loop

Column numbers: 133-162
    Scored sequences and counts
CAUGGUAGAUAACGUUUGUUCAAACAAUAG 2
No Matches Found View All Results for this Loop

Loop 9 Hairpin loop

Column numbers: 184-194
    Scored sequences and counts
CUAUGUUUAUG 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 50.65 2 2

Pseudoknot

2 100.00 27.87 5 3

3 100.00 17.33 6 4

4 100.00 16.24 5 3

5 100.00 4.75 5 3

6 100.00 4.17 5 3

7 100.00 0.05 5 4

Coloring options: