JAR3D
Query RF01446-3.98 completed
Run on Motif Atlas Version 3.98
using the Rfam secondary structure. Run with the CaCoFold secondary structure.
RF01446 small nucleolar RNA snR95
Input Summary
000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111122222222222222222222222
000000000111111111122222222223333333333444444444455555555556666666666777777777788888888889999999999000000000011111111112222222222333333333344444444445555555555666666666677777777778888888888999999999900000000001111111111222
123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012
........(((((((......((((..((((((((.(((.((((((((..(.((.((((.....((((......))))....))))..)).)..)..)))))))...)))))))..))))..).)))...))))))).....................(((((((....(((..((.(((((((.........))))))).)))))...)))))))......
>AB004535.1/423-644
UUUAACAACCAUGUUCACUUUCCACUUGAGAAGACACAAAAAUUGUCUUGUCGCUUUAGGAUAAUGUGUUGACUCGCAGGAACUAGUUGCAAUGAACGGCGAUUAAAUUGGUCUGUUUUUUUGUUGGUUAAGCAUGGUAGAUAACGUUUGUUCAAACAAUAGCUUAAAGUGACAUGGUUUUGCCUAUGUUUAUGGUAAAAGCAUCGAUAGAGCUGUACAUUU
>AB004534.1/35594-35815
UUUAACAACCAUGUUCACUUUCCACUUGAGAAGACACAAAAAUUGUCUUGUCGCUUUAGGAUAAUGUGUUGACUCGCAGGAACUAGUUGCAAUGAACGGCGAUUAAAUUGGUCUGUUUUUUUGUUGGUUAAGCAUGGUAGAUAACGUUUGUUCAAACAAUAGCUUAAAGUGACAUGGUUUUGCCUAUGUUUAUGGUAAAAGCAUCGAUAGAGCUGUACAUUU
There are no chains in PDB that we map to Rfam family RF01446.
Jump to results for:
- Loop 1IL Column numbers: 15-22, 127-131
- Loop 2IL Column numbers: 24-25, 123-125
- Loop 3IL Column numbers: 25-28, 120-123
- Loop 4IL Column numbers: 31-32, 114-117
- Loop 5IL Column numbers: 35-37, 110-111
- Loop 6IL Column numbers: 39-41, 104-108
- Loop 7IL Column numbers: 47-48, 95-98
- Loop 8IL Column numbers: 48-51, 92-95
- Loop 9IL Column numbers: 51-53, 90-92
- Loop 10IL Column numbers: 54-56, 86-89
- Loop 11IL Column numbers: 59-65, 78-83
- Loop 12HL Column numbers: 68-75
- Loop 13IL Column numbers: 165-170, 206-210
- Loop 14IL Column numbers: 172-175, 203-204
- Loop 15IL Column numbers: 176-178, 200-202
- Loop 16HL Column numbers: 184-194
Loop 1 Internal loop
Column numbers: 15-22, 127-131
Scored sequences and counts
UCACUUUC*GUUAA 2
No Matches Found
View All Results for this LoopLoop 2 Internal loop
Column numbers: 24-25, 123-125
Scored sequences and counts
AC*GUU 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_81831.1
Basepair signature:
|
100.00 | 99.22 | 2 | 0 |
Intercalated cWS |
| 2 |
Motif group IL_73452.2
Basepair signature:
|
100.00 | 97.14 | 2 | 0 |
|
| 3 |
Motif group IL_89505.4
Basepair signature:
|
100.00 | 92.59 | 0 | 0 |
Single bulged U |
| 4 |
Motif group IL_90729.1
Basepair signature:
|
100.00 | 90.82 | 1 | 0 |
Single stack bend |
| 5 |
Motif group IL_33761.2
Basepair signature:
|
100.00 | 81.88 | 2 | 0 |
|
| 6 |
Motif group IL_48076.6
Basepair signature:
|
100.00 | 78.62 | 2 | 0 |
Major groove platform |
| 7 |
Motif group IL_26793.1
Basepair signature:
|
100.00 | 77.51 | 3 | 0 |
Single stack bend |
| 8 |
Motif group IL_07039.3
Basepair signature:
|
100.00 | 68.02 | 3 | 0 |
Major groove platform |
| 9 |
Motif group IL_42771.1
Basepair signature:
|
100.00 | 64.64 | 5 | 1 |
Multiple bulged bases |
| 10 |
Motif group IL_10569.1
Basepair signature:
|
100.00 | 62.57 | 5 | 1 |
|
Loop 3 Internal loop
Column numbers: 25-28, 120-123
Scored sequences and counts
CUUG*UUUG 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_77658.1
Basepair signature:
|
100.00 | 83.62 | 1 | 0 |
Tandem non-canonical cWW pairs |
| 2 |
Motif group IL_85033.2
Basepair signature:
|
100.00 | 65.26 | 3 | 0 |
Tandem non-canonical cWW pairs |
| 3 |
Motif group IL_51479.1
Basepair signature:
|
100.00 | 60.87 | 1 | 0 |
|
| 4 |
Motif group IL_92446.2
Basepair signature:
|
100.00 | 29.36 | 4 | 1 |
|
| 5 |
Motif group IL_02203.1
Basepair signature:
|
100.00 | 27.52 | 4 | 1 |
|
| 6 |
Motif group IL_81522.2
Basepair signature:
|
100.00 | 24.60 | 5 | 1 |
Major groove minor groove platform with intercalation; mini C-loop |
| 7 |
Motif group IL_78800.1
Basepair signature:
|
100.00 | 19.95 | 5 | 2 |
|
Loop 4 Internal loop
Column numbers: 31-32, 114-117
Scored sequences and counts
AA*UGUU 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_50694.7
Basepair signature:
|
100.00 | 88.79 | 1 | 0 |
Major groove platform; stack outside cWW |
| 2 |
Motif group IL_66635.5
Basepair signature:
|
100.00 | 87.98 | 2 | 0 |
Major groove intercalation |
| 3 |
Motif group IL_82107.4
Basepair signature:
|
100.00 | 73.51 | 2 | 0 |
Multiple bulged bases |
| 4 |
Motif group IL_79895.1
Basepair signature:
|
100.00 | 55.38 | 3 | 1 |
|
| 5 |
Motif group IL_73452.2
Basepair signature:
|
100.00 | 49.37 | 4 | 1 |
|
| 6 |
Motif group IL_56987.1
Basepair signature:
|
100.00 | 45.96 | 4 | 1 |
|
| 7 |
Motif group IL_76709.2
Basepair signature:
|
100.00 | 43.49 | 4 | 1 |
|
| 8 |
Motif group IL_81831.1
Basepair signature:
|
100.00 | 37.21 | 4 | 1 |
Intercalated cWS |
| 9 |
Motif group IL_33761.2
Basepair signature:
|
100.00 | 36.14 | 4 | 1 |
|
| 10 |
Motif group IL_84476.1
Basepair signature:
|
100.00 | 26.79 | 3 | 1 |
Multiple bulged bases |
Loop 5 Internal loop
Column numbers: 35-37, 110-111
Scored sequences and counts
CAC*GG 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_33761.2
Basepair signature:
|
100.00 | 100.00 | 0 | 0 |
|
| 2 |
Motif group IL_48076.6
Basepair signature:
|
100.00 | 100.00 | 0 | 0 |
Major groove platform |
| 3 |
Motif group IL_51454.3
Basepair signature:
|
100.00 | 100.00 | 0 | 0 |
Minor groove platform |
| 4 |
Motif group IL_42771.1
Basepair signature:
|
100.00 | 97.31 | 2 | 0 |
Multiple bulged bases |
| 5 |
Motif group IL_26793.1
Basepair signature:
|
100.00 | 96.13 | 3 | 0 |
Single stack bend |
| 6 |
Motif group IL_31462.6
Basepair signature:
|
100.00 | 92.67 | 0 | 0 |
Single bulged A |
| 7 |
Motif group IL_90729.1
Basepair signature:
|
100.00 | 91.56 | 2 | 0 |
Single stack bend |
| 8 |
Motif group IL_66635.5
Basepair signature:
|
100.00 | 88.60 | 1 | 0 |
Major groove intercalation |
| 9 |
Motif group IL_31737.3
Basepair signature:
|
100.00 | 86.90 | 2 | 0 |
Stack and bulge |
| 10 |
Motif group IL_07039.3
Basepair signature:
|
100.00 | 73.46 | 3 | 0 |
Major groove platform |
Loop 6 Internal loop
Column numbers: 39-41, 104-108
Scored sequences and counts
AAA*UAAAU 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_69440.3
Basepair signature:
|
100.00 | 78.93 | 4 | 0 |
|
| 2 |
Motif group IL_98347.1
Basepair signature:
|
100.00 | 55.73 | 5 | 1 |
|
| 3 |
Motif group IL_49061.1
Basepair signature:
|
100.00 | 54.92 | 5 | 1 |
|
| 4 |
Motif group IL_61476.2
Basepair signature:
|
100.00 | 49.17 | 4 | 1 |
|
| 5 |
Motif group IL_08770.1
Basepair signature:
|
100.00 | 40.27 | 5 | 1 |
|
| 6 |
Motif group IL_66997.2
Basepair signature:
|
100.00 | 31.85 | 3 | 1 |
|
| 7 |
Motif group IL_31737.3
Basepair signature:
|
100.00 | 31.12 | 5 | 1 |
Stack and bulge |
| 8 |
Motif group IL_47972.1
Basepair signature:
|
100.00 | 29.35 | 6 | 2 |
|
| 9 |
Motif group IL_06549.2
Basepair signature:
|
100.00 | 28.43 | 4 | 2 |
|
| 10 |
Motif group IL_90351.1
Basepair signature:
|
100.00 | 27.30 | 4 | 1 |
|
Loop 7 Internal loop
Column numbers: 47-48, 95-98
Scored sequences and counts
CU*AACG 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_42626.2
Basepair signature:
|
100.00 | 100.00 | 0 | 0 |
|
| 2 |
Motif group IL_76709.2
Basepair signature:
|
100.00 | 93.57 | 3 | 0 |
|
| 3 |
Motif group IL_82107.4
Basepair signature:
|
100.00 | 76.47 | 3 | 0 |
Multiple bulged bases |
| 4 |
Motif group IL_79895.1
Basepair signature:
|
100.00 | 66.37 | 5 | 1 |
|
| 5 |
Motif group IL_51454.3
Basepair signature:
|
100.00 | 55.02 | 3 | 0 |
Minor groove platform |
| 6 |
Motif group IL_81831.1
Basepair signature:
|
100.00 | 48.91 | 3 | 1 |
Intercalated cWS |
| 7 |
Motif group IL_73355.1
Basepair signature:
|
100.00 | 48.76 | 4 | 1 |
|
| 8 |
Motif group IL_00881.1
Basepair signature:
|
100.00 | 44.63 | 4 | 1 |
|
| 9 |
Motif group IL_95583.2
Basepair signature:
|
100.00 | 43.81 | 3 | 1 |
Minor groove platform, major groove intercalation |
| 10 |
Motif group IL_15052.4
Basepair signature:
|
100.00 | 40.82 | 3 | 1 |
Minor groove platform |
Loop 8 Internal loop
Column numbers: 48-51, 92-95
Scored sequences and counts
UUGU*AUGA 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_02203.1
Basepair signature:
|
100.00 | 56.24 | 3 | 1 |
|
| 2 |
Motif group IL_76758.2
Basepair signature:
|
100.00 | 9.24 | 4 | 2 |
Intercalated tWH |
Loop 9 Internal loop
Column numbers: 51-53, 90-92
Scored sequences and counts
UCG*CAA 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_67095.2
Basepair signature:
|
100.00 | 98.60 | 0 | 0 |
Isolated tWW turn |
| 2 |
Motif group IL_87907.2
Basepair signature:
|
100.00 | 87.80 | 0 | 0 |
Isolated non-canonical cWW pair |
| 3 |
Motif group IL_42997.3
Basepair signature:
|
100.00 | 79.24 | 1 | 0 |
Isolated cWS basepair |
| 4 |
Motif group IL_08770.1
Basepair signature:
|
100.00 | 73.16 | 3 | 1 |
|
| 5 |
Motif group IL_57744.1
Basepair signature:
|
100.00 | 68.28 | 3 | 0 |
Isolated non-canonical cWW pair |
| 6 |
Motif group IL_07785.1
Basepair signature:
|
100.00 | 62.69 | 2 | 1 |
Isolated non-canonical cWW pair |
| 7 |
Motif group IL_31737.3
Basepair signature:
|
100.00 | 55.95 | 3 | 1 |
Stack and bulge |
| 8 |
Motif group IL_42771.1
Basepair signature:
|
100.00 | 44.18 | 1 | 1 |
Multiple bulged bases |
| 9 |
Motif group IL_14688.1
Basepair signature:
|
100.00 | 43.65 | 4 | 1 |
Isolated non-canonical cWW pair |
| 10 |
Motif group IL_28037.2
Basepair signature:
|
100.00 | 40.84 | 3 | 1 |
Isolated non-canonical cWW pair |
Loop 10 Internal loop
Column numbers: 54-56, 86-89
Scored sequences and counts
CUU*GUUG 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_51387.2
Basepair signature:
|
100.00 | 69.15 | 1 | 0 |
|
| 2 |
Motif group IL_07785.1
Basepair signature:
|
100.00 | 49.77 | 1 | 0 |
Isolated non-canonical cWW pair |
| 3 |
Motif group IL_99358.1
Basepair signature:
|
100.00 | 46.04 | 2 | 1 |
|
| 4 |
Motif group IL_92446.2
Basepair signature:
|
100.00 | 5.02 | 2 | 1 |
|
| 5 |
Motif group IL_57744.1
Basepair signature:
|
100.00 | 2.58 | 3 | 1 |
Isolated non-canonical cWW pair |
| 6 |
Motif group IL_31737.3
Basepair signature:
|
100.00 | 0.10 | 4 | 1 |
Stack and bulge |
Loop 11 Internal loop
Column numbers: 59-65, 78-83
Scored sequences and counts
GGAUAAU*AGGAAC 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_47346.2
Basepair signature:
|
100.00 | 66.68 | 3 | 1 |
tSH-tSH-tHH-tHS |
| 2 |
Motif group IL_69543.3
Basepair signature:
|
100.00 | 20.45 | 6 | 3 |
|
| 3 |
Motif group IL_26307.2
Basepair signature:
|
100.00 | 20.39 | 6 | 3 |
7x6 Sarcin-Ricin; G-bulge |
| 4 |
Motif group IL_09044.1
Basepair signature:
|
100.00 | 18.29 | 5 | 2 |
|
| 5 |
Motif group IL_32016.1
Basepair signature:
|
100.00 | 13.67 | 7 | 3 |
Kink-turn |
| 6 |
Motif group IL_85536.2
Basepair signature:
|
100.00 | 7.37 | 5 | 3 |
|
| 7 |
Motif group IL_87284.1
Basepair signature:
|
100.00 | 6.46 | 6 | 2 |
tSH-tHW-tWH-tHS |
| 8 |
Motif group IL_78349.3
Basepair signature:
|
100.00 | 5.92 | 7 | 3 |
|
| 9 |
Motif group IL_06136.2
Basepair signature:
|
100.00 | 4.36 | 4 | 2 |
Quadruple sheared |
Loop 12 Hairpin loop
Column numbers: 68-75
Scored sequences and counts
GUUGACUC 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_20535.2
Basepair signature:
|
100.00 | 77.60 | 1 | 1 |
|
| 2 |
Motif group HL_77436.5
Basepair signature:
|
100.00 | 38.69 | 2 | 1 |
T-loop related |
| 3 |
Motif group HL_27670.2
Basepair signature:
|
100.00 | 37.35 | 2 | 2 |
T-loop with unstacked turn |
| 4 |
Motif group HL_84299.4
Basepair signature:
|
100.00 | 35.80 | 1 | 1 |
|
| 5 |
Motif group HL_25967.2
Basepair signature:
|
100.00 | 18.48 | 2 | 2 |
|
| 6 |
Motif group HL_50318.1
Basepair signature:
|
100.00 | 2.96 | 4 | 3 |
|
| 7 |
Motif group HL_20167.2
Basepair signature:
|
100.00 | 1.37 | 2 | 2 |
|
| 8 |
Motif group HL_10453.3
Basepair signature:
|
100.00 | 0.43 | 2 | 2 |
tRNA anticodon loop |
Loop 13 Internal loop
Column numbers: 165-170, 206-210
Scored sequences and counts
UAAAGU*GAUAG 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_68405.1
Basepair signature:
|
100.00 | 9.77 | 5 | 3 |
Kink-turn related |
Loop 14 Internal loop
Column numbers: 172-175, 203-204
Scored sequences and counts
ACAU*AU 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_22551.4
Basepair signature:
|
100.00 | 95.13 | 3 | 0 |
|
| 2 |
Motif group IL_95583.2
Basepair signature:
|
100.00 | 79.61 | 3 | 0 |
Minor groove platform, major groove intercalation |
| 3 |
Motif group IL_82107.4
Basepair signature:
|
100.00 | 78.84 | 3 | 0 |
Multiple bulged bases |
| 4 |
Motif group IL_15052.4
Basepair signature:
|
100.00 | 63.93 | 3 | 1 |
Minor groove platform |
| 5 |
Motif group IL_42626.2
Basepair signature:
|
100.00 | 62.84 | 2 | 1 |
|
| 6 |
Motif group IL_73452.2
Basepair signature:
|
100.00 | 54.80 | 5 | 1 |
|
| 7 |
Motif group IL_68140.4
Basepair signature:
|
100.00 | 51.82 | 1 | 1 |
Major groove minor groove platform; mini C-loop |
| 8 |
Motif group IL_73355.1
Basepair signature:
|
100.00 | 48.68 | 5 | 1 |
|
| 9 |
Motif group IL_81831.1
Basepair signature:
|
100.00 | 48.13 | 5 | 1 |
Intercalated cWS |
| 10 |
Motif group IL_00881.1
Basepair signature:
|
100.00 | 44.38 | 4 | 1 |
|
Loop 15 Internal loop
Column numbers: 176-178, 200-202
Scored sequences and counts
GGU*AGC 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_44465.1
Basepair signature:
|
100.00 | 96.19 | 2 | 0 |
Isolated non-canonical cWW contact |
| 2 |
Motif group IL_10167.6
Basepair signature:
|
100.00 | 90.34 | 0 | 0 |
Isolated cWH basepair |
| 3 |
Motif group IL_87907.2
Basepair signature:
|
100.00 | 60.94 | 1 | 0 |
Isolated non-canonical cWW pair |
| 4 |
Motif group IL_42997.3
Basepair signature:
|
100.00 | 36.39 | 3 | 1 |
Isolated cWS basepair |
| 5 |
Motif group IL_99358.1
Basepair signature:
|
100.00 | 19.33 | 2 | 1 |
|
| 6 |
Motif group IL_08770.1
Basepair signature:
|
100.00 | 14.80 | 4 | 2 |
|
| 7 |
Motif group IL_67095.2
Basepair signature:
|
100.00 | 14.56 | 4 | 2 |
Isolated tWW turn |
| 8 |
Motif group IL_57744.1
Basepair signature:
|
100.00 | 9.09 | 3 | 1 |
Isolated non-canonical cWW pair |
Loop 16 Hairpin loop
Column numbers: 184-194
Scored sequences and counts
CUAUGUUUAUG 2
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_93135.1
Basepair signature:
|
100.00 | 50.65 | 2 | 2 |
Pseudoknot |
| 2 |
Motif group HL_99769.3
Basepair signature:
|
100.00 | 27.87 | 5 | 3 |
|
| 3 |
Motif group HL_34964.1
Basepair signature:
|
100.00 | 17.33 | 6 | 4 |
|
| 4 |
Motif group HL_67079.1
Basepair signature:
|
100.00 | 16.24 | 5 | 3 |
|
| 5 |
Motif group HL_98252.1
Basepair signature:
|
100.00 | 4.75 | 5 | 3 |
|
| 6 |
Motif group HL_87463.1
Basepair signature:
|
100.00 | 4.17 | 5 | 3 |
|
| 7 |
Motif group HL_29762.1
Basepair signature:
|
100.00 | 0.05 | 5 | 4 |
|