RF01446 small nucleolar RNA snR95

Input Summary

      000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111122222222222222222222222
000000000111111111122222222223333333333444444444455555555556666666666777777777788888888889999999999000000000011111111112222222222333333333344444444445555555555666666666677777777778888888888999999999900000000001111111111222
123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012
........(((((((......((((..((((((((.(((.((((((((..(.((.((((.....((((......))))....))))..)).)..)..)))))))...)))))))..))))..).)))...))))))).....................(((((((....(((..((.(((((((.........))))))).)))))...)))))))......
>AB004535.1/423-644
UUUAACAACCAUGUUCACUUUCCACUUGAGAAGACACAAAAAUUGUCUUGUCGCUUUAGGAUAAUGUGUUGACUCGCAGGAACUAGUUGCAAUGAACGGCGAUUAAAUUGGUCUGUUUUUUUGUUGGUUAAGCAUGGUAGAUAACGUUUGUUCAAACAAUAGCUUAAAGUGACAUGGUUUUGCCUAUGUUUAUGGUAAAAGCAUCGAUAGAGCUGUACAUUU
>AB004534.1/35594-35815
UUUAACAACCAUGUUCACUUUCCACUUGAGAAGACACAAAAAUUGUCUUGUCGCUUUAGGAUAAUGUGUUGACUCGCAGGAACUAGUUGCAAUGAACGGCGAUUAAAUUGGUCUGUUUUUUUGUUGGUUAAGCAUGGUAGAUAACGUUUGUUCAAACAAUAGCUUAAAGUGACAUGGUUUUGCCUAUGUUUAUGGUAAAAGCAUCGAUAGAGCUGUACAUUU

There are no chains in PDB that we map to Rfam family RF01446.

Jump to results for:

  • Loop 1IL Column numbers: 15-22, 127-131
  • Loop 2IL Column numbers: 24-25, 123-125
  • Loop 3IL Column numbers: 25-28, 120-123
  • Loop 4IL Column numbers: 31-32, 114-117
  • Loop 5IL Column numbers: 35-37, 110-111
  • Loop 6IL Column numbers: 39-41, 104-108
  • Loop 7IL Column numbers: 47-48, 95-98
  • Loop 8IL Column numbers: 48-51, 92-95
  • Loop 9IL Column numbers: 51-53, 90-92
  • Loop 10IL Column numbers: 54-56, 86-89
  • Loop 11IL Column numbers: 59-65, 78-83
  • Loop 12HL Column numbers: 68-75
  • Loop 13IL Column numbers: 165-170, 206-210
  • Loop 14IL Column numbers: 172-175, 203-204
  • Loop 15IL Column numbers: 176-178, 200-202
  • Loop 16HL Column numbers: 184-194

Loop 1 Internal loop

Column numbers: 15-22, 127-131
    Scored sequences and counts
UCACUUUC*GUUAA 2
No Matches Found View All Results for this Loop

Loop 2 Internal loop

Column numbers: 24-25, 123-125
    Scored sequences and counts
AC*GUU 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 99.22 2 0

Intercalated cWS

2 100.00 97.14 2 0

3 100.00 92.59 0 0

Single bulged U

4 100.00 90.82 1 0

Single stack bend

5 100.00 81.88 2 0

6 100.00 78.62 2 0

Major groove platform

7 100.00 77.51 3 0

Single stack bend

8 100.00 68.02 3 0

Major groove platform

9 100.00 64.64 5 1

Multiple bulged bases

10 100.00 62.57 5 1

Loop 3 Internal loop

Column numbers: 25-28, 120-123
    Scored sequences and counts
CUUG*UUUG 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 83.62 1 0

Tandem non-canonical cWW pairs

2 100.00 65.26 3 0

Tandem non-canonical cWW pairs

3 100.00 60.87 1 0

4 100.00 29.36 4 1

5 100.00 27.52 4 1

6 100.00 24.60 5 1

Major groove minor groove platform with intercalation; mini C-loop

7 100.00 19.95 5 2

Loop 4 Internal loop

Column numbers: 31-32, 114-117
    Scored sequences and counts
AA*UGUU 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 88.79 1 0

Major groove platform; stack outside cWW

2 100.00 87.98 2 0

Major groove intercalation

3 100.00 73.51 2 0

Multiple bulged bases

4 100.00 55.38 3 1

5 100.00 49.37 4 1

6 100.00 45.96 4 1

7 100.00 43.49 4 1

8 100.00 37.21 4 1

Intercalated cWS

9 100.00 36.14 4 1

10 100.00 26.79 3 1

Multiple bulged bases

Loop 5 Internal loop

Column numbers: 35-37, 110-111
    Scored sequences and counts
CAC*GG 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 100.00 0 0

2 100.00 100.00 0 0

Major groove platform

3 100.00 100.00 0 0

Minor groove platform

4 100.00 97.31 2 0

Multiple bulged bases

5 100.00 96.13 3 0

Single stack bend

6 100.00 92.67 0 0

Single bulged A

7 100.00 91.56 2 0

Single stack bend

8 100.00 88.60 1 0

Major groove intercalation

9 100.00 86.90 2 0

Stack and bulge

10 100.00 73.46 3 0

Major groove platform

Loop 6 Internal loop

Column numbers: 39-41, 104-108
    Scored sequences and counts
AAA*UAAAU 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 78.93 4 0

2 100.00 55.73 5 1

3 100.00 54.92 5 1

4 100.00 49.17 4 1

5 100.00 40.27 5 1

6 100.00 31.85 3 1

7 100.00 31.12 5 1

Stack and bulge

8 100.00 29.35 6 2

9 100.00 28.43 4 2

10 100.00 27.30 4 1

Loop 7 Internal loop

Column numbers: 47-48, 95-98
    Scored sequences and counts
CU*AACG 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 100.00 0 0

2 100.00 93.57 3 0

3 100.00 76.47 3 0

Multiple bulged bases

4 100.00 66.37 5 1

5 100.00 55.02 3 0

Minor groove platform

6 100.00 48.91 3 1

Intercalated cWS

7 100.00 48.76 4 1

8 100.00 44.63 4 1

9 100.00 43.81 3 1

Minor groove platform, major groove intercalation

10 100.00 40.82 3 1

Minor groove platform

Loop 8 Internal loop

Column numbers: 48-51, 92-95
    Scored sequences and counts
UUGU*AUGA 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 56.24 3 1

2 100.00 9.24 4 2

Intercalated tWH

Loop 9 Internal loop

Column numbers: 51-53, 90-92
    Scored sequences and counts
UCG*CAA 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 98.60 0 0

Isolated tWW turn

2 100.00 87.80 0 0

Isolated non-canonical cWW pair

3 100.00 79.24 1 0

Isolated cWS basepair

4 100.00 73.16 3 1

5 100.00 68.28 3 0

Isolated non-canonical cWW pair

6 100.00 62.69 2 1

Isolated non-canonical cWW pair

7 100.00 55.95 3 1

Stack and bulge

8 100.00 44.18 1 1

Multiple bulged bases

9 100.00 43.65 4 1

Isolated non-canonical cWW pair

10 100.00 40.84 3 1

Isolated non-canonical cWW pair

Loop 10 Internal loop

Column numbers: 54-56, 86-89
    Scored sequences and counts
CUU*GUUG 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 69.15 1 0

2 100.00 49.77 1 0

Isolated non-canonical cWW pair

3 100.00 46.04 2 1

4 100.00 5.02 2 1

5 100.00 2.58 3 1

Isolated non-canonical cWW pair

6 100.00 0.10 4 1

Stack and bulge

Loop 11 Internal loop

Column numbers: 59-65, 78-83
    Scored sequences and counts
GGAUAAU*AGGAAC 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 66.68 3 1

tSH-tSH-tHH-tHS

2 100.00 20.45 6 3

3 100.00 20.39 6 3

7x6 Sarcin-Ricin; G-bulge

4 100.00 18.29 5 2

5 100.00 13.67 7 3

Kink-turn

6 100.00 7.37 5 3

7 100.00 6.46 6 2

tSH-tHW-tWH-tHS

8 100.00 5.92 7 3

9 100.00 4.36 4 2

Quadruple sheared

Loop 12 Hairpin loop

Column numbers: 68-75
    Scored sequences and counts
GUUGACUC 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 77.60 1 1

2 100.00 38.69 2 1

T-loop related

3 100.00 37.35 2 2

T-loop with unstacked turn

4 100.00 35.80 1 1

5 100.00 18.48 2 2

6 100.00 2.96 4 3

7 100.00 1.37 2 2

8 100.00 0.43 2 2

tRNA anticodon loop

Loop 13 Internal loop

Column numbers: 165-170, 206-210
    Scored sequences and counts
UAAAGU*GAUAG 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 9.77 5 3

Kink-turn related

Loop 14 Internal loop

Column numbers: 172-175, 203-204
    Scored sequences and counts
ACAU*AU 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 95.13 3 0

2 100.00 79.61 3 0

Minor groove platform, major groove intercalation

3 100.00 78.84 3 0

Multiple bulged bases

4 100.00 63.93 3 1

Minor groove platform

5 100.00 62.84 2 1

6 100.00 54.80 5 1

7 100.00 51.82 1 1

Major groove minor groove platform; mini C-loop

8 100.00 48.68 5 1

9 100.00 48.13 5 1

Intercalated cWS

10 100.00 44.38 4 1

Loop 15 Internal loop

Column numbers: 176-178, 200-202
    Scored sequences and counts
GGU*AGC 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 96.19 2 0

Isolated non-canonical cWW contact

2 100.00 90.34 0 0

Isolated cWH basepair

3 100.00 60.94 1 0

Isolated non-canonical cWW pair

4 100.00 36.39 3 1

Isolated cWS basepair

5 100.00 19.33 2 1

6 100.00 14.80 4 2

7 100.00 14.56 4 2

Isolated tWW turn

8 100.00 9.09 3 1

Isolated non-canonical cWW pair

Loop 16 Hairpin loop

Column numbers: 184-194
    Scored sequences and counts
CUAUGUUUAUG 2
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 50.65 2 2

Pseudoknot

2 100.00 27.87 5 3

3 100.00 17.33 6 4

4 100.00 16.24 5 3

5 100.00 4.75 5 3

6 100.00 4.17 5 3

7 100.00 0.05 5 4

Coloring options: