JAR3D
Query RF01407-CCF-3.98 completed
Run on Motif Atlas Version 3.98
using the CaCoFold secondary structure. Run with the Rfam secondary structure.
RF01407 STnc560 Hfq binding RNA
Input Summary
0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111222222222222222222222
0000000001111111111222222222233333333334444444444555555555566666666667777777777888888888899999999990000000000111111111122222222223333333333444444444455555555556666666666777777777788888888889999999999000000000011111111112
1234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890
............(((((((((.....((.(((.((....(((((((((.((........))))))))))).....))..)))))........................)))))))))...((((((.........))))))........(....(((((((((((((......)).))))))))))))....(((.(((.....))))))..........
>AE005174.2_1939628-1939841
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>AE014075.1_1805101-1804887
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGUUUUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>CP000034.1_1455774-1455986
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU--UUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>CP000266.1_1628757-1628544
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>CP000036.1_1598345-1598558
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUUCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>CP000038.1_1675303-1675516
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAGGUGAUG
>ABAN01000003.1_243628-243410
GCUUCAUUGAUAUUGACGGUGCUACAGUCGUUAGCGAUCCGUUAUCCUCGCAAGAAUUUGCCCGGUAGCGUAUAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUUACCGCUGGUGAACCGGCGGU-UUUUUUUGCCUGCCAUCCAGACAAAAGCGGCCCCUUGCGCAACGAUGCAGCAAGGGGCCGGCUCUGCGAGGGAUUAUCUCCGUUCAUUAAUCA
>CP000468.1_1667136-1666923
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>CP000970.1_1619937-1620150
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAGUUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>AP009048.1_1624662-1624449
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUUCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>FM180568.1_1719664-1719451
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>AE005674.2_1592783-1592995
CUUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU--UUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
There are no chains in PDB that we map to Rfam family RF01407.
Jump to results for:
- Loop 1IL Column numbers: 21-27, 84-109
- Loop 2IL Column numbers: 28-30, 82-83
- Loop 3IL Column numbers: 32-34, 77-80
- Loop 4IL Column numbers: 35-40, 70-76
- Loop 5IL Column numbers: 48-50, 61-62
- Loop 6HL Column numbers: 51-60
- Loop 7HL Column numbers: 126-136
- Loop 8IL Column numbers: 150-155, 187-188
- Loop 9IL Column numbers: 165-166, 175-177
- Loop 10HL Column numbers: 167-174
- Loop 11IL Column numbers: 195-197, 207-208
- Loop 12HL Column numbers: 199-205
Loop 1 Internal loop
Column numbers: 21-27, 84-109
Scored sequences and counts
GCUACUG*CAAAUCUAUCCAUGCAAGCAUUCACC 11
GCUACAG*CAAAUCUAUCCAUGCAAGCAUUUACC 1
No Matches Found
View All Results for this LoopLoop 2 Internal loop
Column numbers: 28-30, 82-83
Scored sequences and counts
U-G*CA 11
UCG*CA 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_07039.3
Basepair signature:
|
100.00 | 27.79 | 2 | 1 |
Major groove platform |
| 2 |
Motif group IL_42771.1
Basepair signature:
|
100.00 | 27.00 | 3 | 1 |
Multiple bulged bases |
| 3 |
Motif group IL_81831.1
Basepair signature:
|
100.00 | 25.84 | 2 | 1 |
Intercalated cWS |
| 4 |
Motif group IL_73452.2
Basepair signature:
|
100.00 | 25.14 | 3 | 1 |
|
| 5 |
Motif group IL_26793.1
Basepair signature:
|
100.00 | 24.11 | 1 | 1 |
Single stack bend |
| 6 |
Motif group IL_66635.5
Basepair signature:
|
100.00 | 18.61 | 2 | 1 |
Major groove intercalation |
| 7 |
Motif group IL_90729.1
Basepair signature:
|
100.00 | 18.38 | 2 | 1 |
Single stack bend |
| 8 |
Motif group IL_61258.15
Basepair signature:
|
100.00 | 17.35 | 1 | 1 |
Single bulged C |
| 9 |
Motif group IL_16386.4
Basepair signature:
|
100.00 | 15.99 | 3 | 1 |
|
| 10 |
Motif group IL_33761.2
Basepair signature:
|
100.00 | 10.14 | 4 | 1 |
|
Loop 3 Internal loop
Column numbers: 32-34, 77-80
Scored sequences and counts
CAA*CAAA 11
UAG*CAAA 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_41344.1
Basepair signature:
|
100.00 | 79.44 | 3 | 0 |
|
| 2 |
Motif group IL_55516.2
Basepair signature:
|
100.00 | 64.37 | 3 | 0 |
|
| 3 |
Motif group IL_31531.3
Basepair signature:
|
100.00 | 61.71 | 3 | 0 |
Decoding loop related |
| 4 |
Motif group IL_31737.3
Basepair signature:
|
100.00 | 51.44 | 3 | 0 |
Stack and bulge |
| 5 |
Motif group IL_08770.1
Basepair signature:
|
100.00 | 48.43 | 3 | 0 |
|
| 6 |
Motif group IL_57744.1
Basepair signature:
|
100.00 | 46.50 | 3 | 0 |
Isolated non-canonical cWW pair |
| 7 |
Motif group IL_90351.1
Basepair signature:
|
100.00 | 39.49 | 3 | 0 |
|
| 8 |
Motif group IL_83389.2
Basepair signature:
|
100.00 | 24.74 | 4 | 1 |
|
| 9 |
Motif group IL_15698.3
Basepair signature:
|
100.00 | 12.38 | 4 | 1 |
|
| 10 |
Motif group IL_14688.1
Basepair signature:
|
100.00 | 10.52 | 5 | 1 |
Isolated non-canonical cWW pair |
Loop 4 Internal loop
Column numbers: 35-40, 70-76
Scored sequences and counts
CGAUCC*GUAAAAG 9
CGAUUC*GUAAAAG 2
CGAUCC*GUAUAAG 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_16458.4
Basepair signature:
|
83.33 | 1.05 | 7 | 3 |
Sarcin-Ricin target in LSU H95; G-bulge |
| 2 |
Motif group IL_26307.2
Basepair signature:
|
83.33 | -3.25 | 4 | 3 |
7x6 Sarcin-Ricin; G-bulge |
| 3 |
Motif group IL_24254.1
Basepair signature:
|
16.67 | -23.39 | 8 | 4 |
7x6 Sarcin-Ricin with UU cWW pair; G-bulge |
Loop 5 Internal loop
Column numbers: 48-50, 61-62
Scored sequences and counts
GUG*CC 11
UCG*CC 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_81831.1
Basepair signature:
|
100.00 | 93.89 | 2 | 0 |
Intercalated cWS |
| 2 |
Motif group IL_73452.2
Basepair signature:
|
100.00 | 92.41 | 2 | 0 |
|
| 3 |
Motif group IL_90729.1
Basepair signature:
|
100.00 | 91.97 | 0 | 0 |
Single stack bend |
| 4 |
Motif group IL_26793.1
Basepair signature:
|
100.00 | 78.05 | 1 | 0 |
Single stack bend |
| 5 |
Motif group IL_33761.2
Basepair signature:
|
100.00 | 76.24 | 2 | 0 |
|
| 6 |
Motif group IL_07039.3
Basepair signature:
|
100.00 | 67.81 | 3 | 0 |
Major groove platform |
| 7 |
Motif group IL_42771.1
Basepair signature:
|
100.00 | 61.06 | 3 | 1 |
Multiple bulged bases |
| 8 |
Motif group IL_66635.5
Basepair signature:
|
100.00 | 60.86 | 1 | 1 |
Major groove intercalation |
| 9 |
Motif group IL_48076.6
Basepair signature:
|
100.00 | 51.01 | 2 | 0 |
Major groove platform |
| 10 |
Motif group IL_16386.4
Basepair signature:
|
100.00 | 40.79 | 3 | 1 |
|
Loop 6 Hairpin loop
Column numbers: 51-60
Scored sequences and counts
CAGGAAAAUG 11
CAAGAAUUUG 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_36335.1
Basepair signature:
|
100.00 | 22.78 | 3 | 3 |
|
| 2 |
Motif group HL_57863.1
Basepair signature:
|
100.00 | 13.89 | 5 | 3 |
G-quadruplex fragment |
| 3 |
Motif group HL_93438.2
Basepair signature:
|
91.67 | 27.67 | 2 | 2 |
|
| 4 |
Motif group HL_75293.5
Basepair signature:
|
91.67 | 0.30 | 3 | 3 |
|
| 5 |
Motif group HL_73255.1
Basepair signature:
|
8.33 | -9.42 | 4 | 4 |
|
Loop 7 Hairpin loop
Column numbers: 126-136
Scored sequences and counts
U-UUUUUUUCG 8
U--UUUUUUCG 2
UUUUUUUUUCG 1
U-UUUUUUUGC 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_69139.1
Basepair signature:
|
75.00 | 6.75 | 3 | 3 |
|
| 2 |
Motif group HL_25061.1
Basepair signature:
|
16.67 | -13.61 | 4 | 3 |
|
| 3 |
Motif group HL_98252.1
Basepair signature:
|
8.33 | -10.87 | 5 | 3 |
|
Loop 8 Internal loop
Column numbers: 150-155, 187-188
Scored sequences and counts
C----A*GG 11
AAAAGC*GG 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_84476.1
Basepair signature:
|
91.67 | -11.20 | 2 | 2 |
Multiple bulged bases |
Loop 9 Internal loop
Column numbers: 165-166, 175-177
Scored sequences and counts
UA*UAA 11
CG*CAG 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_42771.1
Basepair signature:
|
100.00 | 99.83 | 2 | 0 |
Multiple bulged bases |
| 2 |
Motif group IL_10569.1
Basepair signature:
|
100.00 | 96.68 | 2 | 0 |
|
| 3 |
Motif group IL_26793.1
Basepair signature:
|
100.00 | 96.03 | 2 | 0 |
Single stack bend |
| 4 |
Motif group IL_90729.1
Basepair signature:
|
100.00 | 90.65 | 2 | 0 |
Single stack bend |
| 5 |
Motif group IL_48076.6
Basepair signature:
|
100.00 | 89.98 | 1 | 0 |
Major groove platform |
| 6 |
Motif group IL_33761.2
Basepair signature:
|
100.00 | 87.31 | 4 | 0 |
|
| 7 |
Motif group IL_66635.5
Basepair signature:
|
100.00 | 84.96 | 2 | 0 |
Major groove intercalation |
| 8 |
Motif group IL_31462.6
Basepair signature:
|
100.00 | 83.33 | 0 | 0 |
Single bulged A |
| 9 |
Motif group IL_31737.3
Basepair signature:
|
100.00 | 82.72 | 3 | 0 |
Stack and bulge |
| 10 |
Motif group IL_51454.3
Basepair signature:
|
100.00 | 81.18 | 0 | 0 |
Minor groove platform |
Loop 10 Hairpin loop
Column numbers: 167-174
Scored sequences and counts
CACAACUG 10
CAACGAUG 1
CACAGUUG 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_39243.1
Basepair signature:
|
91.67 | 18.81 | 4 | 2 |
|
| 2 |
Motif group HL_20535.2
Basepair signature:
|
91.67 | 5.73 | 5 | 3 |
|
| 3 |
Motif group HL_13529.1
Basepair signature:
|
83.33 | -3.08 | 3 | 2 |
|
| 4 |
Motif group HL_04259.3
Basepair signature:
|
83.33 | -3.40 | 4 | 2 |
GNRA with extra cWW |
| 5 |
Motif group HL_22622.1
Basepair signature:
|
16.67 | -28.75 | 4 | 4 |
|
| 6 |
Motif group HL_53890.2
Basepair signature:
|
8.33 | -14.99 | 2 | 2 |
|
| 7 |
Motif group HL_47854.1
Basepair signature:
|
8.33 | -16.73 | 5 | 3 |
|
| 8 |
Motif group HL_99748.1
Basepair signature:
|
8.33 | -30.79 | 4 | 4 |
Other HL |
| 9 |
Motif group HL_04641.1
Basepair signature:
|
8.33 | -57.01 | 5 | 5 |
|
| 10 |
Motif group HL_50006.2
Basepair signature:
|
8.33 | -60.36 | 4 | 4 |
|
Loop 11 Internal loop
Column numbers: 195-197, 207-208
Scored sequences and counts
GAG*CC 12
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_26793.1
Basepair signature:
|
100.00 | 100.00 | 0 | 0 |
Single stack bend |
| 2 |
Motif group IL_31462.6
Basepair signature:
|
100.00 | 100.00 | 0 | 0 |
Single bulged A |
| 3 |
Motif group IL_90729.1
Basepair signature:
|
100.00 | 100.00 | 0 | 0 |
Single stack bend |
| 4 |
Motif group IL_10569.1
Basepair signature:
|
100.00 | 99.41 | 2 | 0 |
|
| 5 |
Motif group IL_42771.1
Basepair signature:
|
100.00 | 96.85 | 2 | 0 |
Multiple bulged bases |
| 6 |
Motif group IL_66635.5
Basepair signature:
|
100.00 | 93.80 | 1 | 0 |
Major groove intercalation |
| 7 |
Motif group IL_33761.2
Basepair signature:
|
100.00 | 87.35 | 3 | 0 |
|
| 8 |
Motif group IL_31737.3
Basepair signature:
|
100.00 | 86.52 | 1 | 0 |
Stack and bulge |
| 9 |
Motif group IL_48076.6
Basepair signature:
|
100.00 | 80.96 | 2 | 0 |
Major groove platform |
| 10 |
Motif group IL_07039.3
Basepair signature:
|
100.00 | 75.28 | 3 | 0 |
Major groove platform |
Loop 12 Hairpin loop
Column numbers: 199-205
Scored sequences and counts
GAUUAUC 12
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_57875.1
Basepair signature:
|
100.00 | 83.87 | 2 | 0 |
|
| 2 |
Motif group HL_50318.1
Basepair signature:
|
100.00 | 83.14 | 4 | 2 |
|
| 3 |
Motif group HL_48417.5
Basepair signature:
|
100.00 | 80.27 | 1 | 0 |
|
| 4 |
Motif group HL_80922.2
Basepair signature:
|
100.00 | 68.42 | 1 | 1 |
|
| 5 |
Motif group HL_25967.2
Basepair signature:
|
100.00 | 62.14 | 1 | 1 |
|
| 6 |
Motif group HL_56131.2
Basepair signature:
|
100.00 | 56.44 | 3 | 1 |
|
| 7 |
Motif group HL_20535.2
Basepair signature:
|
100.00 | 54.68 | 2 | 2 |
|
| 8 |
Motif group HL_43517.1
Basepair signature:
|
100.00 | 36.89 | 1 | 1 |
|
| 9 |
Motif group HL_77436.5
Basepair signature:
|
100.00 | 25.93 | 2 | 2 |
T-loop related |
| 10 |
Motif group HL_28075.1
Basepair signature:
|
100.00 | 24.88 | 2 | 2 |
|