RF01407 STnc560 Hfq binding RNA

Input Summary

      0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111222222222222222222222
0000000001111111111222222222233333333334444444444555555555566666666667777777777888888888899999999990000000000111111111122222222223333333333444444444455555555556666666666777777777788888888889999999999000000000011111111112
1234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890
.................(((((....)).))).......(((((.(((.(((......)))))).)))))....................................((((((((....))))))))......................((.....(((((((((((((....))).))))))))))))................................
>AE005174.2/1939628-1939841
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>AE014075.1/1805101-1804887
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGUUUUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>CP000034.1/1455774-1455986
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU--UUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>CP000266.1/1628757-1628544
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>CP000036.1/1598345-1598558
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUUCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>CP000038.1/1675303-1675516
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAGGUGAUG
>ABAN01000003.1/243628-243410
GCUUCAUUGAUAUUGACGGUGCUACAGUCGUUAGCGAUCCGUUAUCCUCGCAAGAAUUUGCCCGGUAGCGUAUAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUUACCGCUGGUGAACCGGCGGU-UUUUUUUGCCUGCCAUCCAGACAAAAGCGGCCCCUUGCGCAACGAUGCAGCAAGGGGCCGGCUCUGCGAGGGAUUAUCUCCGUUCAUUAAUCA
>CP000468.1/1667136-1666923
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>CP000970.1/1619937-1620150
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAGUUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>AP009048.1/1624662-1624449
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUUCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>FM180568.1/1719664-1719451
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>AE005674.2/1592783-1592995
CUUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU--UUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA

There are no chains in PDB that we map to Rfam family RF01407.

Jump to results for:

  • Loop 1IL Column numbers: 20-21, 28-30
  • Loop 2HL Column numbers: 22-27
  • Loop 3IL Column numbers: 44-46, 64-66
  • Loop 4IL Column numbers: 48-50, 61-62
  • Loop 5HL Column numbers: 52-59
  • Loop 6HL Column numbers: 114-119
  • Loop 7IL Column numbers: 150-156, 186-187
  • Loop 8IL Column numbers: 165-166, 175-177
  • Loop 9HL Column numbers: 168-173

Loop 1 Internal loop

Column numbers: 20-21, 28-30
    Scored sequences and counts
UG*U-G 11
UG*UCG 1
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 35.77 1 1

Major groove platform

2 8.33 -5.38 2 1

Major groove intercalation

3 8.33 -5.69 1 1

Single bulged G

4 8.33 -6.92 3 1

Multiple bulged bases

5 8.33 -9.70 3 1

Intercalated cWS

6 8.33 -14.37 3 1

7 8.33 -19.84 3 1

8 8.33 -20.80 4 1

Stack and bulge

9 8.33 -22.62 2 1

Single stack bend

10 8.33 -23.19 2 1

Single stack bend

Loop 2 Hairpin loop

Column numbers: 22-27
    Scored sequences and counts
CUACUG 11
CUACAG 1
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 36.55 1 1

UNCG

2 100.00 30.18 1 1

3 100.00 26.10 3 1

4 100.00 24.06 1 1

Mini UNCG

5 100.00 24.00 2 2

6 100.00 19.58 2 2

7 100.00 17.39 2 2

tRNA D-loop

8 100.00 11.64 2 2

9 100.00 9.67 3 2

10 100.00 8.36 2 2

Loop 3 Internal loop

Column numbers: 44-46, 64-66
    Scored sequences and counts
AUC*GUU 11
AUC*GGU 1
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 94.53 2 0

Isolated non-canonical cWW pair

2 100.00 91.99 0 0

Isolated non-canonical cWW pair

3 100.00 88.63 3 0

Multiple bulged bases

4 100.00 86.54 2 0

Isolated non-canonical cWW pair

5 100.00 81.86 2 0

Isolated cWS basepair

6 100.00 73.94 2 0

Stack and bulge

7 100.00 61.15 2 0

Isolated non-canonical cWW contact

8 100.00 57.94 3 1

9 100.00 51.48 2 0

Isolated cWH basepair

10 100.00 44.72 2 1

Isolated non-canonical cWW pair

Loop 4 Internal loop

Column numbers: 48-50, 61-62
    Scored sequences and counts
GUG*CC 11
UCG*CC 1
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 93.89 2 0

Intercalated cWS

2 100.00 92.41 2 0

3 100.00 91.97 0 0

Single stack bend

4 100.00 78.05 1 0

Single stack bend

5 100.00 76.24 2 0

6 100.00 67.81 3 0

Major groove platform

7 100.00 61.06 3 1

Multiple bulged bases

8 100.00 60.86 1 1

Major groove intercalation

9 100.00 51.01 2 0

Major groove platform

10 100.00 40.79 3 1

Loop 5 Hairpin loop

Column numbers: 52-59
    Scored sequences and counts
AGGAAAAU 11
AAGAAUUU 1
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 58.83 3 1

GNRA with extra cWW

2 91.67 31.98 4 2

3 91.67 31.82 4 2

4 91.67 30.17 2 2

5 91.67 26.16 3 1

Pseudoknot geometry

6 91.67 22.75 4 2

7 91.67 21.21 3 1

8 91.67 12.58 4 2

9 91.67 12.38 4 2

GNRA with tandem sheared

10 91.67 11.58 2 2

Loop 6 Hairpin loop

Column numbers: 114-119
    Scored sequences and counts
GUUUAC 11
GUGAAC 1
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 58.90 3 1

2 100.00 57.13 3 1

3 100.00 56.97 1 1

4 100.00 55.81 2 1

5 100.00 54.04 2 1

6 100.00 53.25 3 1

Mini UNCG

7 100.00 28.81 4 2

8 100.00 20.01 3 2

tRNA D-loop

9 100.00 16.20 3 2

10 100.00 12.37 2 2

Loop 7 Internal loop

Column numbers: 150-156, 186-187
    Scored sequences and counts
C----AG*CG 11
AAAAGCG*CG 1
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 91.67 66.58 0 0

Minor groove platform

2 91.67 62.23 1 0

Single stack bend

3 91.67 61.67 1 0

Single stack bend

4 91.67 59.92 2 0

Major groove intercalation

5 91.67 57.47 0 0

Single bulged A

6 91.67 57.39 0 0

Major groove platform

7 91.67 56.01 2 0

8 91.67 52.05 1 1

9 91.67 47.86 2 0

Stack and bulge

10 91.67 47.85 2 0

Major groove platform

Loop 8 Internal loop

Column numbers: 165-166, 175-177
    Scored sequences and counts
UA*UAA 11
CG*CAG 1
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 99.83 2 0

Multiple bulged bases

2 100.00 96.68 2 0

3 100.00 96.03 2 0

Single stack bend

4 100.00 90.65 2 0

Single stack bend

5 100.00 89.98 1 0

Major groove platform

6 100.00 87.31 4 0

7 100.00 84.96 2 0

Major groove intercalation

8 100.00 83.33 0 0

Single bulged A

9 100.00 82.72 3 0

Stack and bulge

10 100.00 81.18 0 0

Minor groove platform

Loop 9 Hairpin loop

Column numbers: 168-173
    Scored sequences and counts
ACAACU 10
AACGAU 1
ACAGUU 1
Click on headings to reorder table - View All Results for this Loop
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 100.00 51.70 2 1

2 100.00 35.73 3 1

Pseudoknot geometry with 3' bulge

3 91.67 28.52 4 2

4 91.67 16.58 4 2

5 83.33 47.29 3 1

6 83.33 32.42 4 2

7 83.33 11.18 3 2

8 83.33 2.36 2 1

GNRA

9 16.67 -13.99 4 2

10 16.67 -18.49 3 2

Coloring options: