JAR3D
Query RF01407-3.98 completed
Run on Motif Atlas Version 3.98
using the Rfam secondary structure. Run with the CaCoFold secondary structure.
RF01407 STnc560 Hfq binding RNA
Input Summary
0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111222222222222222222222
0000000001111111111222222222233333333334444444444555555555566666666667777777777888888888899999999990000000000111111111122222222223333333333444444444455555555556666666666777777777788888888889999999999000000000011111111112
1234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890
.................(((((....)).))).......(((((.(((.(((......)))))).)))))....................................((((((((....))))))))......................((.....(((((((((((((....))).))))))))))))................................
>AE005174.2/1939628-1939841
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>AE014075.1/1805101-1804887
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGUUUUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>CP000034.1/1455774-1455986
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU--UUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>CP000266.1/1628757-1628544
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>CP000036.1/1598345-1598558
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUUCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>CP000038.1/1675303-1675516
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAGGUGAUG
>ABAN01000003.1/243628-243410
GCUUCAUUGAUAUUGACGGUGCUACAGUCGUUAGCGAUCCGUUAUCCUCGCAAGAAUUUGCCCGGUAGCGUAUAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUUACCGCUGGUGAACCGGCGGU-UUUUUUUGCCUGCCAUCCAGACAAAAGCGGCCCCUUGCGCAACGAUGCAGCAAGGGGCCGGCUCUGCGAGGGAUUAUCUCCGUUCAUUAAUCA
>CP000468.1/1667136-1666923
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>CP000970.1/1619937-1620150
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAGUUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>AP009048.1/1624662-1624449
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUUCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>FM180568.1/1719664-1719451
CAUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU-UUUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
>AE005674.2/1592783-1592995
CUUUCAUUGAGAAAACUGAUGCUACUGU-GUCAACGAUCCGUUAUCAGUGCAGGAAAAUGCCUGUUAGCGUAAAAGCAAAACACAAAUCUAUCCAUGCAAGCAUUCACCGCCGGUUUACUGGCGGU--UUUUUUCGCCGUCAUAAAAAUC----AGGCCCCUUGUACACAACUGUAACAAGGGGCCGGUUAGGUGAGGGAUUAUCUCCGUUCAUUAGUCA
There are no chains in PDB that we map to Rfam family RF01407.
Jump to results for:
- Loop 1IL Column numbers: 20-21, 28-30
- Loop 2HL Column numbers: 22-27
- Loop 3IL Column numbers: 44-46, 64-66
- Loop 4IL Column numbers: 48-50, 61-62
- Loop 5HL Column numbers: 52-59
- Loop 6HL Column numbers: 114-119
- Loop 7IL Column numbers: 150-156, 186-187
- Loop 8IL Column numbers: 165-166, 175-177
- Loop 9HL Column numbers: 168-173
Loop 1 Internal loop
Column numbers: 20-21, 28-30
Scored sequences and counts
UG*U-G 11
UG*UCG 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_07039.3
Basepair signature:
|
100.00 | 35.77 | 1 | 1 |
Major groove platform |
| 2 |
Motif group IL_66635.5
Basepair signature:
|
8.33 | -5.38 | 2 | 1 |
Major groove intercalation |
| 3 |
Motif group IL_00225.13
Basepair signature:
|
8.33 | -5.69 | 1 | 1 |
Single bulged G |
| 4 |
Motif group IL_42771.1
Basepair signature:
|
8.33 | -6.92 | 3 | 1 |
Multiple bulged bases |
| 5 |
Motif group IL_81831.1
Basepair signature:
|
8.33 | -9.70 | 3 | 1 |
Intercalated cWS |
| 6 |
Motif group IL_33761.2
Basepair signature:
|
8.33 | -14.37 | 3 | 1 |
|
| 7 |
Motif group IL_73452.2
Basepair signature:
|
8.33 | -19.84 | 3 | 1 |
|
| 8 |
Motif group IL_31737.3
Basepair signature:
|
8.33 | -20.80 | 4 | 1 |
Stack and bulge |
| 9 |
Motif group IL_26793.1
Basepair signature:
|
8.33 | -22.62 | 2 | 1 |
Single stack bend |
| 10 |
Motif group IL_90729.1
Basepair signature:
|
8.33 | -23.19 | 2 | 1 |
Single stack bend |
Loop 2 Hairpin loop
Column numbers: 22-27
Scored sequences and counts
CUACUG 11
CUACAG 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_34617.5
Basepair signature:
|
100.00 | 36.55 | 1 | 1 |
UNCG |
| 2 |
Motif group HL_75660.5
Basepair signature:
|
100.00 | 30.18 | 1 | 1 |
|
| 3 |
Motif group HL_82710.2
Basepair signature:
|
100.00 | 26.10 | 3 | 1 |
|
| 4 |
Motif group HL_48778.2
Basepair signature:
|
100.00 | 24.06 | 1 | 1 |
Mini UNCG |
| 5 |
Motif group HL_53890.2
Basepair signature:
|
100.00 | 24.00 | 2 | 2 |
|
| 6 |
Motif group HL_50006.2
Basepair signature:
|
100.00 | 19.58 | 2 | 2 |
|
| 7 |
Motif group HL_38901.2
Basepair signature:
|
100.00 | 17.39 | 2 | 2 |
tRNA D-loop |
| 8 |
Motif group HL_43517.1
Basepair signature:
|
100.00 | 11.64 | 2 | 2 |
|
| 9 |
Motif group HL_99040.1
Basepair signature:
|
100.00 | 9.67 | 3 | 2 |
|
| 10 |
Motif group HL_48417.5
Basepair signature:
|
100.00 | 8.36 | 2 | 2 |
|
Loop 3 Internal loop
Column numbers: 44-46, 64-66
Scored sequences and counts
AUC*GUU 11
AUC*GGU 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_07785.1
Basepair signature:
|
100.00 | 94.53 | 2 | 0 |
Isolated non-canonical cWW pair |
| 2 |
Motif group IL_28037.2
Basepair signature:
|
100.00 | 91.99 | 0 | 0 |
Isolated non-canonical cWW pair |
| 3 |
Motif group IL_42771.1
Basepair signature:
|
100.00 | 88.63 | 3 | 0 |
Multiple bulged bases |
| 4 |
Motif group IL_87907.2
Basepair signature:
|
100.00 | 86.54 | 2 | 0 |
Isolated non-canonical cWW pair |
| 5 |
Motif group IL_42997.3
Basepair signature:
|
100.00 | 81.86 | 2 | 0 |
Isolated cWS basepair |
| 6 |
Motif group IL_31737.3
Basepair signature:
|
100.00 | 73.94 | 2 | 0 |
Stack and bulge |
| 7 |
Motif group IL_44465.1
Basepair signature:
|
100.00 | 61.15 | 2 | 0 |
Isolated non-canonical cWW contact |
| 8 |
Motif group IL_08770.1
Basepair signature:
|
100.00 | 57.94 | 3 | 1 |
|
| 9 |
Motif group IL_10167.6
Basepair signature:
|
100.00 | 51.48 | 2 | 0 |
Isolated cWH basepair |
| 10 |
Motif group IL_14688.1
Basepair signature:
|
100.00 | 44.72 | 2 | 1 |
Isolated non-canonical cWW pair |
Loop 4 Internal loop
Column numbers: 48-50, 61-62
Scored sequences and counts
GUG*CC 11
UCG*CC 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_81831.1
Basepair signature:
|
100.00 | 93.89 | 2 | 0 |
Intercalated cWS |
| 2 |
Motif group IL_73452.2
Basepair signature:
|
100.00 | 92.41 | 2 | 0 |
|
| 3 |
Motif group IL_90729.1
Basepair signature:
|
100.00 | 91.97 | 0 | 0 |
Single stack bend |
| 4 |
Motif group IL_26793.1
Basepair signature:
|
100.00 | 78.05 | 1 | 0 |
Single stack bend |
| 5 |
Motif group IL_33761.2
Basepair signature:
|
100.00 | 76.24 | 2 | 0 |
|
| 6 |
Motif group IL_07039.3
Basepair signature:
|
100.00 | 67.81 | 3 | 0 |
Major groove platform |
| 7 |
Motif group IL_42771.1
Basepair signature:
|
100.00 | 61.06 | 3 | 1 |
Multiple bulged bases |
| 8 |
Motif group IL_66635.5
Basepair signature:
|
100.00 | 60.86 | 1 | 1 |
Major groove intercalation |
| 9 |
Motif group IL_48076.6
Basepair signature:
|
100.00 | 51.01 | 2 | 0 |
Major groove platform |
| 10 |
Motif group IL_16386.4
Basepair signature:
|
100.00 | 40.79 | 3 | 1 |
|
Loop 5 Hairpin loop
Column numbers: 52-59
Scored sequences and counts
AGGAAAAU 11
AAGAAUUU 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_04259.3
Basepair signature:
|
100.00 | 58.83 | 3 | 1 |
GNRA with extra cWW |
| 2 |
Motif group HL_41464.2
Basepair signature:
|
91.67 | 31.98 | 4 | 2 |
|
| 3 |
Motif group HL_10540.1
Basepair signature:
|
91.67 | 31.82 | 4 | 2 |
|
| 4 |
Motif group HL_85993.1
Basepair signature:
|
91.67 | 30.17 | 2 | 2 |
|
| 5 |
Motif group HL_77082.1
Basepair signature:
|
91.67 | 26.16 | 3 | 1 |
Pseudoknot geometry |
| 6 |
Motif group HL_78197.1
Basepair signature:
|
91.67 | 22.75 | 4 | 2 |
|
| 7 |
Motif group HL_07886.3
Basepair signature:
|
91.67 | 21.21 | 3 | 1 |
|
| 8 |
Motif group HL_00914.1
Basepair signature:
|
91.67 | 12.58 | 4 | 2 |
|
| 9 |
Motif group HL_81538.2
Basepair signature:
|
91.67 | 12.38 | 4 | 2 |
GNRA with tandem sheared |
| 10 |
Motif group HL_89567.2
Basepair signature:
|
91.67 | 11.58 | 2 | 2 |
|
Loop 6 Hairpin loop
Column numbers: 114-119
Scored sequences and counts
GUUUAC 11
GUGAAC 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_69752.2
Basepair signature:
|
100.00 | 58.90 | 3 | 1 |
|
| 2 |
Motif group HL_46501.1
Basepair signature:
|
100.00 | 57.13 | 3 | 1 |
|
| 3 |
Motif group HL_71391.1
Basepair signature:
|
100.00 | 56.97 | 1 | 1 |
|
| 4 |
Motif group HL_57875.1
Basepair signature:
|
100.00 | 55.81 | 2 | 1 |
|
| 5 |
Motif group HL_70782.2
Basepair signature:
|
100.00 | 54.04 | 2 | 1 |
|
| 6 |
Motif group HL_56334.1
Basepair signature:
|
100.00 | 53.25 | 3 | 1 |
Mini UNCG |
| 7 |
Motif group HL_50006.2
Basepair signature:
|
100.00 | 28.81 | 4 | 2 |
|
| 8 |
Motif group HL_38901.2
Basepair signature:
|
100.00 | 20.01 | 3 | 2 |
tRNA D-loop |
| 9 |
Motif group HL_04783.2
Basepair signature:
|
100.00 | 16.20 | 3 | 2 |
|
| 10 |
Motif group HL_75660.5
Basepair signature:
|
100.00 | 12.37 | 2 | 2 |
|
Loop 7 Internal loop
Column numbers: 150-156, 186-187
Scored sequences and counts
C----AG*CG 11
AAAAGCG*CG 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_51454.3
Basepair signature:
|
91.67 | 66.58 | 0 | 0 |
Minor groove platform |
| 2 |
Motif group IL_90729.1
Basepair signature:
|
91.67 | 62.23 | 1 | 0 |
Single stack bend |
| 3 |
Motif group IL_26793.1
Basepair signature:
|
91.67 | 61.67 | 1 | 0 |
Single stack bend |
| 4 |
Motif group IL_66635.5
Basepair signature:
|
91.67 | 59.92 | 2 | 0 |
Major groove intercalation |
| 5 |
Motif group IL_31462.6
Basepair signature:
|
91.67 | 57.47 | 0 | 0 |
Single bulged A |
| 6 |
Motif group IL_48076.6
Basepair signature:
|
91.67 | 57.39 | 0 | 0 |
Major groove platform |
| 7 |
Motif group IL_33761.2
Basepair signature:
|
91.67 | 56.01 | 2 | 0 |
|
| 8 |
Motif group IL_73452.2
Basepair signature:
|
91.67 | 52.05 | 1 | 1 |
|
| 9 |
Motif group IL_31737.3
Basepair signature:
|
91.67 | 47.86 | 2 | 0 |
Stack and bulge |
| 10 |
Motif group IL_07039.3
Basepair signature:
|
91.67 | 47.85 | 2 | 0 |
Major groove platform |
Loop 8 Internal loop
Column numbers: 165-166, 175-177
Scored sequences and counts
UA*UAA 11
CG*CAG 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_42771.1
Basepair signature:
|
100.00 | 99.83 | 2 | 0 |
Multiple bulged bases |
| 2 |
Motif group IL_10569.1
Basepair signature:
|
100.00 | 96.68 | 2 | 0 |
|
| 3 |
Motif group IL_26793.1
Basepair signature:
|
100.00 | 96.03 | 2 | 0 |
Single stack bend |
| 4 |
Motif group IL_90729.1
Basepair signature:
|
100.00 | 90.65 | 2 | 0 |
Single stack bend |
| 5 |
Motif group IL_48076.6
Basepair signature:
|
100.00 | 89.98 | 1 | 0 |
Major groove platform |
| 6 |
Motif group IL_33761.2
Basepair signature:
|
100.00 | 87.31 | 4 | 0 |
|
| 7 |
Motif group IL_66635.5
Basepair signature:
|
100.00 | 84.96 | 2 | 0 |
Major groove intercalation |
| 8 |
Motif group IL_31462.6
Basepair signature:
|
100.00 | 83.33 | 0 | 0 |
Single bulged A |
| 9 |
Motif group IL_31737.3
Basepair signature:
|
100.00 | 82.72 | 3 | 0 |
Stack and bulge |
| 10 |
Motif group IL_51454.3
Basepair signature:
|
100.00 | 81.18 | 0 | 0 |
Minor groove platform |
Loop 9 Hairpin loop
Column numbers: 168-173
Scored sequences and counts
ACAACU 10
AACGAU 1
ACAGUU 1
Click on headings to reorder table
- View All Results for this Loop
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_53890.2
Basepair signature:
|
100.00 | 51.70 | 2 | 1 |
|
| 2 |
Motif group HL_57176.2
Basepair signature:
|
100.00 | 35.73 | 3 | 1 |
Pseudoknot geometry with 3' bulge |
| 3 |
Motif group HL_59843.1
Basepair signature:
|
91.67 | 28.52 | 4 | 2 |
|
| 4 |
Motif group HL_93535.1
Basepair signature:
|
91.67 | 16.58 | 4 | 2 |
|
| 5 |
Motif group HL_04783.2
Basepair signature:
|
83.33 | 47.29 | 3 | 1 |
|
| 6 |
Motif group HL_50006.2
Basepair signature:
|
83.33 | 32.42 | 4 | 2 |
|
| 7 |
Motif group HL_62934.1
Basepair signature:
|
83.33 | 11.18 | 3 | 2 |
|
| 8 |
Motif group HL_37824.7
Basepair signature:
|
83.33 | 2.36 | 2 | 1 |
GNRA |
| 9 |
Motif group HL_52953.3
Basepair signature:
|
16.67 | -13.99 | 4 | 2 |
|
| 10 |
Motif group HL_75660.5
Basepair signature:
|
16.67 | -18.49 | 3 | 2 |
|