JAR3D on RF01460

RF01460 Listeria sRNA rliH

Input Summary

      000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111122222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222223333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333444444444444444444444444444444
000000000111111111122222222223333333333444444444455555555556666666666777777777788888888889999999999000000000011111111112222222222333333333344444444445555555555666666666677777777778888888888999999999900000000001111111111222222222233333333334444444444555555555566666666667777777777888888888899999999990000000000111111111122222222223333333333444444444455555555556666666666777777777788888888889999999999000000000011111111112222222222
123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789
..............................................................................................(((((...(((((((....((((....))))...))))))))))))...(((((((.(((....))).))...((...(((((.(((((......))))))))))..)).)))))................................................(((..((((.......))))...)))((((((.......))))))...............................((((((((....(((........)))..))))))))...............((((((((..((((((((....)))))))).))))))))......
>AADQ01000003.1/73707-73279
CUUCCAGUCCACCAAACAUAUCACAUUUUUGGCAAAGGGAGCGAUAUUUGGGAUUGGAGCGAAUAAGUUGGCAAAAAGGAGUAAAGUUACAUAAUCUAGAAACUUCGGUACCGUGUAUAUCUACAACAACUGAGGCUAAACUGGUUGCGGCUGAGAACUCAUCCAUCACUUUUUCAAUGAGCAUUUCGUUGCUUUUGGACUGUAGUAACAUAGCUAUUCCCCUUUCGGCGAGACUUGGCGUGUUUCUGUCGUUCUUAGUAUAGCAUAUUUAUAAUGCGCUUACAUUUUCUUGCCAUGAAGAUAACAAUAUAUUGCUAAGAGUAAUUUCAUAAGAGAAUGCCCAAACCAUGCAUUACUGGAUGGCUUUUUGUCAUUAUUUUUUUUGAAGGCGCAAAAUUGUGUUAAAACACGAUUCGCGUCUUCUUUUUU
>AL596167.1/168444-168872
CUUCCAACCCGCCAAACAUAUCACAUUUUUGGCAAAGCGAGCGAUAUUUUGGGUUAGAACGAAUGAGUUGGCAAAAAGGAGUAAAGUUACAUAAUCUUGAAACUUCGGUACCGUGUAUAUCUACAACAACUGAGGCUAGACUAGUAGCGGCUGAGAACUCAUCCAUGACUUUUUCAAGAAGCAUUUCAUUGCUUUUGGUUUGUAGUAACAUAGCUAUUCCCCUUUCGGCAAUACUUGGCGUGUUUCUGUCGUUCUUAGUAUAGCAUAUUUAUAAUGCGCUUACAUUUUCUUGCCAUGAAGAUAACAAUAUAUUGCUAAGACUAAUUUCAUAAGAGAAAGCCCAAACCAUGCUCUACUGGAUGGCUUUUUGUCGUUUAUUUUUUUGAAGGCGCAAAAUUGUGUUAAAACACGAUUCGCGUCUUCUUUUUU
>AM263198.1/1123866-1124294
CUUCAAGGCCCCCAAACAUAUCACAUUUUUGACAAAGUGAGCGAUAUUUUGGGUUGGAACGAAUGAGUUGGCAAAAAGGAGUAAAGUUACAUAAUCUAGAAACUUCGGUACCGUGUAUAUCUACAACAACGGAGGCUAGACUCGUUGCGGCUGAAAACUCAUCCAUGACUUUUUCAAUGAGCAAUUCGUUGCUUUUGGACUGUAGUAACAUAGUUAUUCCCCUUUCGGCAAUACUUGGCGUGUUUCUGUCGUUCUUAGUAUAGCAUAUUUAUAAUGCGCUUACAUUUUCUUGCCAUGAAGAUAACAAUAUAUUGCUAAGACCAAUUUCAUAGUAAAAGCCCCAAACCAUGCAUGACUGGAUGGCUUUUUGUAUAUAAUUUUUUAAAAGGCGCAAAAUUGUGUUAAAACACGAUUCGCGUCUUCUUUUUU

There are no chains in PDB that we map to Rfam family RF01460.

Jump to results for:

Loop 1IL Column numbers: 99-103, 135-136
Loop 2IL Column numbers: 109-114, 125-129
Loop 3HL Column numbers: 117-122
Loop 4J3 Column numbers: 148-149, 164-168, 203-205
Loop 5IL Column numbers: 150-152, 161-163
Loop 6HL Column numbers: 154-159
Loop 7IL Column numbers: 169-173, 199-202
Loop 8IL Column numbers: 177-179, 194-195
Loop 9HL Column numbers: 183-190
Loop 10IL Column numbers: 260-263, 277-281
Loop 11HL Column numbers: 266-274
Loop 12HL Column numbers: 289-297
Loop 13IL Column numbers: 341-346, 359-362
Loop 14HL Column numbers: 348-357
Loop 15IL Column numbers: 392-395, 414-416
Loop 16HL Column numbers: 402-407

Loop 1 Internal loop

Column numbers: 99-103, 135-136

    Scored sequences and counts

    
    GAAAC*GC    3

Click on headings to reorder table - View All Results for this Loop

#	Matching motif group	Acceptance Rate	Mean Cutoff Score	Full Edit Distance	Interior Edit Distance	Basepair Diagram and most common annotation
1	Motif group IL_68140.4 View motif instance in 3D Basepair signature: cWW-cSH-cWW	100.00	61.82	2	0	Major groove minor groove platform; mini C-loop
2	Motif group IL_47078.3 View motif instance in 3D Basepair signature: cWW-cWS-L-cWW-L	100.00	45.30	3	1	Minor groove platform
3	Motif group IL_00881.1 View motif instance in 3D Basepair signature: cWW-L-cWW-L	100.00	42.59	5	1
4	Motif group IL_73452.2 View motif instance in 3D Basepair signature: cWW-L-cWW	100.00	42.52	3	1
5	Motif group IL_03109.3 View motif instance in 3D Basepair signature: cWW-cWS-tWH-cWW-L	100.00	37.56	3	1	C-loop
6	Motif group IL_42626.2 View motif instance in 3D Basepair signature: cWW-cWW	100.00	33.40	5	1
7	Motif group IL_95583.2 View motif instance in 3D Basepair signature: cWW-L-cWW	100.00	19.17	3	1	Minor groove platform, major groove intercalation
8	Motif group IL_81831.1 View motif instance in 3D Basepair signature: cWW-L-cWW	100.00	14.54	4	1	Intercalated cWS
9	Motif group IL_81522.2 View motif instance in 3D Basepair signature: cWW-L-L-cWW	100.00	13.28	4	2	Major groove minor groove platform with intercalation; mini C-loop
10	Motif group IL_66997.2 View motif instance in 3D Basepair signature: cWW-L-R-L-cWW-L	100.00	10.12	3	2

Loop 2 Internal loop

Column numbers: 109-114, 125-129

    Scored sequences and counts

    
    UACCGU*AACAA    3

Click on headings to reorder table - View All Results for this Loop

#	Matching motif group	Acceptance Rate	Mean Cutoff Score	Full Edit Distance	Interior Edit Distance	Basepair Diagram and most common annotation
1	Motif group IL_01176.1 View motif instance in 3D Basepair signature: cWW-L-R-L-R-L-R-L-cWW	100.00	29.76	5	3
2	Motif group IL_68405.1 View motif instance in 3D Basepair signature: cWW-cSS-L-tWH-tHW-cWW-cWW	100.00	18.72	7	3	Kink-turn related
3	Motif group IL_42778.1 View motif instance in 3D Basepair signature: cWW-L-R-L-R-L-R-L-cWW	100.00	16.35	7	3
4	Motif group IL_25186.4 View motif instance in 3D Basepair signature: cWW-L-R-L-R-L-R-cWW	100.00	9.69	7	3

Loop 3 Hairpin loop

Column numbers: 117-122

    Scored sequences and counts

    
    AUAUCU    3

Click on headings to reorder table - View All Results for this Loop

#	Matching motif group	Acceptance Rate	Mean Cutoff Score	Full Edit Distance	Interior Edit Distance	Basepair Diagram and most common annotation
1	Motif group HL_70782.2 View motif instance in 3D Basepair signature: cWW-F	100.00	55.85	3	1
2	Motif group HL_04783.2 View motif instance in 3D Basepair signature: cWW-F-F-F	100.00	55.06	3	1
3	Motif group HL_56334.1 View motif instance in 3D Basepair signature: cWW-F	100.00	48.23	1	1	Mini UNCG
4	Motif group HL_50006.2 View motif instance in 3D Basepair signature: cWW-F-F	100.00	48.03	4	2
5	Motif group HL_49922.4 View motif instance in 3D Basepair signature: cWW-F-F-F	100.00	43.94	3	1
6	Motif group HL_43517.1 View motif instance in 3D Basepair signature: cWW-F-F-F	100.00	43.39	3	1
7	Motif group HL_62934.1 View motif instance in 3D Basepair signature: cWW-tSH-F	100.00	32.08	4	2
8	Motif group HL_86883.1 View motif instance in 3D Basepair signature: cWW-F-F-F	100.00	30.25	3	1
9	Motif group HL_46501.1 View motif instance in 3D Basepair signature: cWW-cWS	100.00	17.26	4	2
10	Motif group HL_65794.5 View motif instance in 3D Basepair signature: cWW-F-F-F-F	100.00	15.22	3	1	Pseudoknot geometry

Loop 4 3-way junction loop

Column numbers: 148-149, 164-168, 203-205

    Scored sequences and counts

    
    CG*CAUGA*UAG    2

    
    CG*CAUCA*UAG    1

No Matches Found View All Results for this Loop

Loop 5 Internal loop

Column numbers: 150-152, 161-163

    Scored sequences and counts

    
    GCU*AUC    3

Click on headings to reorder table - View All Results for this Loop

#	Matching motif group	Acceptance Rate	Mean Cutoff Score	Full Edit Distance	Interior Edit Distance	Basepair Diagram and most common annotation
1	Motif group IL_14688.1 View motif instance in 3D Basepair signature: cWW-cWW-cWW	100.00	99.97	2	0	Isolated non-canonical cWW pair
2	Motif group IL_08770.1 View motif instance in 3D Basepair signature: cWW-L-R-cWW	100.00	94.78	4	0
3	Motif group IL_07785.1 View motif instance in 3D Basepair signature: cWW-cWW-cWW	100.00	91.93	2	0	Isolated non-canonical cWW pair
4	Motif group IL_87907.2 View motif instance in 3D Basepair signature: cWW-cWW-cWW	100.00	80.87	1	0	Isolated non-canonical cWW pair
5	Motif group IL_28037.2 View motif instance in 3D Basepair signature: cWW-cWW-cWW	100.00	64.57	1	0	Isolated non-canonical cWW pair
6	Motif group IL_10167.6 View motif instance in 3D Basepair signature: cWW-cHW-cWW	100.00	47.56	3	0	Isolated cWH basepair
7	Motif group IL_31737.3 View motif instance in 3D Basepair signature: cWW-L-cWW	100.00	43.88	3	1	Stack and bulge
8	Motif group IL_42771.1 View motif instance in 3D Basepair signature: cWW-cWW	100.00	40.91	4	1	Multiple bulged bases
9	Motif group IL_42997.3 View motif instance in 3D Basepair signature: cWW-L-R-cWW	100.00	34.23	3	1	Isolated cWS basepair
10	Motif group IL_57744.1 View motif instance in 3D Basepair signature: cWW-cWW-cWW	100.00	32.51	4	1	Isolated non-canonical cWW pair

Loop 6 Hairpin loop

Column numbers: 154-159

    Scored sequences and counts

    
    AGAACU    2

    
    AAAACU    1

Click on headings to reorder table - View All Results for this Loop

#	Matching motif group	Acceptance Rate	Mean Cutoff Score	Full Edit Distance	Interior Edit Distance	Basepair Diagram and most common annotation
1	Motif group HL_93535.1 View motif instance in 3D Basepair signature: cWW-F-F-F-F	100.00	60.72	3	1
2	Motif group HL_53890.2 View motif instance in 3D Basepair signature: cWW-F-F-F	100.00	58.36	1	1
3	Motif group HL_04783.2 View motif instance in 3D Basepair signature: cWW-F-F-F	100.00	36.37	3	1
4	Motif group HL_37824.7 View motif instance in 3D Basepair signature: cWW-F-F-F-F	100.00	34.11	1	0	GNRA
5	Motif group HL_75660.5 View motif instance in 3D Basepair signature: cWW-F	100.00	33.84	3	1
6	Motif group HL_82710.2 View motif instance in 3D Basepair signature: cWW-F-F-F	100.00	32.24	2	1
7	Motif group HL_38901.2 View motif instance in 3D Basepair signature: cWW-F-cSH	100.00	27.98	3	1	tRNA D-loop
8	Motif group HL_52953.3 View motif instance in 3D Basepair signature: cWW-F-F-F-F	100.00	26.59	3	1
9	Motif group HL_50006.2 View motif instance in 3D Basepair signature: cWW-F-F	100.00	23.55	3	1
10	Motif group HL_65794.5 View motif instance in 3D Basepair signature: cWW-F-F-F-F	66.67	21.33	3	1	Pseudoknot geometry

Loop 7 Internal loop

Column numbers: 169-173, 199-202

    Scored sequences and counts

    
    CUUUU*ACUG    2

    
    CUUUU*UUUG    1

Click on headings to reorder table - View All Results for this Loop

#	Matching motif group	Acceptance Rate	Mean Cutoff Score	Full Edit Distance	Interior Edit Distance	Basepair Diagram and most common annotation
1	Motif group IL_70096.1 View motif instance in 3D Basepair signature: cWW-L-cWW-cWW	100.00	42.49	4	2	Kink-turn related
2	Motif group IL_68909.1 View motif instance in 3D Basepair signature: cWW-L-R-L-R-L-cWW	100.00	18.51	6	2
3	Motif group IL_74367.1 View motif instance in 3D Basepair signature: cWW-L-R-L-R-L-R-cWW	66.67	-5.06	6	2
4	Motif group IL_91920.1 View motif instance in 3D Basepair signature: cWW-cWW-tHH-cWW	66.67	-5.33	7	3
5	Motif group IL_70335.1 View motif instance in 3D Basepair signature: cWW-L-R-L-cWW	66.67	-10.72	5	3
6	Motif group IL_29223.1 View motif instance in 3D Basepair signature: cWW-L-R-L-cWW-cWW-cWW	33.33	-1.84	5	3
7	Motif group IL_61242.1 View motif instance in 3D Basepair signature: cWW-cWW-L-R-L-R-cWW	33.33	-3.46	5	3
8	Motif group IL_26728.3 View motif instance in 3D Basepair signature: cWW-cSH-R-cSH-cWW-cWW	33.33	-12.26	6	4

Loop 8 Internal loop

Column numbers: 177-179, 194-195

    Scored sequences and counts

    
    AUG*UU    2

    
    AGA*UU    1

Click on headings to reorder table - View All Results for this Loop

#	Matching motif group	Acceptance Rate	Mean Cutoff Score	Full Edit Distance	Interior Edit Distance	Basepair Diagram and most common annotation
1	Motif group IL_81831.1 View motif instance in 3D Basepair signature: cWW-L-cWW	100.00	73.25	3	0	Intercalated cWS
2	Motif group IL_07039.3 View motif instance in 3D Basepair signature: cWW-L-cWW	100.00	67.33	2	0	Major groove platform
3	Motif group IL_73452.2 View motif instance in 3D Basepair signature: cWW-L-cWW	100.00	67.09	4	0
4	Motif group IL_90729.1 View motif instance in 3D Basepair signature: cWW-L-cWW	100.00	66.58	1	0	Single stack bend
5	Motif group IL_66635.5 View motif instance in 3D Basepair signature: cWW-L-cWW	100.00	53.99	2	1	Major groove intercalation
6	Motif group IL_10569.1 View motif instance in 3D Basepair signature: cWW-L-cWW	100.00	53.16	2	1
7	Motif group IL_33761.2 View motif instance in 3D Basepair signature: cWW-L-cWW	100.00	51.43	4	0
8	Motif group IL_42771.1 View motif instance in 3D Basepair signature: cWW-cWW	100.00	49.47	2	1	Multiple bulged bases
9	Motif group IL_26793.1 View motif instance in 3D Basepair signature: cWW-L-cWW	100.00	46.94	2	0	Single stack bend
10	Motif group IL_16386.4 View motif instance in 3D Basepair signature: cWW-L-cWW	100.00	44.83	4	1

Loop 9 Hairpin loop

Column numbers: 183-190

    Scored sequences and counts

    
    AAUUCGUU    1

    
    AUUUCAUU    1

    
    AUUUCGUU    1

Click on headings to reorder table - View All Results for this Loop

#	Matching motif group	Acceptance Rate	Mean Cutoff Score	Full Edit Distance	Interior Edit Distance	Basepair Diagram and most common annotation
1	Motif group HL_20535.2 View motif instance in 3D Basepair signature: cWW-F-F-F-F	100.00	8.71	5	3
2	Motif group HL_77082.1 View motif instance in 3D Basepair signature: cWW-F-F-F-F-F-F	66.67	15.31	3	2	Pseudoknot geometry
3	Motif group HL_28075.1 View motif instance in 3D Basepair signature: cWW-F-F-F-F-F	66.67	13.80	3	2
4	Motif group HL_78197.1 View motif instance in 3D Basepair signature: cWW-F-F-F-F-F-F	66.67	9.30	4	2
5	Motif group HL_50006.2 View motif instance in 3D Basepair signature: cWW-F-F	66.67	8.84	4	2
6	Motif group HL_31585.4 View motif instance in 3D Basepair signature: cWW-F-F-F-F-F	66.67	8.21	4	2	Purine riboswitch
7	Motif group HL_26934.1 View motif instance in 3D Basepair signature: cWW-F-F-F-F-F-F	66.67	3.88	5	3
8	Motif group HL_25967.2 View motif instance in 3D Basepair signature: cWW-cWW-F-F-F	66.67	1.35	4	2
9	Motif group HL_66103.1 View motif instance in 3D Basepair signature: cWW-F-F	66.67	-4.71	3	1
10	Motif group HL_38808.1 View motif instance in 3D Basepair signature: cWW-cWW	33.33	-0.05	3	3

Loop 10 Internal loop

Column numbers: 260-263, 277-281

    Scored sequences and counts

    
    AUAG*CGCUU    3

Click on headings to reorder table - View All Results for this Loop

#	Matching motif group	Acceptance Rate	Mean Cutoff Score	Full Edit Distance	Interior Edit Distance	Basepair Diagram and most common annotation
1	Motif group IL_06300.1 View motif instance in 3D Basepair signature: cWW-L-R-L-R-L-cWW	100.00	44.45	5	1
2	Motif group IL_99646.2 View motif instance in 3D Basepair signature: cWW-tWH-tHS-cWW	100.00	28.28	2	1	tSH-tHW
3	Motif group IL_68574.4 View motif instance in 3D Basepair signature: cWW-tHH-tHS-cWW	100.00	20.76	4	2
4	Motif group IL_49612.1 View motif instance in 3D Basepair signature: cWW-L-R-L-R-L-cWW-L	100.00	16.58	3	3
5	Motif group IL_48444.6 View motif instance in 3D Basepair signature: cWW-L-R-cWW-cWW	100.00	9.13	5	2
6	Motif group IL_96236.1 View motif instance in 3D Basepair signature: cWW-tWW-cWW-L-cWW	100.00	4.32	7	3

Loop 11 Hairpin loop

Column numbers: 266-274

    Scored sequences and counts

    
    UAUUUAUAA    3

Click on headings to reorder table - View All Results for this Loop

#	Matching motif group	Acceptance Rate	Mean Cutoff Score	Full Edit Distance	Interior Edit Distance	Basepair Diagram and most common annotation
1	Motif group HL_20535.2 View motif instance in 3D Basepair signature: cWW-F-F-F-F	100.00	35.91	4	2
2	Motif group HL_66853.7 View motif instance in 3D Basepair signature: cWW-cWS-F-cSH	100.00	16.87	5	3
3	Motif group HL_73266.9 View motif instance in 3D Basepair signature: cWW-F-F-cSW-cSH-F	100.00	10.46	2	2
4	Motif group HL_32735.2 View motif instance in 3D Basepair signature: cWW-tSH-F-F-F-F-F	100.00	4.18	4	2
5	Motif group HL_45175.1 View motif instance in 3D Basepair signature: cWW-cWS-F-F	100.00	3.15	5	3	tRNA D-loop
6	Motif group HL_69139.1 View motif instance in 3D Basepair signature: cWW-F-F-F-F-F-F-F-F	100.00	3.09	4	3
7	Motif group HL_50537.6 View motif instance in 3D Basepair signature: cWW-F-F-F	100.00	0.12	5	3	tRNA anticodon loop with synthetase

Loop 12 Hairpin loop

Column numbers: 289-297

    Scored sequences and counts

    
    CUUGCCAUG    3

Click on headings to reorder table - View All Results for this Loop

#	Matching motif group	Acceptance Rate	Mean Cutoff Score	Full Edit Distance	Interior Edit Distance	Basepair Diagram and most common annotation
1	Motif group HL_38808.1 View motif instance in 3D Basepair signature: cWW-cWW	100.00	69.86	3	1
2	Motif group HL_83632.1 View motif instance in 3D Basepair signature: cWW-F-F-F-F-F-F	100.00	49.14	1	1	tRNA anticodon loop
3	Motif group HL_06059.6 View motif instance in 3D Basepair signature: cWW-F-F-F-F-F-F-F	100.00	44.33	1	1	tRNA anticodon loop
4	Motif group HL_87463.1 View motif instance in 3D Basepair signature: cWW-cWW-F-F-F-F-F	100.00	24.60	5	3
5	Motif group HL_80008.1 View motif instance in 3D Basepair signature: cWW-F-F-F-cSH-F	100.00	21.47	2	2

Loop 13 Internal loop

Column numbers: 341-346, 359-362

    Scored sequences and counts

    
    CCAAAC*GAUG    3

Click on headings to reorder table - View All Results for this Loop

#	Matching motif group	Acceptance Rate	Mean Cutoff Score	Full Edit Distance	Interior Edit Distance	Basepair Diagram and most common annotation
1	Motif group IL_11344.2 View motif instance in 3D Basepair signature: cWW-cSS-L-cWW	100.00	49.49	2	2	180 degree turn
2	Motif group IL_90346.1 View motif instance in 3D Basepair signature: cWW-L-R-L-cWW-L-L	100.00	19.40	3	3
3	Motif group IL_29471.1 View motif instance in 3D Basepair signature: cWW-cWW-L-tHS-L-cWW	100.00	4.46	5	3
4	Motif group IL_96332.5 View motif instance in 3D Basepair signature: cWW-cWW-L-R-L-cWW-L	100.00	3.43	5	3
5	Motif group IL_91920.1 View motif instance in 3D Basepair signature: cWW-cWW-tHH-cWW	100.00	1.06	6	2
6	Motif group IL_14177.2 View motif instance in 3D Basepair signature: cWW-L-R-L-cWW	100.00	0.66	3	2
7	Motif group IL_05192.4 View motif instance in 3D Basepair signature: cWW-L-R-L-R-L-cWW-L	100.00	0.15	5	3

Loop 14 Hairpin loop

Column numbers: 348-357

    Scored sequences and counts

    
    AUGCAUGACU    1

    
    AUGCAUUACU    1

    
    AUGCUCUACU    1

Click on headings to reorder table - View All Results for this Loop

#	Matching motif group	Acceptance Rate	Mean Cutoff Score	Full Edit Distance	Interior Edit Distance	Basepair Diagram and most common annotation
1	Motif group HL_02887.3 View motif instance in 3D Basepair signature: cWW-tWH-F-F-F-F-F-F	100.00	19.24	5	3	T-loop with 3 stacked bulged bases
2	Motif group HL_45785.1 View motif instance in 3D Basepair signature: cWW-F-F-F-F-cSH-F-F	100.00	6.18	6	4
3	Motif group HL_25847.2 View motif instance in 3D Basepair signature: cWW-F-cSH-tHW-F-F-F	66.67	1.50	6	4
4	Motif group HL_29762.1 View motif instance in 3D Basepair signature: cWW-F-F-F-F-F	33.33	-5.24	6	4
5	Motif group HL_73255.1 View motif instance in 3D Basepair signature: cWW-F-F-F-F-F-F	33.33	-7.05	6	4
6	Motif group HL_18978.1 View motif instance in 3D Basepair signature: cWW-F-F-tHW-F-F-F	33.33	-11.16	7	5
7	Motif group HL_83808.4 View motif instance in 3D Basepair signature: cWW-tWW-F-F-F	33.33	-13.55	6	4	Pseudoknot
8	Motif group HL_24792.1 View motif instance in 3D Basepair signature: cWW-cWS-F-F-F	33.33	-17.72	7	5

Loop 15 Internal loop

Column numbers: 392-395, 414-416

    Scored sequences and counts

    
    CAAA*UCG    3

Click on headings to reorder table - View All Results for this Loop

#	Matching motif group	Acceptance Rate	Mean Cutoff Score	Full Edit Distance	Interior Edit Distance
1	Motif group IL_61438.4 View motif instance in 3D Basepair signature: cWW-L-cWW	100.00	98.03	2	0
2	Motif group IL_90351.1 View motif instance in 3D Basepair signature: cWW-L-R-L-cWW	100.00	84.28	4	0
3	Motif group IL_51387.2 View motif instance in 3D Basepair signature: cWW-cSH-cWW-cWW	100.00	74.99	2	0
4	Motif group IL_83389.2 View motif instance in 3D Basepair signature: cWW-cWW	100.00	67.90	3	1
5	Motif group IL_99358.1 View motif instance in 3D Basepair signature: cWW-L-R-L-cWW	100.00	61.04	2	1
6	Motif group IL_41344.1 View motif instance in 3D Basepair signature: cWW-L-R-L-cWW	100.00	44.92	5	1
7	Motif group IL_09990.4 View motif instance in 3D Basepair signature: cWW-L-R-L-cWW	100.00	43.67	5	1
8	Motif group IL_08770.1 View motif instance in 3D Basepair signature: cWW-L-R-cWW	100.00	42.62	4	1
9	Motif group IL_55516.2 View motif instance in 3D Basepair signature: cWW-cWW-cSH-cWW	100.00	34.54	4	1
10	Motif group IL_15698.3 View motif instance in 3D Basepair signature: cWW-L-R-L-cWW	100.00	33.74	3	1

Loop 16 Hairpin loop

Column numbers: 402-407

    Scored sequences and counts

    
    UUAAAA    3

Click on headings to reorder table - View All Results for this Loop

#	Matching motif group	Acceptance Rate	Mean Cutoff Score	Full Edit Distance	Interior Edit Distance	Basepair Diagram and most common annotation
1	Motif group HL_04783.2 View motif instance in 3D Basepair signature: cWW-F-F-F	100.00	64.52	3	1
2	Motif group HL_53890.2 View motif instance in 3D Basepair signature: cWW-F-F-F	100.00	55.03	2	1
3	Motif group HL_46501.1 View motif instance in 3D Basepair signature: cWW-cWS	100.00	54.41	3	1
4	Motif group HL_38901.2 View motif instance in 3D Basepair signature: cWW-F-cSH	100.00	51.96	3	1	tRNA D-loop
5	Motif group HL_82710.2 View motif instance in 3D Basepair signature: cWW-F-F-F	100.00	45.60	3	1
6	Motif group HL_50006.2 View motif instance in 3D Basepair signature: cWW-F-F	100.00	45.30	3	1
7	Motif group HL_75660.5 View motif instance in 3D Basepair signature: cWW-F	100.00	44.10	3	1
8	Motif group HL_52953.3 View motif instance in 3D Basepair signature: cWW-F-F-F-F	100.00	39.30	3	1
9	Motif group HL_59843.1 View motif instance in 3D Basepair signature: cWW-F-F-F-F	100.00	35.27	3	2
10	Motif group HL_69752.2 View motif instance in 3D Basepair signature: cWW-F	100.00	30.20	4	2

Nucleotide numbers Coloring options:

JAR3D Query RF01460-3.98 completed Run on Motif Atlas Version 3.98 using the Rfam secondary structure. Run with the CaCoFold secondary structure.

RF01460 Listeria sRNA rliH

Input Summary

Jump to results for:

Loop 1 Internal loop

Loop 2 Internal loop

Loop 3 Hairpin loop

Loop 4 3-way junction loop

Loop 5 Internal loop

Loop 6 Hairpin loop

Loop 7 Internal loop

Loop 8 Internal loop

Loop 9 Hairpin loop

Loop 10 Internal loop

Loop 11 Hairpin loop

Loop 12 Hairpin loop

Loop 13 Internal loop

Loop 14 Hairpin loop

Loop 15 Internal loop

Loop 16 Hairpin loop

JAR3D Query RF01460-3.98 completed
Run on Motif Atlas Version 3.98 using the Rfam secondary structure. Run with the CaCoFold secondary structure.