JAR3D
Query RF02032-3.98 completed
Run on Motif Atlas Version
using the Rfam secondary structure. Run with the CaCoFold secondary structure.
Rfam family RF02032 maps to these 73 chains: 9L0R|1|A, 9L0R|1|B, 9L0R|1|C, 9L0R|1|D, 9L0R|1|E, 9L0R|1|F, 9L0R|1|G, 9L0R|1|H, 9L0R|1|I, 9L0R|1|J, 9L0R|1|K, 9L0R|1|L, 9LEC|1|J, 9LEE|1|A, 9LEE|1|B, 9LEE|1|C, 9LEE|1|D, 9LEE|1|E, 9LEE|1|F, 9LEE|1|G, 9LEE|1|H, 9LEE|1|I, 9LEE|1|J, 9LEL|1|J, 9LEM|1|A, 9LEM|1|B, 9LEM|1|C, 9LEM|1|D, 9LEM|1|E, 9LEM|1|F, 9LEM|1|G, 9LEM|1|H, 9LEM|1|I, 9LEM|1|J, 9LHK|1|G, 9LHL|1|A, 9LHL|1|B, 9LHL|1|C, 9LHL|1|D, 9LHL|1|E, 9LHL|1|F, 9LHL|1|G, 9LHL|1|H, 9LHL|1|I, 9LHL|1|J, 9LHL|1|K, 9LHL|1|L, 9LHL|1|M, 9LHL|1|N, 9LMF|1|A, 9LMF|1|B, 9LMF|1|C, 9LMF|1|D, 9LMF|1|E, 9LMF|1|F, 9LMF|1|G, 9LMF|1|H, 9LMF|1|I, 9LMF|1|J, 9MEE|1|A, 9MEE|1|B, 9MEE|1|C, 9MEE|1|D, 9MEE|1|E, 9MEE|1|F, 9MEE|1|G, 9MEE|1|H, 9MEE|1|I, 9MEE|1|J, 9MEE|1|K, 9MEE|1|L, 9MEE|1|M, 9MEE|1|N See more about them at RNA 3D Hub by filtering on the chain or the Rfam family.
Loop 11 3-way junction loop
Column numbers: 319-352, 366-371, 405-406 - View nucleotides in PDB file(s)
Scored sequences and counts
UA-------------------------------A*UGAG-U*AA 3
GU-------------------------------A*UUUAGG*CA 2
GU-------------------------------G*CUUAGA*UA 2
UA-------------------------------G*CGAA-U*AA 2
GGCCGCCUCAACAGAGGACGUCUAUGAAUGGUGA*U--U-G*CA 1
CAC-GUUU-------------------------G*UUAA-C*GG 1
GU-------------------------------A*UUUAGA*UA 1
GU-------------------------------G*CUUAGU*GA 1
GU-------------------------------G*CUUUGU*AA 1
GU-------------------------------U*UUAG-A*UA 1
UA-------------------------------A*CGAG-C*GA 1
UA-------------------------------A*CUAG-U*AA 1
UA-------------------------------A*UAAA-U*AA 1
UA-------------------------------A*UGAA-U*AA 1
UA-------------------------------A*UUCA-C*GA 1
UA-------------------------------A*UUCA-U*AA 1
UA-------------------------------G*CGAA-C*GA 1
UA-------------------------------U*AGAG-U*AA 1
Omitted sequenced and counts
-AGCUUAGACUUUUAGC-GGAGUCU-------U-*--C---*-- 3
UA----AGGUGAGGAGGCAUCCUCUU------UA*ACU---*-U 1
UA-----AGUGGUUAGC-ACCACCGA-----AUA*UA----*-A 1
------GGUGGGUUCGCAGCCCUUUA------CU*AG----*-A 1
-AGCUUAGACCUUUAGC-GGGGUUU-------U-*------*-C 1
------GAGACGUUAGC-GCGUCUCG------CU*AGA---*-- 1
AAC--CGAGUGGGUAGCUCCCAUUU---------*------*-A 1
G-----AGGGCGUAAGC--UGCCCUA------GC*G-----*-A 1
UA------GCGACGGCC-AUCGUU----------*------*-G 1
U--------------------------------A*UUAA-U*A- 1
Click on headings to reorder table
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group J3_80578.1
Basepair signature:
|
56.52 | -330.46 | 4 | 1 |
|
| 2 |
Motif group J3_14360.1
Basepair signature:
|
56.52 | -387.19 | 7 | 2 |
|
| 3 |
Motif group J3_81015.1
Basepair signature:
|
34.78 | -365.23 | 9 | 4 |
|
| 4 |
Motif group J3_47376.1
Basepair signature:
|
8.70 | -312.99 | 9 | 4 |
|
| 5 |
Motif group J3_41097.1
Basepair signature:
|
4.35 | -322.15 | 8 | 4 |
phi29 pRNA |
| 6 |
Motif group J3_31041.1
Basepair signature:
|
4.35 | -344.92 | 10 | 4 |
|
| 7 |
Motif group J3_83726.1
Basepair signature:
|
0.00 | -224.31 | 14 | 9 |
|
| 8 |
Motif group J3_45941.1
Basepair signature:
|
0.00 | -243.67 | 11 | 8 |
|
| 9 |
Motif group J3_72012.1
Basepair signature:
|
0.00 | -254.06 | 13 | 10 |
|
| 10 |
Motif group J3_83332.1
Basepair signature:
|
0.00 | -291.71 | 10 | 6 |
|
| 11 |
Motif group J3_19286.1
Basepair signature:
|
0.00 | -298.51 | 10 | 7 |
|
| 12 |
Motif group J3_89095.1
Basepair signature:
|
0.00 | -304.48 | 11 | 7 |
|
| 13 |
Motif group J3_75408.1
Basepair signature:
|
0.00 | -308.27 | 14 | 13 |
|
| 14 |
Motif group J3_20650.1
Basepair signature:
|
0.00 | -313.90 | 9 | 5 |
|
| 15 |
Motif group J3_20992.1
Basepair signature:
|
0.00 | -318.52 | 15 | 13 |
|
| 16 |
Motif group J3_97609.1
Basepair signature:
|
0.00 | -325.28 | 12 | 7 |
|
| 17 |
Motif group J3_44792.1
Basepair signature:
|
0.00 | -328.59 | 16 | 13 |
|
| 18 |
Motif group J3_12393.2
Basepair signature:
|
0.00 | -328.73 | 9 | 6 |
|
| 19 |
Motif group J3_31965.2
Basepair signature:
|
0.00 | -330.29 | 8 | 5 |
|
| 20 |
Motif group J3_98484.1
Basepair signature:
|
0.00 | -330.58 | 11 | 8 |
|
| 21 |
Motif group J3_88257.1
Basepair signature:
|
0.00 | -330.92 | 12 | 9 |
|
| 22 |
Motif group J3_83592.1
Basepair signature:
|
0.00 | -331.62 | 14 | 13 |
|
| 23 |
Motif group J3_36387.1
Basepair signature:
|
0.00 | -331.75 | 10 | 8 |
|
| 24 |
Motif group J3_35667.2
Basepair signature:
|
0.00 | -334.75 | 9 | 6 |
|
| 25 |
Motif group J3_21426.1
Basepair signature:
|
0.00 | -335.94 | 16 | 13 |
|
| 26 |
Motif group J3_76043.3
Basepair signature:
|
0.00 | -336.39 | 8 | 4 |
|
| 27 |
Motif group J3_55773.1
Basepair signature:
|
0.00 | -336.76 | 10 | 6 |
|
| 28 |
Motif group J3_53439.1
Basepair signature:
|
0.00 | -337.11 | 12 | 8 |
|
| 29 |
Motif group J3_23373.1
Basepair signature:
|
0.00 | -340.46 | 11 | 8 |
|
| 30 |
Motif group J3_79369.1
Basepair signature:
|
0.00 | -343.60 | 8 | 4 |
|
| 31 |
Motif group J3_45482.1
Basepair signature:
|
0.00 | -345.53 | 12 | 9 |
|
| 32 |
Motif group J3_89737.1
Basepair signature:
|
0.00 | -347.65 | 12 | 9 |
5S rRNA junction |
| 33 |
Motif group J3_32030.1
Basepair signature:
|
0.00 | -350.22 | 11 | 8 |
|
| 34 |
Motif group J3_39320.1
Basepair signature:
|
0.00 | -355.85 | 18 | 15 |
|
| 35 |
Motif group J3_96372.2
Basepair signature:
|
0.00 | -357.03 | 12 | 9 |
|
| 36 |
Motif group J3_97642.1
Basepair signature:
|
0.00 | -359.56 | 7 | 5 |
|
| 37 |
Motif group J3_94652.1
Basepair signature:
|
0.00 | -360.75 | 9 | 4 |
|
| 38 |
Motif group J3_80708.1
Basepair signature:
|
0.00 | -360.78 | 7 | 3 |
|
| 39 |
Motif group J3_01596.1
Basepair signature:
|
0.00 | -361.19 | 18 | 15 |
|
| 40 |
Motif group J3_99563.1
Basepair signature:
|
0.00 | -365.71 | 13 | 10 |
|
| 41 |
Motif group J3_46173.1
Basepair signature:
|
0.00 | -366.40 | 17 | 13 |
|
| 42 |
Motif group J3_19545.2
Basepair signature:
|
0.00 | -366.66 | 7 | 5 |
|
| 43 |
Motif group J3_20574.1
Basepair signature:
|
0.00 | -366.74 | 8 | 6 |
|
| 44 |
Motif group J3_01052.1
Basepair signature:
|
0.00 | -369.92 | 12 | 6 |
|
| 45 |
Motif group J3_84052.1
Basepair signature:
|
0.00 | -370.22 | 13 | 9 |
|
| 46 |
Motif group J3_68164.1
Basepair signature:
|
0.00 | -371.19 | 10 | 7 |
|
| 47 |
Motif group J3_06335.1
Basepair signature:
|
0.00 | -371.49 | 10 | 7 |
|
| 48 |
Motif group J3_71677.1
Basepair signature:
|
0.00 | -371.51 | 10 | 5 |
|
| 49 |
Motif group J3_44961.1
Basepair signature:
|
0.00 | -372.62 | 12 | 9 |
|
| 50 |
Motif group J3_58957.1
Basepair signature:
|
0.00 | -373.05 | 13 | 8 |
|
| 51 |
Motif group J3_41596.1
Basepair signature:
|
0.00 | -373.52 | 13 | 10 |
|
| 52 |
Motif group J3_89368.5
Basepair signature:
|
0.00 | -373.75 | 10 | 5 |
|
| 53 |
Motif group J3_17385.4
Basepair signature:
|
0.00 | -373.99 | 8 | 5 |
|
| 54 |
Motif group J3_21998.1
Basepair signature:
|
0.00 | -374.47 | 8 | 7 |
|
| 55 |
Motif group J3_47324.1
Basepair signature:
|
0.00 | -375.63 | 9 | 5 |
|
| 56 |
Motif group J3_82572.1
Basepair signature:
|
0.00 | -377.18 | 9 | 7 |
|
| 57 |
Motif group J3_87797.1
Basepair signature:
|
0.00 | -377.53 | 12 | 10 |
|
| 58 |
Motif group J3_36499.1
Basepair signature:
|
0.00 | -380.18 | 9 | 5 |
|
| 59 |
Motif group J3_85054.4
Basepair signature:
|
0.00 | -381.42 | 9 | 7 |
|
| 60 |
Motif group J3_92705.1
Basepair signature:
|
0.00 | -382.32 | 9 | 5 |
|
| 61 |
Motif group J3_32852.6
Basepair signature:
|
0.00 | -382.69 | 6 | 4 |
|
| 62 |
Motif group J3_98798.1
Basepair signature:
|
0.00 | -383.79 | 9 | 6 |
|
| 63 |
Motif group J3_34864.2
Basepair signature:
|
0.00 | -383.93 | 12 | 7 |
|
| 64 |
Motif group J3_62630.1
Basepair signature:
|
0.00 | -385.78 | 10 | 7 |
|
| 65 |
Motif group J3_00210.1
Basepair signature:
|
0.00 | -388.22 | 13 | 10 |
|
| 66 |
Motif group J3_61124.2
Basepair signature:
|
0.00 | -389.06 | 7 | 3 |
|
| 67 |
Motif group J3_15893.1
Basepair signature:
|
0.00 | -391.43 | 8 | 6 |
C-di-AMP riboswitch |
| 68 |
Motif group J3_32857.1
Basepair signature:
|
0.00 | -392.83 | 11 | 8 |
|
| 69 |
Motif group J3_58090.1
Basepair signature:
|
0.00 | -393.06 | 10 | 6 |
|
| 70 |
Motif group J3_93637.1
Basepair signature:
|
0.00 | -393.16 | 10 | 7 |
|
| 71 |
Motif group J3_69441.1
Basepair signature:
|
0.00 | -394.70 | 12 | 9 |
|
| 72 |
Motif group J3_76375.1
Basepair signature:
|
0.00 | -396.34 | 13 | 10 |
|
| 73 |
Motif group J3_44163.2
Basepair signature:
|
0.00 | -396.83 | 12 | 9 |
|
| 74 |
Motif group J3_61367.1
Basepair signature:
|
0.00 | -396.93 | 17 | 16 |
|
| 75 |
Motif group J3_76911.2
Basepair signature:
|
0.00 | -397.60 | 9 | 6 |
|
| 76 |
Motif group J3_37089.1
Basepair signature:
|
0.00 | -398.63 | 10 | 6 |
|
| 77 |
Motif group J3_24127.1
Basepair signature:
|
0.00 | -399.38 | 7 | 5 |
|
| 78 |
Motif group J3_71753.1
Basepair signature:
|
0.00 | -399.40 | 14 | 10 |
|
| 79 |
Motif group J3_25217.1
Basepair signature:
|
0.00 | -401.92 | 8 | 4 |
|
| 80 |
Motif group J3_47707.1
Basepair signature:
|
0.00 | -407.12 | 14 | 10 |
|
| 81 |
Motif group J3_65990.1
Basepair signature:
|
0.00 | -407.43 | 10 | 8 |
|
| 82 |
Motif group J3_44724.7
Basepair signature:
|
0.00 | -411.78 | 7 | 4 |
|
| 83 |
Motif group J3_07703.1
Basepair signature:
|
0.00 | -412.50 | 11 | 7 |
|
| 84 |
Motif group J3_37047.6
Basepair signature:
|
0.00 | -416.44 | 12 | 10 |
|
| 85 |
Motif group J3_88233.1
Basepair signature:
|
0.00 | -417.40 | 11 | 9 |
|
| 86 |
Motif group J3_46299.2
Basepair signature:
|
0.00 | -417.41 | 13 | 10 |
|
| 87 |
Motif group J3_04315.1
Basepair signature:
|
0.00 | -418.51 | 13 | 12 |
|
| 88 |
Motif group J3_83516.4
Basepair signature:
|
0.00 | -419.79 | 20 | 17 |
|
| 89 |
Motif group J3_25303.4
Basepair signature:
|
0.00 | -420.35 | 11 | 10 |
|
| 90 |
Motif group J3_45099.1
Basepair signature:
|
0.00 | -420.77 | 13 | 11 |
|
| 91 |
Motif group J3_38881.1
Basepair signature:
|
0.00 | -422.50 | 12 | 10 |
|
| 92 |
Motif group J3_72575.1
Basepair signature:
|
0.00 | -426.37 | 9 | 6 |
|
| 93 |
Motif group J3_41486.2
Basepair signature:
|
0.00 | -428.07 | 7 | 3 |
|
| 94 |
Motif group J3_98379.3
Basepair signature:
|
0.00 | -428.47 | 11 | 8 |
|
| 95 |
Motif group J3_89044.1
Basepair signature:
|
0.00 | -429.71 | 10 | 6 |
|
| 96 |
Motif group J3_10118.1
Basepair signature:
|
0.00 | -430.33 | 9 | 4 |
|
| 97 |
Motif group J3_58525.1
Basepair signature:
|
0.00 | -431.03 | 14 | 12 |
|
| 98 |
Motif group J3_76475.2
Basepair signature:
|
0.00 | -431.88 | 12 | 10 |
|
| 99 |
Motif group J3_22198.1
Basepair signature:
|
0.00 | -437.33 | 8 | 4 |
|
| 100 |
Motif group J3_08394.3
Basepair signature:
|
0.00 | -445.87 | 14 | 11 |
|
| 101 |
Motif group J3_64069.1
Basepair signature:
|
0.00 | -446.20 | 10 | 8 |
|
| 102 |
Motif group J3_94999.1
Basepair signature:
|
0.00 | -446.85 | 8 | 5 |
|
| 103 |
Motif group J3_52655.4
Basepair signature:
|
0.00 | -448.30 | 7 | 5 |
|
| 104 |
Motif group J3_00458.1
Basepair signature:
|
0.00 | -449.23 | 16 | 12 |
|
| 105 |
Motif group J3_22899.1
Basepair signature:
|
0.00 | -453.47 | 14 | 12 |
|
| 106 |
Motif group J3_01425.1
Basepair signature:
|
0.00 | -459.37 | 8 | 4 |
|
| 107 |
Motif group J3_38098.1
Basepair signature:
|
0.00 | -465.05 | 20 | 19 |
|
| 108 |
Motif group J3_56052.5
Basepair signature:
|
0.00 | -467.28 | 6 | 3 |
|
| 109 |
Motif group J3_04521.1
Basepair signature:
|
0.00 | -468.93 | 9 | 6 |
|
| 110 |
Motif group J3_68440.1
Basepair signature:
|
0.00 | -472.75 | 11 | 9 |
|
| 111 |
Motif group J3_77951.1
Basepair signature:
|
0.00 | -474.59 | 15 | 13 |
|
| 112 |
Motif group J3_51910.1
Basepair signature:
|
0.00 | -477.79 | 11 | 6 |
|
| 113 |
Motif group J3_28315.1
Basepair signature:
|
0.00 | -479.99 | 8 | 5 |
|
| 114 |
Motif group J3_93261.1
Basepair signature:
|
0.00 | -480.88 | 21 | 20 |
|
| 115 |
Motif group J3_46317.4
Basepair signature:
|
0.00 | -483.64 | 12 | 11 |
|
| 116 |
Motif group J3_41339.1
Basepair signature:
|
0.00 | -484.63 | 15 | 13 |
|
| 117 |
Motif group J3_59706.1
Basepair signature:
|
0.00 | -485.75 | 15 | 13 |
|
| 118 |
Motif group J3_69466.1
Basepair signature:
|
0.00 | -486.06 | 22 | 20 |
|
| 119 |
Motif group J3_97280.1
Basepair signature:
|
0.00 | -489.40 | 14 | 11 |
|
| 120 |
Motif group J3_65403.1
Basepair signature:
|
0.00 | -489.58 | 16 | 13 |
|
| 121 |
Motif group J3_11934.4
Basepair signature:
|
0.00 | -505.27 | 11 | 8 |
|
| 122 |
Motif group J3_38151.1
Basepair signature:
|
0.00 | -505.90 | 7 | 4 |
|
| 123 |
Motif group J3_33494.1
Basepair signature:
|
0.00 | -506.39 | 9 | 4 |
|
| 124 |
Motif group J3_97971.2
Basepair signature:
|
0.00 | -512.20 | 10 | 7 |
|
| 125 |
Motif group J3_64189.2
Basepair signature:
|
0.00 | -519.73 | 7 | 5 |
|
| 126 |
Motif group J3_67856.4
Basepair signature:
|
0.00 | -528.63 | 10 | 7 |
|
| 127 |
Motif group J3_82365.4
Basepair signature:
|
0.00 | -535.15 | 8 | 4 |
|
| 128 |
Motif group J3_63687.1
Basepair signature:
|
0.00 | -545.13 | 22 | 18 |
|
| 129 |
Motif group J3_30040.2
Basepair signature:
|
0.00 | -547.91 | 21 | 18 |
|
| 130 |
Motif group J3_90186.1
Basepair signature:
|
0.00 | -557.74 | 18 | 15 |
|
| 131 |
Motif group J3_17791.2
Basepair signature:
|
0.00 | -559.20 | 16 | 14 |
|
| 132 |
Motif group J3_19664.1
Basepair signature:
|
0.00 | -569.53 | 18 | 16 |
|
| 133 |
Motif group J3_51249.1
Basepair signature:
|
0.00 | -573.70 | 9 | 5 |
|
| 134 |
Motif group J3_36821.1
Basepair signature:
|
0.00 | -574.02 | 7 | 4 |
|
| 135 |
Motif group J3_59914.1
Basepair signature:
|
0.00 | -579.41 | 8 | 4 |
|
| 136 |
Motif group J3_32601.5
Basepair signature:
|
0.00 | -588.55 | 10 | 7 |
|
| 137 |
Motif group J3_74474.1
Basepair signature:
|
0.00 | -629.18 | 18 | 15 |
|
| 138 |
Motif group J3_58429.1
Basepair signature:
|
0.00 | -634.34 | 25 | 24 |
|
| 139 |
Motif group J3_07845.1
Basepair signature:
|
0.00 | -636.29 | 7 | 3 |
|
| 140 |
Motif group J3_28621.5
Basepair signature:
|
0.00 | -638.43 | 10 | 7 |
|
| 141 |
Motif group J3_46124.1
Basepair signature:
|
0.00 | -638.78 | 20 | 19 |
|
| 142 |
Motif group J3_09667.1
Basepair signature:
|
0.00 | -649.00 | 9 | 5 |
|
| 143 |
Motif group J3_12003.2
Basepair signature:
|
0.00 | -652.22 | 7 | 4 |
|
| 144 |
Motif group J3_28460.1
Basepair signature:
|
0.00 | -660.58 | 27 | 27 |
|
| 145 |
Motif group J3_30478.1
Basepair signature:
|
0.00 | -666.08 | 8 | 3 |
|
| 146 |
Motif group J3_30104.1
Basepair signature:
|
0.00 | -670.09 | 7 | 3 |
|
| 147 |
Motif group J3_99595.1
Basepair signature:
|
0.00 | -676.77 | 8 | 4 |
|
| 148 |
Motif group J3_33327.1
Basepair signature:
|
0.00 | -684.61 | 26 | 24 |
|
| 149 |
Motif group J3_10708.1
Basepair signature:
|
0.00 | -688.80 | 21 | 18 |
|
| 150 |
Motif group J3_65214.1
Basepair signature:
|
0.00 | -701.27 | 21 | 19 |
|
| 151 |
Motif group J3_93059.1
Basepair signature:
|
0.00 | -712.86 | 12 | 8 |
|
| 152 |
Motif group J3_11375.2
Basepair signature:
|
0.00 | -721.74 | 9 | 6 |
|
| 153 |
Motif group J3_75076.1
Basepair signature:
|
0.00 | -727.54 | 28 | 26 |
|
| 154 |
Motif group J3_08040.1
Basepair signature:
|
0.00 | -757.62 | 22 | 21 |
|
| 155 |
Motif group J3_28639.1
Basepair signature:
|
0.00 | -772.21 | 17 | 15 |
|
| 156 |
Motif group J3_05216.1
Basepair signature:
|
0.00 | -806.35 | 8 | 5 |
|
| 157 |
Motif group J3_70599.1
Basepair signature:
|
0.00 | -834.52 | 9 | 7 |
|
| 158 |
Motif group J3_24879.1
Basepair signature:
|
0.00 | -842.02 | 23 | 20 |
|
| 159 |
Motif group J3_08158.1
Basepair signature:
|
0.00 | -843.33 | 32 | 31 |
|
| 160 |
Motif group J3_26675.1
Basepair signature:
|
0.00 | -854.64 | 9 | 7 |
|
| 161 |
Motif group J3_13378.1
Basepair signature:
|
0.00 | -869.82 | 33 | 32 |
|
| 162 |
Motif group J3_92134.2
Basepair signature:
|
0.00 | -871.40 | 20 | 18 |
|
| 163 |
Motif group J3_75962.2
Basepair signature:
|
0.00 | -910.10 | 7 | 5 |
|
| 164 |
Motif group J3_60031.2
Basepair signature:
|
0.00 | -963.19 | 11 | 8 |
|
| 165 |
Motif group J3_03190.1
Basepair signature:
|
0.00 | -9999.00 | 22 | 20 |
|