JAR3D
Query RF00011-CCF-3.98 completed
Run on Motif Atlas Version
using the Rfam secondary structure. Run with the CaCoFold secondary structure.
Rfam family RF00011 maps to these 104 chains: 1NBS|1|A, 1NBS|1|B, 2A64|1|A, 3DHS|1|A, 9OV3|1|A, 9OV6|1|A, 9OV7|1|A, 9OV8|1|A, 9OVB|1|A, 9OVC|1|A, 9OWJ|1|A, 9OWK|1|A, 9OWL|1|A, 9OWM|1|A, 9OWN|1|A, 9OWO|1|A, 9OWP|1|A, 9OWQ|1|A, 9OWS|1|A, 9OWT|1|A, 9OWU|1|A, 9OWV|1|A, 9OWW|1|A, 9OWX|1|A, 9OWY|1|A, 9OY2|1|A, 9OY3|1|A, 9OY4|1|A, 9ZDV|1|A, 9ZF2|1|A, 9ZF3|1|A, 9ZF5|1|A, 9ZF9|1|A, 9ZFC|1|A, 9ZFD|1|A, 9ZGM|1|A, 9ZGN|1|A, 9ZGO|1|A, 9ZGP|1|A, 9ZGQ|1|A, 9ZGR|1|A, 9ZGS|1|A, 9ZGT|1|A, 9ZGU|1|A, 9ZGV|1|A, 9ZGW|1|A, 9ZGX|1|A, 9ZGY|1|A, 9ZGZ|1|A, 9ZH0|1|A, 9ZH1|1|A, 9ZH2|1|A, 9ZH5|1|A, 9ZH7|1|A, 9ZH9|1|A, 9ZHA|1|A, 9ZHB|1|A, 9ZHC|1|A, 9ZHD|1|A, 9ZHE|1|A, 9ZHF|1|A, 9ZHG|1|A, 9ZHI|1|A, 9ZHJ|1|A, 9ZHK|1|A, 9ZHL|1|A, 9ZHO|1|A, 9ZHP|1|A, 9ZHR|1|A, 9ZHS|1|A, 9ZHT|1|A, 9ZHU|1|A, 9ZHV|1|A, 9ZHW|1|A, 9ZHX|1|A, 9ZHZ|1|A, 9ZI0|1|A, 9ZI2|1|A, 9ZI3|1|A, 9ZI4|1|A, 9ZI5|1|A, 9ZI6|1|A, 9ZI7|1|A, 9ZI8|1|A, 9ZI9|1|A, 9ZIB|1|A, 9ZIC|1|A, 9ZID|1|A, 9ZIE|1|A, 9ZIF|1|A, 9ZIG|1|A, 9ZIH|1|A, 9ZII|1|A, 9ZIJ|1|A, 9ZIK|1|A, 9ZIL|1|A, 9ZIM|1|A, 9ZIN|1|A, 9ZIU|1|A, 9ZIV|1|A, 9ZIW|1|A, 9ZIX|1|A, 9ZIY|1|A, 9ZIZ|1|A See more about them at RNA 3D Hub by filtering on the chain or the Rfam family.
Rfam family RF00011
is part of clan CL00002, which includes Rfam families
RF00009,
RF00373,
RF02357,
RF01577,
RF00011,
RF00010,
RF00030
.
There are 130 chains in PDB that we map to these Rfam families:
1NBS|1|A,
1NBS|1|B,
1U9S|1|A,
2A2E|1|A,
2A64|1|A,
3DHS|1|A,
3OK7|1|B,
3OKB|1|B,
3Q1Q|1|B,
3Q1R|1|B,
6AGB|1|A,
6AH3|1|A,
6AHR|1|A,
6AHU|1|A,
6K0A|1|X,
6K0A|1|Y,
6K0B|1|X,
6K0B|1|Y,
6W6V|1|A,
7C79|1|A,
7C7A|1|A,
7DA7|1|C,
7DAS|1|C,
7UO0|1|B,
7UO1|1|B,
7UO2|1|B,
7UO5|1|B,
9OV3|1|A,
9OV6|1|A,
9OV7|1|A,
9OV8|1|A,
9OVB|1|A,
9OVC|1|A,
9OWJ|1|A,
9OWK|1|A,
9OWL|1|A,
9OWM|1|A,
9OWN|1|A,
9OWO|1|A,
9OWP|1|A,
9OWQ|1|A,
9OWS|1|A,
9OWT|1|A,
9OWU|1|A,
9OWV|1|A,
9OWW|1|A,
9OWX|1|A,
9OWY|1|A,
9OY2|1|A,
9OY3|1|A,
9OY4|1|A,
9UH7|1|A,
9UH9|1|A,
9UHA|1|A,
9ZDV|1|A,
9ZF2|1|A,
9ZF3|1|A,
9ZF5|1|A,
9ZF9|1|A,
9ZFC|1|A,
9ZFD|1|A,
9ZGM|1|A,
9ZGN|1|A,
9ZGO|1|A,
9ZGP|1|A,
9ZGQ|1|A,
9ZGR|1|A,
9ZGS|1|A,
9ZGT|1|A,
9ZGU|1|A,
9ZGV|1|A,
9ZGW|1|A,
9ZGX|1|A,
9ZGY|1|A,
9ZGZ|1|A,
9ZH0|1|A,
9ZH1|1|A,
9ZH2|1|A,
9ZH5|1|A,
9ZH7|1|A,
9ZH9|1|A,
9ZHA|1|A,
9ZHB|1|A,
9ZHC|1|A,
9ZHD|1|A,
9ZHE|1|A,
9ZHF|1|A,
9ZHG|1|A,
9ZHI|1|A,
9ZHJ|1|A,
9ZHK|1|A,
9ZHL|1|A,
9ZHO|1|A,
9ZHP|1|A,
9ZHR|1|A,
9ZHS|1|A,
9ZHT|1|A,
9ZHU|1|A,
9ZHV|1|A,
9ZHW|1|A,
9ZHX|1|A,
9ZHZ|1|A,
9ZI0|1|A,
9ZI2|1|A,
9ZI3|1|A,
9ZI4|1|A,
9ZI5|1|A,
9ZI6|1|A,
9ZI7|1|A,
9ZI8|1|A,
9ZI9|1|A,
9ZIB|1|A,
9ZIC|1|A,
9ZID|1|A,
9ZIE|1|A,
9ZIF|1|A,
9ZIG|1|A,
9ZIH|1|A,
9ZII|1|A,
9ZIJ|1|A,
9ZIK|1|A,
9ZIL|1|A,
9ZIM|1|A,
9ZIN|1|A,
9ZIU|1|A,
9ZIV|1|A,
9ZIW|1|A,
9ZIX|1|A,
9ZIY|1|A,
9ZIZ|1|A
.
See them at RNA 3D Hub
by filtering on Rfam family, clan, or chain.
Loop 2 Hairpin loop
Column numbers: 31-76 - View nucleotides in PDB file(s)
Scored sequences and counts
CUU----------------------------------------UUG 5
CUU----------------------------------------AUG 4
AUAUUU-------------------------------------UAU 3
CGGUU--------------------------------------UCG 3
UUUU---------------------------------------ACA 2
GCC----------------------------------------AAC 2
UUC----------------------------------------AAA 2
UUC----------------------------------------CAA 2
UUU----------------------------------------UAA 2
UUU----------------------------------------UGA 2
UU-----------------------------------------UUA 2
-------------------------------------------AUA 2
-------------------------------------------GAA 2
AAUUAAAUAUAAUAAUUUUUUUAUAAUUGUUAUAUUUAACAAAUUU 1
AAUCAAAAUAUUAUUUUAUAAAUAUAAAUUAUAUUUUGA----UUA 1
AAUAUUGCAA---------------------------------UUU 1
AAAGAUAUA----------------------------------UUU 1
AAUCGUCUC----------------------------------GGC 1
CUUUUUUC-----------------------------------UGU 1
GCAAGUAA-----------------------------------GUC 1
AGAAUU-------------------------------------GCU 1
AGAAUU-------------------------------------UCU 1
AGGAUC-------------------------------------UCU 1
AGUUCG-------------------------------------UCU 1
AGUUUA-------------------------------------UCU 1
AUUUGA-------------------------------------UAU 1
AUUUUA-------------------------------------GAU 1
CUUUCU-------------------------------------UGG 1
CUUUUU-------------------------------------AGU 1
AGCUU--------------------------------------GCU 1
AGUCG--------------------------------------UCU 1
GAUUC--------------------------------------UUC 1
UGAAA--------------------------------------AAG 1
UUUAA--------------------------------------AUA 1
UUUUA--------------------------------------AAA 1
UUUUU--------------------------------------GUA 1
ACUU---------------------------------------GAU 1
CAUU---------------------------------------UGG 1
CCUU---------------------------------------ACG 1
CCUU---------------------------------------GAG 1
CUUC---------------------------------------UUG 1
CUUU---------------------------------------GUG 1
GCAA---------------------------------------GUC 1
GCUA---------------------------------------GAC 1
GCUA---------------------------------------GUC 1
GCUU---------------------------------------GUC 1
UUUU---------------------------------------AAU 1
AUA----------------------------------------UUU 1
AUU----------------------------------------GGU 1
CAU----------------------------------------CAG 1
CAU----------------------------------------CUG 1
CUU----------------------------------------AGA 1
CUU----------------------------------------AUA 1
CUU----------------------------------------CGG 1
CUU----------------------------------------UAG 1
GCA----------------------------------------UGC 1
GGA----------------------------------------AUC 1
GUA----------------------------------------AAC 1
GUU----------------------------------------UUC 1
UAU----------------------------------------UUC 1
UGU----------------------------------------AUA 1
UUC----------------------------------------UAA 1
UUU----------------------------------------AGA 1
UUU----------------------------------------AUU 1
UUU----------------------------------------CAA 1
UUU----------------------------------------GUA 1
AUU----------------------------------------UA- 1
UU-----------------------------------------GAU 1
UU-----------------------------------------GCA 1
UU-----------------------------------------GUA 1
A------------------------------------------AAG 1
A------------------------------------------GUU 1
A------------------------------------------UUU 1
G------------------------------------------UUU 1
U------------------------------------------CUU 1
U------------------------------------------GAA 1
-------------------------------------------AAU 1
-------------------------------------------GCG 1
-------------------------------------------UUU 1
-------------------------------------------CA- 1
-------------------------------------------CG- 1
Omitted sequenced and counts
---------------------------------------------- 12
-------------------------------------------U-- 1
Click on headings to reorder table
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_70782.2
Basepair signature:
|
48.51 | -782.73 | 3 | 2 |
|
| 2 |
Motif group HL_48417.5
Basepair signature:
|
45.54 | -257.51 | 3 | 2 |
|
| 3 |
Motif group HL_53890.2
Basepair signature:
|
43.56 | -490.59 | 3 | 2 |
|
| 4 |
Motif group HL_50006.2
Basepair signature:
|
41.58 | -472.54 | 4 | 2 |
|
| 5 |
Motif group HL_48778.2
Basepair signature:
|
40.59 | -807.70 | 2 | 1 |
Mini UNCG |
| 6 |
Motif group HL_75660.5
Basepair signature:
|
40.59 | -1540.52 | 3 | 2 |
|
| 7 |
Motif group HL_56334.1
Basepair signature:
|
39.60 | -1003.52 | 3 | 2 |
Mini UNCG |
| 8 |
Motif group HL_46501.1
Basepair signature:
|
35.64 | -408.60 | 3 | 2 |
|
| 9 |
Motif group HL_69752.2
Basepair signature:
|
35.64 | -1534.13 | 3 | 2 |
|
| 10 |
Motif group HL_43517.1
Basepair signature:
|
34.65 | -503.80 | 3 | 2 |
|
| 11 |
Motif group HL_32346.4
Basepair signature:
|
33.66 | -1029.66 | 2 | 2 |
|
| 12 |
Motif group HL_57875.1
Basepair signature:
|
32.67 | -492.17 | 3 | 2 |
|
| 13 |
Motif group HL_56131.2
Basepair signature:
|
28.71 | -273.79 | 3 | 3 |
|
| 14 |
Motif group HL_50318.1
Basepair signature:
|
26.73 | -299.61 | 5 | 4 |
|
| 15 |
Motif group HL_38901.2
Basepair signature:
|
26.73 | -622.61 | 3 | 2 |
tRNA D-loop |
| 16 |
Motif group HL_08100.1
Basepair signature:
|
25.74 | -497.58 | 4 | 2 |
|
| 17 |
Motif group HL_07886.3
Basepair signature:
|
23.76 | -507.25 | 4 | 2 |
|
| 18 |
Motif group HL_65313.1
Basepair signature:
|
23.76 | -1651.31 | 4 | 3 |
|
| 19 |
Motif group HL_56676.1
Basepair signature:
|
22.77 | -1060.20 | 4 | 2 |
|
| 20 |
Motif group HL_13189.1
Basepair signature:
|
21.78 | -300.67 | 3 | 3 |
|
| 21 |
Motif group HL_66103.1
Basepair signature:
|
21.78 | -508.85 | 4 | 3 |
|
| 22 |
Motif group HL_86870.2
Basepair signature:
|
20.79 | -503.07 | 4 | 2 |
|
| 23 |
Motif group HL_81100.2
Basepair signature:
|
20.79 | -3576.16 | 4 | 3 |
|
| 24 |
Motif group HL_34617.5
Basepair signature:
|
17.82 | -531.54 | 3 | 2 |
UNCG |
| 25 |
Motif group HL_57176.2
Basepair signature:
|
17.82 | -1445.54 | 4 | 2 |
Pseudoknot geometry with 3' bulge |
| 26 |
Motif group HL_28075.1
Basepair signature:
|
16.83 | -512.07 | 4 | 3 |
|
| 27 |
Motif group HL_37344.1
Basepair signature:
|
16.83 | -920.85 | 5 | 3 |
|
| 28 |
Motif group HL_13963.3
Basepair signature:
|
15.84 | -502.83 | 4 | 3 |
|
| 29 |
Motif group HL_55195.3
Basepair signature:
|
15.84 | -1789.60 | 3 | 2 |
|
| 30 |
Motif group HL_78347.4
Basepair signature:
|
14.85 | -307.09 | 4 | 3 |
|
| 31 |
Motif group HL_32392.1
Basepair signature:
|
14.85 | -429.19 | 3 | 2 |
|
| 32 |
Motif group HL_04783.2
Basepair signature:
|
14.85 | -510.91 | 3 | 3 |
|
| 33 |
Motif group HL_80709.3
Basepair signature:
|
14.85 | -1675.81 | 3 | 2 |
|
| 34 |
Motif group HL_71391.1
Basepair signature:
|
10.89 | -551.77 | 4 | 2 |
|
| 35 |
Motif group HL_93535.1
Basepair signature:
|
10.89 | -1246.45 | 4 | 3 |
|
| 36 |
Motif group HL_89199.2
Basepair signature:
|
10.89 | -1481.81 | 4 | 3 |
Mini UNCG |
| 37 |
Motif group HL_29966.1
Basepair signature:
|
10.89 | -1668.51 | 5 | 3 |
|
| 38 |
Motif group HL_86883.1
Basepair signature:
|
9.90 | -1680.86 | 4 | 3 |
|
| 39 |
Motif group HL_25967.2
Basepair signature:
|
8.91 | -897.27 | 4 | 3 |
|
| 40 |
Motif group HL_50537.6
Basepair signature:
|
8.91 | -1032.95 | 5 | 4 |
tRNA anticodon loop with synthetase |
| 41 |
Motif group HL_10453.3
Basepair signature:
|
8.91 | -1617.72 | 4 | 3 |
tRNA anticodon loop |
| 42 |
Motif group HL_27483.1
Basepair signature:
|
7.92 | -316.57 | 4 | 3 |
|
| 43 |
Motif group HL_37824.7
Basepair signature:
|
7.92 | -374.34 | 3 | 2 |
GNRA |
| 44 |
Motif group HL_78677.1
Basepair signature:
|
7.92 | -1068.96 | 3 | 3 |
|
| 45 |
Motif group HL_20535.2
Basepair signature:
|
7.92 | -1221.58 | 5 | 4 |
|
| 46 |
Motif group HL_31585.4
Basepair signature:
|
7.92 | -1871.87 | 4 | 2 |
Purine riboswitch |
| 47 |
Motif group HL_99040.1
Basepair signature:
|
7.92 | -2018.24 | 5 | 3 |
|
| 48 |
Motif group HL_94980.1
Basepair signature:
|
7.92 | -2838.42 | 4 | 3 |
|
| 49 |
Motif group HL_77436.5
Basepair signature:
|
6.93 | -546.91 | 4 | 3 |
T-loop related |
| 50 |
Motif group HL_38168.1
Basepair signature:
|
6.93 | -1559.69 | 4 | 3 |
|
| 51 |
Motif group HL_09452.1
Basepair signature:
|
6.93 | -4633.55 | 5 | 4 |
|
| 52 |
Motif group HL_26934.1
Basepair signature:
|
5.94 | -205.63 | 5 | 3 |
|
| 53 |
Motif group HL_35941.1
Basepair signature:
|
5.94 | -1066.37 | 4 | 3 |
|
| 54 |
Motif group HL_97917.2
Basepair signature:
|
5.94 | -1229.52 | 4 | 3 |
|
| 55 |
Motif group HL_60914.1
Basepair signature:
|
5.94 | -1831.28 | 5 | 3 |
|
| 56 |
Motif group HL_52953.3
Basepair signature:
|
5.94 | -2400.90 | 4 | 3 |
|
| 57 |
Motif group HL_80241.1
Basepair signature:
|
5.94 | -5442.47 | 5 | 4 |
|
| 58 |
Motif group HL_62934.1
Basepair signature:
|
4.95 | -556.93 | 5 | 4 |
|
| 59 |
Motif group HL_22135.1
Basepair signature:
|
4.95 | -1620.45 | 5 | 3 |
|
| 60 |
Motif group HL_65794.5
Basepair signature:
|
4.95 | -1984.26 | 3 | 3 |
Pseudoknot geometry |
| 61 |
Motif group HL_41464.2
Basepair signature:
|
3.96 | -328.08 | 5 | 4 |
|
| 62 |
Motif group HL_80922.2
Basepair signature:
|
3.96 | -528.12 | 4 | 3 |
|
| 63 |
Motif group HL_82710.2
Basepair signature:
|
3.96 | -556.91 | 5 | 3 |
|
| 64 |
Motif group HL_21372.1
Basepair signature:
|
3.96 | -1079.88 | 5 | 4 |
|
| 65 |
Motif group HL_77082.1
Basepair signature:
|
3.96 | -1116.65 | 4 | 3 |
Pseudoknot geometry |
| 66 |
Motif group HL_78197.1
Basepair signature:
|
3.96 | -2372.34 | 4 | 3 |
|
| 67 |
Motif group HL_30680.3
Basepair signature:
|
3.96 | -5780.76 | 4 | 3 |
Pseudoknot geometry |
| 68 |
Motif group HL_86012.1
Basepair signature:
|
2.97 | -195.90 | 6 | 4 |
T-loop with unstacked turn |
| 69 |
Motif group HL_04259.3
Basepair signature:
|
2.97 | -408.44 | 5 | 4 |
GNRA with extra cWW |
| 70 |
Motif group HL_42046.2
Basepair signature:
|
2.97 | -453.28 | 4 | 3 |
|
| 71 |
Motif group HL_22584.6
Basepair signature:
|
2.97 | -503.64 | 4 | 3 |
Fab BL3-6 binding hairpin with tSW |
| 72 |
Motif group HL_87954.2
Basepair signature:
|
2.97 | -554.07 | 4 | 3 |
|
| 73 |
Motif group HL_87553.1
Basepair signature:
|
2.97 | -557.39 | 4 | 4 |
|
| 74 |
Motif group HL_18565.1
Basepair signature:
|
2.97 | -704.81 | 6 | 5 |
|
| 75 |
Motif group HL_15802.1
Basepair signature:
|
2.97 | -716.85 | 6 | 5 |
|
| 76 |
Motif group HL_66853.7
Basepair signature:
|
2.97 | -773.84 | 6 | 5 |
|
| 77 |
Motif group HL_59843.1
Basepair signature:
|
2.97 | -1072.77 | 4 | 3 |
|
| 78 |
Motif group HL_47787.2
Basepair signature:
|
2.97 | -1241.92 | 4 | 2 |
|
| 79 |
Motif group HL_38046.1
Basepair signature:
|
2.97 | -1636.35 | 6 | 5 |
|
| 80 |
Motif group HL_26631.1
Basepair signature:
|
2.97 | -1733.29 | 4 | 3 |
|
| 81 |
Motif group HL_39243.1
Basepair signature:
|
2.97 | -1880.39 | 5 | 4 |
|
| 82 |
Motif group HL_76094.1
Basepair signature:
|
2.97 | -3198.65 | 4 | 3 |
|
| 83 |
Motif group HL_35677.3
Basepair signature:
|
2.97 | -4108.50 | 5 | 4 |
|
| 84 |
Motif group HL_73266.9
Basepair signature:
|
1.98 | -403.50 | 5 | 4 |
|
| 85 |
Motif group HL_28252.8
Basepair signature:
|
1.98 | -409.70 | 5 | 4 |
T-loop with 2 stacked bulged bases |
| 86 |
Motif group HL_01609.3
Basepair signature:
|
1.98 | -464.18 | 4 | 4 |
T-loop with 2 bulged bases not stacked |
| 87 |
Motif group HL_99748.1
Basepair signature:
|
1.98 | -932.20 | 5 | 4 |
Other HL |
| 88 |
Motif group HL_30068.2
Basepair signature:
|
1.98 | -1088.20 | 4 | 3 |
|
| 89 |
Motif group HL_81538.2
Basepair signature:
|
1.98 | -1183.02 | 4 | 3 |
GNRA with tandem sheared |
| 90 |
Motif group HL_80008.1
Basepair signature:
|
1.98 | -1345.60 | 6 | 5 |
|
| 91 |
Motif group HL_27670.2
Basepair signature:
|
1.98 | -1449.50 | 5 | 3 |
T-loop with unstacked turn |
| 92 |
Motif group HL_00914.1
Basepair signature:
|
1.98 | -1626.91 | 6 | 4 |
|
| 93 |
Motif group HL_83632.1
Basepair signature:
|
1.98 | -1717.29 | 5 | 4 |
tRNA anticodon loop |
| 94 |
Motif group HL_67667.2
Basepair signature:
|
1.98 | -2338.74 | 4 | 3 |
|
| 95 |
Motif group HL_28791.1
Basepair signature:
|
1.98 | -2424.03 | 5 | 3 |
|
| 96 |
Motif group HL_93324.4
Basepair signature:
|
1.98 | -2507.70 | 4 | 3 |
Pseudoknot geometry |
| 97 |
Motif group HL_32735.2
Basepair signature:
|
1.98 | -3346.58 | 4 | 4 |
|
| 98 |
Motif group HL_69139.1
Basepair signature:
|
1.98 | -3996.47 | 6 | 5 |
|
| 99 |
Motif group HL_77600.2
Basepair signature:
|
1.98 | -6720.08 | 5 | 4 |
|
| 100 |
Motif group HL_81545.2
Basepair signature:
|
0.99 | -242.19 | 6 | 4 |
|
| 101 |
Motif group HL_50860.2
Basepair signature:
|
0.99 | -244.67 | 6 | 5 |
|
| 102 |
Motif group HL_20167.2
Basepair signature:
|
0.99 | -259.03 | 4 | 4 |
|
| 103 |
Motif group HL_61996.2
Basepair signature:
|
0.99 | -261.02 | 5 | 4 |
|
| 104 |
Motif group HL_13529.1
Basepair signature:
|
0.99 | -296.47 | 5 | 3 |
|
| 105 |
Motif group HL_07583.1
Basepair signature:
|
0.99 | -321.69 | 9 | 7 |
|
| 106 |
Motif group HL_89567.2
Basepair signature:
|
0.99 | -490.86 | 5 | 4 |
|
| 107 |
Motif group HL_20811.4
Basepair signature:
|
0.99 | -507.75 | 4 | 3 |
tRNA D-loop |
| 108 |
Motif group HL_49922.4
Basepair signature:
|
0.99 | -552.64 | 3 | 3 |
|
| 109 |
Motif group HL_18978.1
Basepair signature:
|
0.99 | -647.06 | 6 | 5 |
|
| 110 |
Motif group HL_98252.1
Basepair signature:
|
0.99 | -764.23 | 7 | 6 |
|
| 111 |
Motif group HL_84299.4
Basepair signature:
|
0.99 | -901.11 | 5 | 4 |
|
| 112 |
Motif group HL_73255.1
Basepair signature:
|
0.99 | -910.62 | 6 | 6 |
|
| 113 |
Motif group HL_64690.6
Basepair signature:
|
0.99 | -954.00 | 5 | 4 |
|
| 114 |
Motif group HL_89881.5
Basepair signature:
|
0.99 | -967.38 | 6 | 5 |
|
| 115 |
Motif group HL_87463.1
Basepair signature:
|
0.99 | -1031.91 | 6 | 5 |
|
| 116 |
Motif group HL_25061.1
Basepair signature:
|
0.99 | -1328.23 | 6 | 5 |
|
| 117 |
Motif group HL_99769.3
Basepair signature:
|
0.99 | -1339.30 | 6 | 6 |
|
| 118 |
Motif group HL_72628.1
Basepair signature:
|
0.99 | -1372.83 | 6 | 5 |
|
| 119 |
Motif group HL_06059.6
Basepair signature:
|
0.99 | -1446.21 | 4 | 3 |
tRNA anticodon loop |
| 120 |
Motif group HL_02817.2
Basepair signature:
|
0.99 | -1540.98 | 5 | 4 |
|
| 121 |
Motif group HL_85367.2
Basepair signature:
|
0.99 | -1668.72 | 5 | 4 |
|
| 122 |
Motif group HL_38808.1
Basepair signature:
|
0.99 | -1845.66 | 5 | 4 |
|
| 123 |
Motif group HL_08510.1
Basepair signature:
|
0.99 | -2157.97 | 6 | 5 |
|
| 124 |
Motif group HL_42998.2
Basepair signature:
|
0.99 | -3032.12 | 6 | 4 |
|
| 125 |
Motif group HL_22622.1
Basepair signature:
|
0.99 | -4722.69 | 5 | 4 |
|
| 126 |
Motif group HL_59735.5
Basepair signature:
|
0.99 | -6115.96 | 5 | 4 |
|
| 127 |
Motif group HL_97983.1
Basepair signature:
|
0.99 | -6209.25 | 7 | 5 |
|
| 128 |
Motif group HL_20743.5
Basepair signature:
|
0.00 | -242.67 | 5 | 4 |
|
| 129 |
Motif group HL_93438.2
Basepair signature:
|
0.00 | -247.78 | 5 | 5 |
|
| 130 |
Motif group HL_41543.1
Basepair signature:
|
0.00 | -259.68 | 7 | 6 |
|
| 131 |
Motif group HL_67079.1
Basepair signature:
|
0.00 | -268.08 | 6 | 5 |
|
| 132 |
Motif group HL_41902.1
Basepair signature:
|
0.00 | -286.59 | 9 | 8 |
|
| 133 |
Motif group HL_86769.4
Basepair signature:
|
0.00 | -307.88 | 5 | 4 |
|
| 134 |
Motif group HL_08602.1
Basepair signature:
|
0.00 | -315.59 | 9 | 8 |
|
| 135 |
Motif group HL_36335.1
Basepair signature:
|
0.00 | -317.39 | 8 | 7 |
|
| 136 |
Motif group HL_83808.4
Basepair signature:
|
0.00 | -325.11 | 6 | 5 |
Pseudoknot |
| 137 |
Motif group HL_02887.3
Basepair signature:
|
0.00 | -326.98 | 7 | 6 |
T-loop with 3 stacked bulged bases |
| 138 |
Motif group HL_74055.2
Basepair signature:
|
0.00 | -327.06 | 10 | 9 |
|
| 139 |
Motif group HL_04171.7
Basepair signature:
|
0.00 | -333.61 | 6 | 6 |
|
| 140 |
Motif group HL_68767.1
Basepair signature:
|
0.00 | -341.60 | 9 | 8 |
tRNA D-loop |
| 141 |
Motif group HL_13971.1
Basepair signature:
|
0.00 | -348.93 | 9 | 9 |
|
| 142 |
Motif group HL_53504.3
Basepair signature:
|
0.00 | -366.77 | 7 | 6 |
|
| 143 |
Motif group HL_74379.3
Basepair signature:
|
0.00 | -369.81 | 8 | 7 |
|
| 144 |
Motif group HL_14757.1
Basepair signature:
|
0.00 | -378.82 | 12 | 12 |
|
| 145 |
Motif group HL_49941.1
Basepair signature:
|
0.00 | -389.94 | 7 | 6 |
tRNA D-loop |
| 146 |
Motif group HL_70658.1
Basepair signature:
|
0.00 | -393.39 | 8 | 7 |
|
| 147 |
Motif group HL_86109.1
Basepair signature:
|
0.00 | -398.38 | 9 | 8 |
|
| 148 |
Motif group HL_01962.2
Basepair signature:
|
0.00 | -402.72 | 7 | 5 |
|
| 149 |
Motif group HL_18423.1
Basepair signature:
|
0.00 | -403.71 | 7 | 6 |
|
| 150 |
Motif group HL_90620.1
Basepair signature:
|
0.00 | -404.61 | 8 | 7 |
|
| 151 |
Motif group HL_25847.2
Basepair signature:
|
0.00 | -415.87 | 7 | 6 |
|
| 152 |
Motif group HL_81205.3
Basepair signature:
|
0.00 | -422.76 | 10 | 9 |
|
| 153 |
Motif group HL_84847.1
Basepair signature:
|
0.00 | -424.17 | 10 | 9 |
|
| 154 |
Motif group HL_88205.2
Basepair signature:
|
0.00 | -435.47 | 6 | 5 |
|
| 155 |
Motif group HL_60266.1
Basepair signature:
|
0.00 | -440.71 | 8 | 7 |
|
| 156 |
Motif group HL_91641.1
Basepair signature:
|
0.00 | -441.53 | 12 | 11 |
|
| 157 |
Motif group HL_40252.4
Basepair signature:
|
0.00 | -447.73 | 8 | 7 |
|
| 158 |
Motif group HL_73247.1
Basepair signature:
|
0.00 | -449.26 | 10 | 9 |
Pseudoknot geometry |
| 159 |
Motif group HL_98870.1
Basepair signature:
|
0.00 | -477.36 | 11 | 10 |
|
| 160 |
Motif group HL_10540.1
Basepair signature:
|
0.00 | -534.59 | 5 | 4 |
|
| 161 |
Motif group HL_97756.2
Basepair signature:
|
0.00 | -570.68 | 10 | 9 |
|
| 162 |
Motif group HL_68257.1
Basepair signature:
|
0.00 | -606.66 | 7 | 6 |
|
| 163 |
Motif group HL_92488.1
Basepair signature:
|
0.00 | -632.75 | 12 | 11 |
|
| 164 |
Motif group HL_98864.1
Basepair signature:
|
0.00 | -652.43 | 6 | 5 |
T-loop with unstacked turn |
| 165 |
Motif group HL_06226.4
Basepair signature:
|
0.00 | -684.92 | 7 | 6 |
|
| 166 |
Motif group HL_23509.1
Basepair signature:
|
0.00 | -698.92 | 8 | 7 |
|
| 167 |
Motif group HL_91939.2
Basepair signature:
|
0.00 | -701.74 | 8 | 7 |
|
| 168 |
Motif group HL_16991.1
Basepair signature:
|
0.00 | -705.07 | 9 | 8 |
G-quadruplex fragment |
| 169 |
Motif group HL_57863.1
Basepair signature:
|
0.00 | -712.46 | 7 | 6 |
G-quadruplex fragment |
| 170 |
Motif group HL_45175.1
Basepair signature:
|
0.00 | -715.57 | 6 | 5 |
tRNA D-loop |
| 171 |
Motif group HL_51921.1
Basepair signature:
|
0.00 | -724.34 | 15 | 15 |
|
| 172 |
Motif group HL_04642.1
Basepair signature:
|
0.00 | -724.67 | 7 | 6 |
tRNA D-loop |
| 173 |
Motif group HL_07480.2
Basepair signature:
|
0.00 | -733.90 | 8 | 7 |
|
| 174 |
Motif group HL_02581.1
Basepair signature:
|
0.00 | -738.06 | 10 | 10 |
tRNA D-loop |
| 175 |
Motif group HL_34964.1
Basepair signature:
|
0.00 | -865.67 | 6 | 6 |
|
| 176 |
Motif group HL_75293.5
Basepair signature:
|
0.00 | -881.62 | 5 | 5 |
|
| 177 |
Motif group HL_37369.2
Basepair signature:
|
0.00 | -902.33 | 4 | 3 |
|
| 178 |
Motif group HL_45785.1
Basepair signature:
|
0.00 | -990.84 | 8 | 6 |
|
| 179 |
Motif group HL_89893.1
Basepair signature:
|
0.00 | -991.57 | 5 | 4 |
|
| 180 |
Motif group HL_02483.1
Basepair signature:
|
0.00 | -999.18 | 8 | 7 |
|
| 181 |
Motif group HL_93616.2
Basepair signature:
|
0.00 | -1000.61 | 7 | 7 |
tRNA D-loop |
| 182 |
Motif group HL_85434.1
Basepair signature:
|
0.00 | -1003.94 | 7 | 5 |
|
| 183 |
Motif group HL_47854.1
Basepair signature:
|
0.00 | -1032.19 | 7 | 5 |
|
| 184 |
Motif group HL_05304.3
Basepair signature:
|
0.00 | -1049.59 | 8 | 7 |
|
| 185 |
Motif group HL_58224.1
Basepair signature:
|
0.00 | -1095.86 | 7 | 6 |
|
| 186 |
Motif group HL_29129.3
Basepair signature:
|
0.00 | -1129.73 | 7 | 6 |
|
| 187 |
Motif group HL_23010.1
Basepair signature:
|
0.00 | -1153.58 | 8 | 7 |
|
| 188 |
Motif group HL_04641.1
Basepair signature:
|
0.00 | -1160.08 | 8 | 6 |
|
| 189 |
Motif group HL_33983.1
Basepair signature:
|
0.00 | -1249.09 | 6 | 5 |
|
| 190 |
Motif group HL_53454.2
Basepair signature:
|
0.00 | -1310.15 | 6 | 5 |
|
| 191 |
Motif group HL_11542.1
Basepair signature:
|
0.00 | -1468.36 | 10 | 9 |
|
| 192 |
Motif group HL_97733.1
Basepair signature:
|
0.00 | -1485.53 | 7 | 6 |
|
| 193 |
Motif group HL_93383.1
Basepair signature:
|
0.00 | -1887.55 | 6 | 5 |
|
| 194 |
Motif group HL_15574.1
Basepair signature:
|
0.00 | -1946.01 | 5 | 4 |
|
| 195 |
Motif group HL_38649.1
Basepair signature:
|
0.00 | -2278.52 | 7 | 7 |
|
| 196 |
Motif group HL_55436.1
Basepair signature:
|
0.00 | -2343.04 | 6 | 6 |
|
| 197 |
Motif group HL_10456.1
Basepair signature:
|
0.00 | -2646.91 | 14 | 13 |
|
| 198 |
Motif group HL_66482.1
Basepair signature:
|
0.00 | -2650.20 | 13 | 12 |
|
| 199 |
Motif group HL_33074.4
Basepair signature:
|
0.00 | -2984.77 | 8 | 7 |
U1 small nuclear ribonucleoprotein A binding hairpin |
| 200 |
Motif group HL_89346.1
Basepair signature:
|
0.00 | -3064.55 | 13 | 13 |
|
| 201 |
Motif group HL_80599.2
Basepair signature:
|
0.00 | -3134.51 | 5 | 4 |
|
| 202 |
Motif group HL_20751.2
Basepair signature:
|
0.00 | -3146.01 | 9 | 9 |
|
| 203 |
Motif group HL_23115.1
Basepair signature:
|
0.00 | -3312.90 | 8 | 7 |
tRNA D-loop |
| 204 |
Motif group HL_91503.7
Basepair signature:
|
0.00 | -3447.38 | 6 | 6 |
|
| 205 |
Motif group HL_88558.1
Basepair signature:
|
0.00 | -3477.09 | 8 | 7 |
|
| 206 |
Motif group HL_80411.1
Basepair signature:
|
0.00 | -3484.54 | 8 | 7 |
tRNA D-loop |
| 207 |
Motif group HL_29762.1
Basepair signature:
|
0.00 | -3500.74 | 6 | 5 |
|
| 208 |
Motif group HL_59330.1
Basepair signature:
|
0.00 | -3542.56 | 5 | 4 |
|
| 209 |
Motif group HL_93135.1
Basepair signature:
|
0.00 | -3673.27 | 7 | 6 |
Pseudoknot |
| 210 |
Motif group HL_12870.1
Basepair signature:
|
0.00 | -3688.21 | 9 | 8 |
|
| 211 |
Motif group HL_50851.1
Basepair signature:
|
0.00 | -3718.28 | 9 | 8 |
G-quadruplex fragment |
| 212 |
Motif group HL_50779.4
Basepair signature:
|
0.00 | -3781.20 | 7 | 6 |
|
| 213 |
Motif group HL_67407.5
Basepair signature:
|
0.00 | -3815.41 | 7 | 6 |
|
| 214 |
Motif group HL_73183.1
Basepair signature:
|
0.00 | -3819.12 | 11 | 11 |
Pseudoknot geometry with G-bulge |
| 215 |
Motif group HL_80362.1
Basepair signature:
|
0.00 | -3880.30 | 6 | 5 |
|
| 216 |
Motif group HL_99324.1
Basepair signature:
|
0.00 | -3974.91 | 11 | 11 |
|
| 217 |
Motif group HL_81312.1
Basepair signature:
|
0.00 | -3978.26 | 7 | 7 |
|
| 218 |
Motif group HL_59564.1
Basepair signature:
|
0.00 | -3982.50 | 15 | 14 |
|
| 219 |
Motif group HL_04725.1
Basepair signature:
|
0.00 | -3982.66 | 7 | 6 |
|
| 220 |
Motif group HL_19210.3
Basepair signature:
|
0.00 | -4001.87 | 6 | 5 |
|
| 221 |
Motif group HL_00317.1
Basepair signature:
|
0.00 | -4025.01 | 15 | 14 |
|
| 222 |
Motif group HL_85461.1
Basepair signature:
|
0.00 | -4027.51 | 14 | 14 |
|
| 223 |
Motif group HL_12758.3
Basepair signature:
|
0.00 | -4048.96 | 21 | 20 |
G-quadruplex |
| 224 |
Motif group HL_21400.1
Basepair signature:
|
0.00 | -4060.19 | 18 | 17 |
G-quadruplex |
| 225 |
Motif group HL_60293.1
Basepair signature:
|
0.00 | -4063.24 | 17 | 16 |
G-quadruplex |
| 226 |
Motif group HL_35354.1
Basepair signature:
|
0.00 | -4068.75 | 19 | 18 |
|
| 227 |
Motif group HL_24792.1
Basepair signature:
|
0.00 | -4069.31 | 7 | 5 |
|
| 228 |
Motif group HL_55305.1
Basepair signature:
|
0.00 | -4108.71 | 8 | 7 |
|
| 229 |
Motif group HL_07903.1
Basepair signature:
|
0.00 | -4164.80 | 10 | 9 |
|
| 230 |
Motif group HL_31581.6
Basepair signature:
|
0.00 | -4167.63 | 7 | 7 |
|
| 231 |
Motif group HL_01255.1
Basepair signature:
|
0.00 | -4223.27 | 8 | 7 |
|
| 232 |
Motif group HL_63355.1
Basepair signature:
|
0.00 | -4226.00 | 10 | 9 |
|
| 233 |
Motif group HL_16398.2
Basepair signature:
|
0.00 | -4412.65 | 10 | 8 |
|
| 234 |
Motif group HL_15118.1
Basepair signature:
|
0.00 | -4455.20 | 8 | 7 |
|
| 235 |
Motif group HL_94376.1
Basepair signature:
|
0.00 | -4519.82 | 7 | 6 |
Pseudoknot geometry |
| 236 |
Motif group HL_85993.1
Basepair signature:
|
0.00 | -4540.37 | 6 | 5 |
|
| 237 |
Motif group HL_47732.1
Basepair signature:
|
0.00 | -4556.51 | 9 | 8 |
|
| 238 |
Motif group HL_73916.1
Basepair signature:
|
0.00 | -4569.50 | 34 | 34 |
|
| 239 |
Motif group HL_70751.1
Basepair signature:
|
0.00 | -4634.94 | 7 | 6 |
|
| 240 |
Motif group HL_64292.1
Basepair signature:
|
0.00 | -4651.68 | 12 | 11 |
|
| 241 |
Motif group HL_51447.1
Basepair signature:
|
0.00 | -4715.20 | 5 | 4 |
|
| 242 |
Motif group HL_29958.1
Basepair signature:
|
0.00 | -4723.21 | 9 | 8 |
|
| 243 |
Motif group HL_36684.4
Basepair signature:
|
0.00 | -4761.12 | 6 | 5 |
|
| 244 |
Motif group HL_88364.2
Basepair signature:
|
0.00 | -4797.17 | 10 | 10 |
|
| 245 |
Motif group HL_50418.1
Basepair signature:
|
0.00 | -4873.71 | 7 | 6 |
|
| 246 |
Motif group HL_74292.1
Basepair signature:
|
0.00 | -5215.65 | 8 | 7 |
|
| 247 |
Motif group HL_20781.1
Basepair signature:
|
0.00 | -5462.29 | 8 | 7 |
|
| 248 |
Motif group HL_78284.1
Basepair signature:
|
0.00 | -5472.53 | 8 | 7 |
|
| 249 |
Motif group HL_68572.1
Basepair signature:
|
0.00 | -5658.91 | 9 | 8 |
|
| 250 |
Motif group HL_99867.1
Basepair signature:
|
0.00 | -5766.13 | 6 | 4 |
|
| 251 |
Motif group HL_58539.1
Basepair signature:
|
0.00 | -6614.09 | 11 | 10 |
|
| 252 |
Motif group HL_07951.3
Basepair signature:
|
0.00 | -9999.00 | 6 | 5 |
tRNA D-loop |
| 253 |
Motif group HL_09260.2
Basepair signature:
|
0.00 | -9999.00 | 7 | 7 |
tRNA D-loop |