JAR3D
Query RF02032-3.98 completed
Run on Motif Atlas Version
using the Rfam secondary structure. Run with the CaCoFold secondary structure.
Rfam family RF02032 maps to these 73 chains: 9L0R|1|A, 9L0R|1|B, 9L0R|1|C, 9L0R|1|D, 9L0R|1|E, 9L0R|1|F, 9L0R|1|G, 9L0R|1|H, 9L0R|1|I, 9L0R|1|J, 9L0R|1|K, 9L0R|1|L, 9LEC|1|J, 9LEE|1|A, 9LEE|1|B, 9LEE|1|C, 9LEE|1|D, 9LEE|1|E, 9LEE|1|F, 9LEE|1|G, 9LEE|1|H, 9LEE|1|I, 9LEE|1|J, 9LEL|1|J, 9LEM|1|A, 9LEM|1|B, 9LEM|1|C, 9LEM|1|D, 9LEM|1|E, 9LEM|1|F, 9LEM|1|G, 9LEM|1|H, 9LEM|1|I, 9LEM|1|J, 9LHK|1|G, 9LHL|1|A, 9LHL|1|B, 9LHL|1|C, 9LHL|1|D, 9LHL|1|E, 9LHL|1|F, 9LHL|1|G, 9LHL|1|H, 9LHL|1|I, 9LHL|1|J, 9LHL|1|K, 9LHL|1|L, 9LHL|1|M, 9LHL|1|N, 9LMF|1|A, 9LMF|1|B, 9LMF|1|C, 9LMF|1|D, 9LMF|1|E, 9LMF|1|F, 9LMF|1|G, 9LMF|1|H, 9LMF|1|I, 9LMF|1|J, 9MEE|1|A, 9MEE|1|B, 9MEE|1|C, 9MEE|1|D, 9MEE|1|E, 9MEE|1|F, 9MEE|1|G, 9MEE|1|H, 9MEE|1|I, 9MEE|1|J, 9MEE|1|K, 9MEE|1|L, 9MEE|1|M, 9MEE|1|N See more about them at RNA 3D Hub by filtering on the chain or the Rfam family.
Loop 14 Hairpin loop
Column numbers: 376-400 - View nucleotides in PDB file(s)
Scored sequences and counts
CCGCAA------------------G 5
UCGCAA------------------G 5
GAGGCA-----------------UC 4
GUGGCA-----------------AC 3
CCGGCA-----------------GG 2
UUGCAAAGCGUGGUUUUAAUACCAC 1
AAGGCA-----------------UU 1
GGGGCA-----------------CC 1
UCGGCA-----------------GA 1
UCGGCA-----------------GG 1
Omitted sequenced and counts
------------------------- 11
Click on headings to reorder table
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group HL_85993.1
Basepair signature:
|
79.17 | -338.91 | 4 | 2 |
|
| 2 |
Motif group HL_18565.1
Basepair signature:
|
70.83 | -285.40 | 4 | 2 |
|
| 3 |
Motif group HL_04259.3
Basepair signature:
|
70.83 | -451.92 | 2 | 2 |
GNRA with extra cWW |
| 4 |
Motif group HL_87553.1
Basepair signature:
|
58.33 | -431.37 | 3 | 2 |
|
| 5 |
Motif group HL_10540.1
Basepair signature:
|
54.17 | -420.63 | 3 | 2 |
|
| 6 |
Motif group HL_37369.2
Basepair signature:
|
41.67 | -330.18 | 3 | 2 |
|
| 7 |
Motif group HL_10453.3
Basepair signature:
|
41.67 | -410.48 | 3 | 3 |
tRNA anticodon loop |
| 8 |
Motif group HL_53890.2
Basepair signature:
|
41.67 | -507.95 | 3 | 2 |
|
| 9 |
Motif group HL_01609.3
Basepair signature:
|
33.33 | -370.67 | 3 | 3 |
T-loop with 2 bulged bases not stacked |
| 10 |
Motif group HL_30680.3
Basepair signature:
|
33.33 | -460.31 | 3 | 2 |
Pseudoknot geometry |
| 11 |
Motif group HL_22622.1
Basepair signature:
|
25.00 | -405.51 | 5 | 4 |
|
| 12 |
Motif group HL_09452.1
Basepair signature:
|
20.83 | -406.74 | 5 | 4 |
|
| 13 |
Motif group HL_28075.1
Basepair signature:
|
20.83 | -475.82 | 4 | 4 |
|
| 14 |
Motif group HL_30068.2
Basepair signature:
|
20.83 | -477.40 | 4 | 3 |
|
| 15 |
Motif group HL_78347.4
Basepair signature:
|
20.83 | -492.56 | 4 | 3 |
|
| 16 |
Motif group HL_56131.2
Basepair signature:
|
20.83 | -497.61 | 3 | 3 |
|
| 17 |
Motif group HL_13963.3
Basepair signature:
|
20.83 | -502.93 | 4 | 3 |
|
| 18 |
Motif group HL_66103.1
Basepair signature:
|
20.83 | -516.76 | 4 | 3 |
|
| 19 |
Motif group HL_70782.2
Basepair signature:
|
20.83 | -524.63 | 3 | 3 |
|
| 20 |
Motif group HL_97733.1
Basepair signature:
|
16.67 | -300.79 | 5 | 4 |
|
| 21 |
Motif group HL_26934.1
Basepair signature:
|
12.50 | -292.44 | 5 | 3 |
|
| 22 |
Motif group HL_50860.2
Basepair signature:
|
12.50 | -303.65 | 4 | 3 |
|
| 23 |
Motif group HL_83632.1
Basepair signature:
|
12.50 | -356.16 | 3.5 | 3 |
tRNA anticodon loop |
| 24 |
Motif group HL_80008.1
Basepair signature:
|
12.50 | -362.54 | 4 | 3 |
|
| 25 |
Motif group HL_41464.2
Basepair signature:
|
12.50 | -471.38 | 5 | 4 |
|
| 26 |
Motif group HL_59330.1
Basepair signature:
|
4.17 | -310.93 | 5 | 4 |
|
| 27 |
Motif group HL_93438.2
Basepair signature:
|
0.00 | -100.42 | 5 | 4 |
|
| 28 |
Motif group HL_68257.1
Basepair signature:
|
0.00 | -109.78 | 7 | 6 |
|
| 29 |
Motif group HL_20167.2
Basepair signature:
|
0.00 | -117.80 | 4 | 4 |
|
| 30 |
Motif group HL_41543.1
Basepair signature:
|
0.00 | -121.84 | 7 | 6 |
|
| 31 |
Motif group HL_77436.5
Basepair signature:
|
0.00 | -127.90 | 3 | 3 |
T-loop related |
| 32 |
Motif group HL_74379.3
Basepair signature:
|
0.00 | -135.55 | 8 | 6 |
|
| 33 |
Motif group HL_36335.1
Basepair signature:
|
0.00 | -139.44 | 6 | 5 |
|
| 34 |
Motif group HL_41902.1
Basepair signature:
|
0.00 | -143.07 | 7 | 6 |
|
| 35 |
Motif group HL_90620.1
Basepair signature:
|
0.00 | -147.78 | 7 | 6 |
|
| 36 |
Motif group HL_67079.1
Basepair signature:
|
0.00 | -149.49 | 6 | 6 |
|
| 37 |
Motif group HL_53454.2
Basepair signature:
|
0.00 | -150.26 | 5 | 4 |
|
| 38 |
Motif group HL_91939.2
Basepair signature:
|
0.00 | -154.67 | 6 | 5 |
|
| 39 |
Motif group HL_40252.4
Basepair signature:
|
0.00 | -158.14 | 6 | 5 |
|
| 40 |
Motif group HL_70658.1
Basepair signature:
|
0.00 | -167.24 | 9 | 7 |
|
| 41 |
Motif group HL_11542.1
Basepair signature:
|
0.00 | -169.89 | 7 | 6 |
|
| 42 |
Motif group HL_23509.1
Basepair signature:
|
0.00 | -173.20 | 10 | 8 |
|
| 43 |
Motif group HL_86109.1
Basepair signature:
|
0.00 | -173.56 | 8 | 7 |
|
| 44 |
Motif group HL_84847.1
Basepair signature:
|
0.00 | -181.72 | 8 | 7 |
|
| 45 |
Motif group HL_05304.3
Basepair signature:
|
0.00 | -182.47 | 8.5 | 7 |
|
| 46 |
Motif group HL_81205.3
Basepair signature:
|
0.00 | -190.01 | 9 | 7 |
|
| 47 |
Motif group HL_20751.2
Basepair signature:
|
0.00 | -192.04 | 8 | 8 |
|
| 48 |
Motif group HL_60266.1
Basepair signature:
|
0.00 | -198.65 | 8 | 7 |
|
| 49 |
Motif group HL_07583.1
Basepair signature:
|
0.00 | -207.65 | 10 | 9 |
|
| 50 |
Motif group HL_74055.2
Basepair signature:
|
0.00 | -211.58 | 8 | 8 |
|
| 51 |
Motif group HL_08602.1
Basepair signature:
|
0.00 | -212.14 | 8 | 7 |
|
| 52 |
Motif group HL_53504.3
Basepair signature:
|
0.00 | -214.53 | 6 | 6 |
|
| 53 |
Motif group HL_68767.1
Basepair signature:
|
0.00 | -215.57 | 8 | 7 |
tRNA D-loop |
| 54 |
Motif group HL_02581.1
Basepair signature:
|
0.00 | -218.73 | 9 | 8 |
tRNA D-loop |
| 55 |
Motif group HL_73247.1
Basepair signature:
|
0.00 | -222.33 | 8 | 8 |
Pseudoknot geometry |
| 56 |
Motif group HL_98870.1
Basepair signature:
|
0.00 | -234.98 | 9.5 | 9 |
|
| 57 |
Motif group HL_91641.1
Basepair signature:
|
0.00 | -257.29 | 11 | 10 |
|
| 58 |
Motif group HL_98864.1
Basepair signature:
|
0.00 | -258.98 | 4.5 | 4 |
T-loop with unstacked turn |
| 59 |
Motif group HL_10456.1
Basepair signature:
|
0.00 | -275.33 | 12 | 11 |
|
| 60 |
Motif group HL_02887.3
Basepair signature:
|
0.00 | -278.52 | 5 | 4 |
T-loop with 3 stacked bulged bases |
| 61 |
Motif group HL_57863.1
Basepair signature:
|
0.00 | -280.73 | 5.5 | 5 |
G-quadruplex fragment |
| 62 |
Motif group HL_14757.1
Basepair signature:
|
0.00 | -285.45 | 12 | 11 |
|
| 63 |
Motif group HL_83808.4
Basepair signature:
|
0.00 | -293.14 | 5 | 5 |
Pseudoknot |
| 64 |
Motif group HL_86012.1
Basepair signature:
|
0.00 | -299.95 | 6 | 5 |
T-loop with unstacked turn |
| 65 |
Motif group HL_18978.1
Basepair signature:
|
0.00 | -302.70 | 5.5 | 5 |
|
| 66 |
Motif group HL_87463.1
Basepair signature:
|
0.00 | -305.77 | 6 | 5 |
|
| 67 |
Motif group HL_04642.1
Basepair signature:
|
0.00 | -310.17 | 5 | 5 |
tRNA D-loop |
| 68 |
Motif group HL_58224.1
Basepair signature:
|
0.00 | -313.89 | 5 | 5 |
|
| 69 |
Motif group HL_16991.1
Basepair signature:
|
0.00 | -315.25 | 7 | 6 |
G-quadruplex fragment |
| 70 |
Motif group HL_15802.1
Basepair signature:
|
0.00 | -320.95 | 6 | 5 |
|
| 71 |
Motif group HL_66853.7
Basepair signature:
|
0.00 | -325.08 | 5 | 5 |
|
| 72 |
Motif group HL_89881.5
Basepair signature:
|
0.00 | -326.15 | 6 | 5.5 |
|
| 73 |
Motif group HL_33983.1
Basepair signature:
|
0.00 | -328.41 | 4.5 | 3 |
|
| 74 |
Motif group HL_04641.1
Basepair signature:
|
0.00 | -332.39 | 6 | 5 |
|
| 75 |
Motif group HL_45785.1
Basepair signature:
|
0.00 | -332.67 | 7 | 6 |
|
| 76 |
Motif group HL_51921.1
Basepair signature:
|
0.00 | -333.78 | 15 | 15 |
|
| 77 |
Motif group HL_02483.1
Basepair signature:
|
0.00 | -335.23 | 7 | 6 |
|
| 78 |
Motif group HL_29129.3
Basepair signature:
|
0.00 | -335.99 | 6 | 5 |
|
| 79 |
Motif group HL_23115.1
Basepair signature:
|
0.00 | -336.46 | 6 | 5.5 |
tRNA D-loop |
| 80 |
Motif group HL_80599.2
Basepair signature:
|
0.00 | -336.71 | 5 | 4 |
|
| 81 |
Motif group HL_61996.2
Basepair signature:
|
0.00 | -338.85 | 5 | 4 |
|
| 82 |
Motif group HL_85434.1
Basepair signature:
|
0.00 | -339.19 | 7 | 6 |
|
| 83 |
Motif group HL_06226.4
Basepair signature:
|
0.00 | -339.86 | 6 | 5.5 |
|
| 84 |
Motif group HL_80362.1
Basepair signature:
|
0.00 | -341.86 | 4.5 | 4 |
|
| 85 |
Motif group HL_91503.7
Basepair signature:
|
0.00 | -349.12 | 6 | 5 |
|
| 86 |
Motif group HL_13971.1
Basepair signature:
|
0.00 | -350.40 | 9 | 8 |
|
| 87 |
Motif group HL_99769.3
Basepair signature:
|
0.00 | -354.10 | 7 | 6 |
|
| 88 |
Motif group HL_23010.1
Basepair signature:
|
0.00 | -354.99 | 6 | 5 |
|
| 89 |
Motif group HL_38046.1
Basepair signature:
|
0.00 | -358.91 | 7 | 5 |
|
| 90 |
Motif group HL_29762.1
Basepair signature:
|
0.00 | -361.07 | 7 | 6 |
|
| 91 |
Motif group HL_73266.9
Basepair signature:
|
0.00 | -362.11 | 5 | 3 |
|
| 92 |
Motif group HL_32735.2
Basepair signature:
|
0.00 | -362.28 | 5 | 4 |
|
| 93 |
Motif group HL_80411.1
Basepair signature:
|
0.00 | -364.54 | 7 | 6 |
tRNA D-loop |
| 94 |
Motif group HL_93135.1
Basepair signature:
|
0.00 | -365.55 | 6 | 5 |
Pseudoknot |
| 95 |
Motif group HL_93616.2
Basepair signature:
|
0.00 | -366.28 | 6 | 6 |
tRNA D-loop |
| 96 |
Motif group HL_85367.2
Basepair signature:
|
0.00 | -366.69 | 5 | 4 |
|
| 97 |
Motif group HL_38808.1
Basepair signature:
|
0.00 | -366.95 | 4 | 2 |
|
| 98 |
Motif group HL_81545.2
Basepair signature:
|
0.00 | -369.77 | 7 | 6 |
|
| 99 |
Motif group HL_49941.1
Basepair signature:
|
0.00 | -370.04 | 6 | 5 |
tRNA D-loop |
| 100 |
Motif group HL_18423.1
Basepair signature:
|
0.00 | -372.84 | 7 | 6 |
|
| 101 |
Motif group HL_45175.1
Basepair signature:
|
0.00 | -374.37 | 5 | 5 |
tRNA D-loop |
| 102 |
Motif group HL_20743.5
Basepair signature:
|
0.00 | -378.12 | 6 | 5 |
|
| 103 |
Motif group HL_98252.1
Basepair signature:
|
0.00 | -380.13 | 9 | 8 |
|
| 104 |
Motif group HL_99748.1
Basepair signature:
|
0.00 | -382.86 | 4.5 | 4 |
Other HL |
| 105 |
Motif group HL_28252.8
Basepair signature:
|
0.00 | -384.47 | 4 | 3 |
T-loop with 2 stacked bulged bases |
| 106 |
Motif group HL_25061.1
Basepair signature:
|
0.00 | -384.59 | 5.5 | 5 |
|
| 107 |
Motif group HL_75293.5
Basepair signature:
|
0.00 | -385.36 | 5 | 4 |
|
| 108 |
Motif group HL_27670.2
Basepair signature:
|
0.00 | -385.49 | 5 | 3 |
T-loop with unstacked turn |
| 109 |
Motif group HL_88558.1
Basepair signature:
|
0.00 | -389.12 | 7 | 7 |
|
| 110 |
Motif group HL_92488.1
Basepair signature:
|
0.00 | -391.48 | 10 | 9 |
|
| 111 |
Motif group HL_01962.2
Basepair signature:
|
0.00 | -392.93 | 7 | 5 |
|
| 112 |
Motif group HL_69139.1
Basepair signature:
|
0.00 | -399.05 | 7 | 6 |
|
| 113 |
Motif group HL_07480.2
Basepair signature:
|
0.00 | -400.47 | 8 | 6 |
|
| 114 |
Motif group HL_89567.2
Basepair signature:
|
0.00 | -403.09 | 3 | 2 |
|
| 115 |
Motif group HL_50537.6
Basepair signature:
|
0.00 | -410.21 | 4 | 3 |
tRNA anticodon loop with synthetase |
| 116 |
Motif group HL_89893.1
Basepair signature:
|
0.00 | -412.09 | 5 | 4 |
|
| 117 |
Motif group HL_72628.1
Basepair signature:
|
0.00 | -412.50 | 5 | 4 |
|
| 118 |
Motif group HL_64690.6
Basepair signature:
|
0.00 | -413.19 | 4 | 4 |
|
| 119 |
Motif group HL_84299.4
Basepair signature:
|
0.00 | -419.12 | 5 | 4 |
|
| 120 |
Motif group HL_73255.1
Basepair signature:
|
0.00 | -420.56 | 6 | 5 |
|
| 121 |
Motif group HL_25847.2
Basepair signature:
|
0.00 | -424.05 | 7 | 6 |
|
| 122 |
Motif group HL_00914.1
Basepair signature:
|
0.00 | -429.00 | 5 | 3 |
|
| 123 |
Motif group HL_06059.6
Basepair signature:
|
0.00 | -432.42 | 3 | 2 |
tRNA anticodon loop |
| 124 |
Motif group HL_47854.1
Basepair signature:
|
0.00 | -434.76 | 6 | 5 |
|
| 125 |
Motif group HL_51447.1
Basepair signature:
|
0.00 | -435.22 | 5 | 5 |
|
| 126 |
Motif group HL_21372.1
Basepair signature:
|
0.00 | -436.68 | 5 | 3 |
|
| 127 |
Motif group HL_66482.1
Basepair signature:
|
0.00 | -438.69 | 11 | 11 |
|
| 128 |
Motif group HL_35677.3
Basepair signature:
|
0.00 | -439.70 | 6 | 5 |
|
| 129 |
Motif group HL_02817.2
Basepair signature:
|
0.00 | -440.49 | 4 | 4 |
|
| 130 |
Motif group HL_25967.2
Basepair signature:
|
0.00 | -440.51 | 5 | 4 |
|
| 131 |
Motif group HL_86769.4
Basepair signature:
|
0.00 | -454.28 | 4 | 3 |
|
| 132 |
Motif group HL_13529.1
Basepair signature:
|
0.00 | -461.65 | 5 | 5 |
|
| 133 |
Motif group HL_37344.1
Basepair signature:
|
0.00 | -466.05 | 4.5 | 4 |
|
| 134 |
Motif group HL_77082.1
Basepair signature:
|
0.00 | -466.78 | 3 | 3 |
Pseudoknot geometry |
| 135 |
Motif group HL_34964.1
Basepair signature:
|
0.00 | -466.94 | 7 | 6 |
|
| 136 |
Motif group HL_04171.7
Basepair signature:
|
0.00 | -477.45 | 7 | 6 |
|
| 137 |
Motif group HL_22584.6
Basepair signature:
|
0.00 | -479.28 | 3 | 3 |
Fab BL3-6 binding hairpin with tSW |
| 138 |
Motif group HL_50006.2
Basepair signature:
|
0.00 | -485.04 | 2 | 2 |
|
| 139 |
Motif group HL_42046.2
Basepair signature:
|
0.00 | -485.05 | 5 | 4 |
|
| 140 |
Motif group HL_99040.1
Basepair signature:
|
0.00 | -487.13 | 4 | 3 |
|
| 141 |
Motif group HL_88205.2
Basepair signature:
|
0.00 | -500.73 | 5 | 3 |
|
| 142 |
Motif group HL_65794.5
Basepair signature:
|
0.00 | -502.82 | 3 | 2 |
Pseudoknot geometry |
| 143 |
Motif group HL_31585.4
Basepair signature:
|
0.00 | -507.86 | 3 | 3 |
Purine riboswitch |
| 144 |
Motif group HL_97917.2
Basepair signature:
|
0.00 | -508.85 | 4 | 3 |
|
| 145 |
Motif group HL_80922.2
Basepair signature:
|
0.00 | -511.37 | 3 | 3 |
|
| 146 |
Motif group HL_20535.2
Basepair signature:
|
0.00 | -511.69 | 6 | 4 |
|
| 147 |
Motif group HL_04783.2
Basepair signature:
|
0.00 | -512.25 | 3 | 2 |
|
| 148 |
Motif group HL_81538.2
Basepair signature:
|
0.00 | -515.72 | 3 | 3 |
GNRA with tandem sheared |
| 149 |
Motif group HL_93535.1
Basepair signature:
|
0.00 | -517.93 | 4 | 3 |
|
| 150 |
Motif group HL_82710.2
Basepair signature:
|
0.00 | -523.07 | 4 | 2 |
|
| 151 |
Motif group HL_20811.4
Basepair signature:
|
0.00 | -527.40 | 4 | 2 |
tRNA D-loop |
| 152 |
Motif group HL_48417.5
Basepair signature:
|
0.00 | -531.28 | 3 | 3 |
|
| 153 |
Motif group HL_62934.1
Basepair signature:
|
0.00 | -535.41 | 4 | 3 |
|
| 154 |
Motif group HL_67667.2
Basepair signature:
|
0.00 | -536.81 | 5 | 4 |
|
| 155 |
Motif group HL_87954.2
Basepair signature:
|
0.00 | -538.12 | 4 | 3 |
|
| 156 |
Motif group HL_78197.1
Basepair signature:
|
0.00 | -539.53 | 5 | 3 |
|
| 157 |
Motif group HL_37824.7
Basepair signature:
|
0.00 | -540.59 | 2 | 2 |
GNRA |
| 158 |
Motif group HL_50318.1
Basepair signature:
|
0.00 | -546.15 | 5 | 4 |
|
| 159 |
Motif group HL_39243.1
Basepair signature:
|
0.00 | -546.95 | 6 | 4 |
|
| 160 |
Motif group HL_15574.1
Basepair signature:
|
0.00 | -547.66 | 5 | 4 |
|
| 161 |
Motif group HL_86870.2
Basepair signature:
|
0.00 | -548.63 | 4 | 3 |
|
| 162 |
Motif group HL_59843.1
Basepair signature:
|
0.00 | -548.80 | 4 | 4 |
|
| 163 |
Motif group HL_57176.2
Basepair signature:
|
0.00 | -549.26 | 4 | 3 |
Pseudoknot geometry with 3' bulge |
| 164 |
Motif group HL_89199.2
Basepair signature:
|
0.00 | -549.71 | 4 | 3 |
Mini UNCG |
| 165 |
Motif group HL_07886.3
Basepair signature:
|
0.00 | -551.98 | 4 | 3 |
|
| 166 |
Motif group HL_97756.2
Basepair signature:
|
0.00 | -553.91 | 9 | 8 |
|
| 167 |
Motif group HL_08100.1
Basepair signature:
|
0.00 | -553.93 | 4.5 | 3 |
|
| 168 |
Motif group HL_49922.4
Basepair signature:
|
0.00 | -554.79 | 4 | 3 |
|
| 169 |
Motif group HL_13189.1
Basepair signature:
|
0.00 | -555.77 | 3.5 | 3 |
|
| 170 |
Motif group HL_59735.5
Basepair signature:
|
0.00 | -556.56 | 4 | 3 |
|
| 171 |
Motif group HL_71391.1
Basepair signature:
|
0.00 | -558.70 | 4 | 2 |
|
| 172 |
Motif group HL_57875.1
Basepair signature:
|
0.00 | -566.39 | 4 | 3 |
|
| 173 |
Motif group HL_75660.5
Basepair signature:
|
0.00 | -573.86 | 3 | 3 |
|
| 174 |
Motif group HL_38901.2
Basepair signature:
|
0.00 | -575.35 | 4 | 3 |
tRNA D-loop |
| 175 |
Motif group HL_38168.1
Basepair signature:
|
0.00 | -575.58 | 5 | 4 |
|
| 176 |
Motif group HL_93324.4
Basepair signature:
|
0.00 | -576.50 | 3.5 | 3 |
Pseudoknot geometry |
| 177 |
Motif group HL_56676.1
Basepair signature:
|
0.00 | -580.04 | 4 | 3 |
|
| 178 |
Motif group HL_56334.1
Basepair signature:
|
0.00 | -580.83 | 3 | 2 |
Mini UNCG |
| 179 |
Motif group HL_55195.3
Basepair signature:
|
0.00 | -583.33 | 3.5 | 3 |
|
| 180 |
Motif group HL_80709.3
Basepair signature:
|
0.00 | -584.95 | 3 | 3 |
|
| 181 |
Motif group HL_28791.1
Basepair signature:
|
0.00 | -585.27 | 4 | 3 |
|
| 182 |
Motif group HL_46501.1
Basepair signature:
|
0.00 | -585.43 | 4 | 2 |
|
| 183 |
Motif group HL_27483.1
Basepair signature:
|
0.00 | -585.75 | 5 | 4 |
|
| 184 |
Motif group HL_81100.2
Basepair signature:
|
0.00 | -586.25 | 4 | 3 |
|
| 185 |
Motif group HL_47787.2
Basepair signature:
|
0.00 | -589.35 | 4 | 3 |
|
| 186 |
Motif group HL_43517.1
Basepair signature:
|
0.00 | -591.00 | 4.5 | 4 |
|
| 187 |
Motif group HL_34617.5
Basepair signature:
|
0.00 | -592.24 | 3 | 3 |
UNCG |
| 188 |
Motif group HL_22135.1
Basepair signature:
|
0.00 | -595.14 | 4 | 3 |
|
| 189 |
Motif group HL_52953.3
Basepair signature:
|
0.00 | -598.77 | 3 | 3 |
|
| 190 |
Motif group HL_69752.2
Basepair signature:
|
0.00 | -601.63 | 5 | 4 |
|
| 191 |
Motif group HL_65313.1
Basepair signature:
|
0.00 | -624.45 | 5.5 | 5 |
|
| 192 |
Motif group HL_78677.1
Basepair signature:
|
0.00 | -625.41 | 4 | 4 |
|
| 193 |
Motif group HL_32346.4
Basepair signature:
|
0.00 | -632.47 | 3 | 3 |
|
| 194 |
Motif group HL_32392.1
Basepair signature:
|
0.00 | -632.59 | 5 | 4 |
|
| 195 |
Motif group HL_29966.1
Basepair signature:
|
0.00 | -641.33 | 7 | 5 |
|
| 196 |
Motif group HL_35941.1
Basepair signature:
|
0.00 | -643.81 | 4 | 4 |
|
| 197 |
Motif group HL_48778.2
Basepair signature:
|
0.00 | -645.88 | 3 | 3 |
Mini UNCG |
| 198 |
Motif group HL_60914.1
Basepair signature:
|
0.00 | -651.21 | 5 | 4 |
|
| 199 |
Motif group HL_86883.1
Basepair signature:
|
0.00 | -687.40 | 6 | 5 |
|
| 200 |
Motif group HL_26631.1
Basepair signature:
|
0.00 | -706.99 | 5 | 4 |
|
| 201 |
Motif group HL_94980.1
Basepair signature:
|
0.00 | -768.06 | 6 | 5 |
|
| 202 |
Motif group HL_89346.1
Basepair signature:
|
0.00 | -1830.78 | 13 | 13 |
|
| 203 |
Motif group HL_33074.4
Basepair signature:
|
0.00 | -1925.57 | 7 | 7 |
U1 small nuclear ribonucleoprotein A binding hairpin |
| 204 |
Motif group HL_73183.1
Basepair signature:
|
0.00 | -2258.99 | 9 | 8 |
Pseudoknot geometry with G-bulge |
| 205 |
Motif group HL_67407.5
Basepair signature:
|
0.00 | -2408.28 | 6 | 5 |
|
| 206 |
Motif group HL_19210.3
Basepair signature:
|
0.00 | -2556.11 | 6 | 5 |
|
| 207 |
Motif group HL_81312.1
Basepair signature:
|
0.00 | -2566.81 | 8 | 8 |
|
| 208 |
Motif group HL_16398.2
Basepair signature:
|
0.00 | -2606.28 | 9 | 8 |
|
| 209 |
Motif group HL_55305.1
Basepair signature:
|
0.00 | -2636.56 | 8 | 7 |
|
| 210 |
Motif group HL_01255.1
Basepair signature:
|
0.00 | -2685.92 | 7 | 6 |
|
| 211 |
Motif group HL_08510.1
Basepair signature:
|
0.00 | -2715.32 | 6 | 4 |
|
| 212 |
Motif group HL_64292.1
Basepair signature:
|
0.00 | -2771.39 | 10 | 10 |
|
| 213 |
Motif group HL_38649.1
Basepair signature:
|
0.00 | -2793.63 | 6 | 5 |
|
| 214 |
Motif group HL_74292.1
Basepair signature:
|
0.00 | -2822.50 | 6 | 4 |
|
| 215 |
Motif group HL_55436.1
Basepair signature:
|
0.00 | -2889.07 | 4 | 4 |
|
| 216 |
Motif group HL_47732.1
Basepair signature:
|
0.00 | -2928.72 | 8 | 7 |
|
| 217 |
Motif group HL_29958.1
Basepair signature:
|
0.00 | -3032.65 | 10 | 8 |
|
| 218 |
Motif group HL_50779.4
Basepair signature:
|
0.00 | -3121.73 | 5 | 4 |
|
| 219 |
Motif group HL_99867.1
Basepair signature:
|
0.00 | -3130.37 | 5 | 3.5 |
|
| 220 |
Motif group HL_20781.1
Basepair signature:
|
0.00 | -3493.74 | 8 | 7 |
|
| 221 |
Motif group HL_93383.1
Basepair signature:
|
0.00 | -3503.55 | 5 | 4 |
|
| 222 |
Motif group HL_42998.2
Basepair signature:
|
0.00 | -3668.06 | 5 | 3 |
|
| 223 |
Motif group HL_07951.3
Basepair signature:
|
0.00 | -3834.69 | 4.5 | 3 |
tRNA D-loop |
| 224 |
Motif group HL_99324.1
Basepair signature:
|
0.00 | -3848.24 | 12 | 11 |
|
| 225 |
Motif group HL_85461.1
Basepair signature:
|
0.00 | -3852.28 | 14 | 13 |
|
| 226 |
Motif group HL_00317.1
Basepair signature:
|
0.00 | -3882.70 | 15 | 14 |
|
| 227 |
Motif group HL_60293.1
Basepair signature:
|
0.00 | -3895.29 | 16.5 | 16 |
G-quadruplex |
| 228 |
Motif group HL_21400.1
Basepair signature:
|
0.00 | -3900.89 | 18 | 17 |
G-quadruplex |
| 229 |
Motif group HL_35354.1
Basepair signature:
|
0.00 | -3904.80 | 19 | 18 |
|
| 230 |
Motif group HL_59564.1
Basepair signature:
|
0.00 | -3914.42 | 15 | 14 |
|
| 231 |
Motif group HL_12758.3
Basepair signature:
|
0.00 | -3918.12 | 18 | 18 |
G-quadruplex |
| 232 |
Motif group HL_97983.1
Basepair signature:
|
0.00 | -3937.01 | 7 | 5 |
|
| 233 |
Motif group HL_58539.1
Basepair signature:
|
0.00 | -4014.36 | 11 | 10 |
|
| 234 |
Motif group HL_50851.1
Basepair signature:
|
0.00 | -4436.31 | 8 | 7 |
G-quadruplex fragment |
| 235 |
Motif group HL_73916.1
Basepair signature:
|
0.00 | -4449.16 | 32 | 32 |
|
| 236 |
Motif group HL_77600.2
Basepair signature:
|
0.00 | -4558.00 | 4 | 2 |
|
| 237 |
Motif group HL_80241.1
Basepair signature:
|
0.00 | -4567.72 | 6 | 5 |
|
| 238 |
Motif group HL_07903.1
Basepair signature:
|
0.00 | -4765.18 | 10 | 9 |
|
| 239 |
Motif group HL_04725.1
Basepair signature:
|
0.00 | -4781.35 | 8 | 7.5 |
|
| 240 |
Motif group HL_88364.2
Basepair signature:
|
0.00 | -4852.62 | 12 | 11 |
|
| 241 |
Motif group HL_31581.6
Basepair signature:
|
0.00 | -4975.50 | 7 | 7 |
|
| 242 |
Motif group HL_63355.1
Basepair signature:
|
0.00 | -5006.03 | 8.5 | 7 |
|
| 243 |
Motif group HL_12870.1
Basepair signature:
|
0.00 | -5070.84 | 8 | 7 |
|
| 244 |
Motif group HL_15118.1
Basepair signature:
|
0.00 | -5324.70 | 7 | 7 |
|
| 245 |
Motif group HL_94376.1
Basepair signature:
|
0.00 | -5384.61 | 7 | 5 |
Pseudoknot geometry |
| 246 |
Motif group HL_70751.1
Basepair signature:
|
0.00 | -5550.41 | 7 | 6 |
|
| 247 |
Motif group HL_36684.4
Basepair signature:
|
0.00 | -5691.35 | 5 | 5 |
|
| 248 |
Motif group HL_78284.1
Basepair signature:
|
0.00 | -5728.56 | 7 | 6 |
|
| 249 |
Motif group HL_24792.1
Basepair signature:
|
0.00 | -5804.44 | 6 | 5 |
|
| 250 |
Motif group HL_50418.1
Basepair signature:
|
0.00 | -5811.30 | 6 | 5 |
|
| 251 |
Motif group HL_68572.1
Basepair signature:
|
0.00 | -5904.47 | 7 | 7 |
|
| 252 |
Motif group HL_09260.2
Basepair signature:
|
0.00 | -6129.78 | 6 | 6 |
tRNA D-loop |
| 253 |
Motif group HL_76094.1
Basepair signature:
|
0.00 | -6322.55 | 5 | 4 |
|